CN106399138A - Oral porcine circovirus II-like particle vaccine, and preparation method and application thereof - Google Patents
Oral porcine circovirus II-like particle vaccine, and preparation method and application thereof Download PDFInfo
- Publication number
- CN106399138A CN106399138A CN201610807435.6A CN201610807435A CN106399138A CN 106399138 A CN106399138 A CN 106399138A CN 201610807435 A CN201610807435 A CN 201610807435A CN 106399138 A CN106399138 A CN 106399138A
- Authority
- CN
- China
- Prior art keywords
- virus
- kluyveromyces marxianus
- porcine circovirus
- restructuring
- kluyveromyces
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/542—Mucosal route oral/gastrointestinal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10023—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Public Health (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides kluyveromyces marxianus recombinant engineering bacteria and an application of the kluyveromyces marxianus recombinant engineering bacteria to the production of an oral porcine circovirus II-like particle vaccine. The recombinant engineering bacteria express porcine circovirus II capsid proteins through kluyveromyces marxianus expression vectors to prepare the oral porcine circovirus II-like particle vaccine. Regulation control elements of the kluyveromyces marxianus expression vectors provided by the invention are all from food-safety-level kluyveromyces, and have the characteristics of no antibiotic resistance genes and escherichia coli sequences. The invention further provides a method for preparing the oral porcine circovirus II-like particle vaccine. By utilizing the oral porcine circovirus II-like particle vaccine provided by the invention, related clinical symptoms caused by PCV2 infection can be reduced and prevented; and the oral porcine circovirus II-like particle vaccine has the advantages of good immune effect, high safety, simple culture operation, high yield, low production cost, capability of performing large-scale enlarged production and the like.
Description
Technical field
The present invention relates to a kind of oral vaccine and its preparation method and application, more particularly, to a kind of oral pig circular ring virus epidemic disease
Seedling and its preparation method and application
Background technology
Pig circular ring virus (Porcine circovirus, PCV) are to find one of animal virus of minimum so far, belong to round
Circoviridae Circovirus, are the sub-thread ring-type minus-strand dna virus of no cyst membrane, and 20 face bodies are symmetrical, diameter 17-20nm it is known that
PCV has two serotypes, i.e. pig annulus I type virus (PCV1) and pig annulus II type virus (PCV2), and wherein, PCV 1 is non-
Pathogenic virus, PCV2 is pathogenic virus.
Although pig circular ring virus genome structure is simple, the harm to animal husbandry is huge, and Porcine circovirus desease is closely several
One of most important viral infectious of year impact world pig industry.
The infection of China's pig annulus II type virus (PCV2) has following three big features：
1) infection rate is high, and infection is wide：Individual positive rate is 21.7-87.3%, and pig farm positive rate is 38.2-100%；
2) infection rate of PCV2 rises year by year：It is within 2003 21.7%, is within 2006 38.3%, be within 2008 70.9%,
It is within 2012 83.2%；
3) PCV2 is serious with the mixed infection of other cause of diseases：In the serum of infection PCV2 virus, it is often able to detect
The blue otopathy poison PRRSV of mixed infection, Pseudorabies virus PRV, parvovirus PPV, mycoplasma pneumoniae, pasteurella multocida,
Epidemic diarrhea virus PEDV, swine influenza virus SIV etc.；Statistics report is had to show PCV2 virus suprainfection rate more than 50%,
With blue otopathy poison PRRSV coinfection rate be 51.9%, Pseudorabies virus PRV coinfection rate be 62.44%, parvovirus PPV altogether
Infection rate is 56.9%.
More severe, it is early (delivery room suckling pig can infect) that the PVC2 in China's pig industry has assumed infection age in days
Situation.Therefore PCV2 has been considered as the important pathogen of world's pig industry, can cause the immunosupress of pig, cause double or
Triple infection, M ＆ M is high, brings significant damage and serious economic loss to pig industry.At present, PCV2 vaccine
Have become as the swine disease vaccine kind that consumption is maximum, consumption is most after swine fever, aftosa, the blue vaccine such as otopathy and pseudo- mad dog,
The huge market demand.
PCV2 vaccine is broadly divided into three classes：Totivirus inactivated vaccine, PCV1-2 recombinant virus inactivated vaccine, and viruslike particle
Subunit vaccine.Wherein, PCV2 subunit vaccine (mainly viruslike particle vaccine) is it has already been proven that immune effect is better than entirely
Inactivation of virus seedling, has significant improvement than inactivated vaccine in security, validity and manufacturing process, is becoming a new generation
The new trend of recombinant vaccine development.
The PCV-2Cap protide virus particle vaccine sold in the market has two classes：
A) class is the PCV2 viruslike particle (prokaryotic expression) of Escherichia coli preparation, ORF2 gene (the Cap egg of PCV-2
In vain) in insertion Escherichia coli prokaryotic vector, using Bacillus coli expression PCV-2Cap albumen, prepare subunit vaccine.Large intestine
The features such as bacillus expression system has fast growth, easily culture, expressing protein yield are high, but the albumen of its expression is mostly with no
The inclusion bodies of activity exist, and after the sequence of operations such as albuminous degeneration renaturation, can obtain soluble protein.But it is former
The easy appearance of nuclear expression does not possess the inclusion body of activity, needs to carry out protein renaturation to improve vaccine effect, high cost, produces week
Phase length (every batch takes about 2-3 month), efficiency are low, and the protein immunogenic of acquisition is poor；Particularly Bacillus coli expression
Although albumen is through purifying, still it is possible to remain endotoxin, immune animal can produce side reaction.
B) another kind of PCV2 viruslike particle vaccine processed is expressed by shaft-like disease by baculoviral/insect cell expression system
The viruslike particle (eukaryotic expression) of poison/insect cell expression system expression, with ORF2 gene (Cap protein) insertion of PCV-2
To insect baculovirus, with Insect cellculture, obtain the PCV-2Cap albumen of restructuring, purified mix with immunologic adjuvant after
Obtain, clinically with injection system immunity, the technological requirement of eukaryotic expression is higher, may be mixed with baculoviral in product
Grain, produces side reaction, there is certain bio-safety risk.
In addition, current PCV2 vaccine is based on injecting, can be used for oral vaccine there is not yet reporting.
Content of the invention
The low production efficiency existing, the defect such as side reaction is big, can not be administered orally for current PCV2 vaccine, the invention provides
A kind of orally available PCV2 vaccine.
The present invention the is to provide a kind of restructuring kluyveromyces marxianus auxotrophic strain on one side, is carried by restructuring
Body conversion kluyveromyces marxianus auxotrophic strain preparation.
Described recombinant vector passes through to encode the pig circular ring virus 2 virus capsid protein (present invention hereinafter also referred to as " pig circular ring virus 2
Virus capsid protein Cap " or " Cap protein ") nucleotides inserted to constructed by kluyveromyces marxianus expression vector.
In an advantageous embodiment, described pig circular ring virus 2 virus capsid protein is preferably Porcine Circovirus viral capsid
Albumen.
Second aspect of the present invention is to provide a kind of method preparing described Porcine Circovirus virus-like particle, bag
Include：
Described restructuring kluyveromyces marxianus recombination engineering cultivation and fermentation, is assembled into pig circular ring virus II in the cell
Virus-like particle；
Collect the bacterium of cultivation and fermentation, obtain Porcine Circovirus virus-like particle.
Or methods described also includes the step that described restructuring kluyveromyces marxianus recombination engineering is constructed as below：
By the nucleotides inserted of coding pig circular ring virus 2 virus capsid protein to kluyveromyces marxianus expression vector, build weight
Group carrier；
Recombinant vector is converted kluyveromyces marxianus auxotrophic strain, builds and obtain described restructuring Marx gram
Yeast recombination engineering is tieed up in Shandong.
In an advantageous embodiment, the bacterium of collected cultivation and fermentation, can be separately as Porcine Circovirus disease
The virus-like particle of release is collected as Porcine Circovirus virus-like particle product after malicious sample grain products, or rupture,
Or the clasmatosis liquid after rupture or broken liquid desciccate are as Porcine Circovirus virus-like particle product.
Third aspect of the present invention is to provide a kind of Porcine Circovirus virus-like particle oral drugs and/or vaccine,
Including described Porcine Circovirus virus-like particle.
The 4th aspect of the present invention provides a kind of Porcine Circovirus virus-like particle medicine and/or vaccine prepared
Method, especially prepares Porcine Circovirus and virus-like particle medicine and/or vaccine is administered orally (Porcine Circovirus virus is drawn
Send out the oral drugs of disease and/or vaccine) method, including with the bacterium of collected cultivation and fermentation or rupture after obtain virus
Sample particle, as active component or as one of active component, prepares Porcine Circovirus virus sample particle vaccines.
In an advantageous embodiment, after collects thalline, direct broken wall, products therefrom is as oral vaccine.
In an advantageous embodiment, releasing virus sample particle after the bacterium rupture of collected cultivation and fermentation, adds protection
Porcine Circovirus virus sample particle vaccines are prepared in agent.
Wherein, described protective agent can be one or more of sucrose, lactose, trehalose.
In another kind of preferred embodiment, after the collected bacterium rupture of cultivation and fermentation, clasmatosis liquid is spray-dried
Prepare Porcine Circovirus virus sample particle vaccines.
The 6th aspect of the present invention is to provide a kind of described Porcine Circovirus virus-like particle or pig circular ring virus II
The application of virus-like particle, preferably prepares the medicine of the disease of prevention and/or treatment Porcine Circovirus virus initiation
And/or vaccine.
In an advantageous embodiment, described pig circular ring virus 2 virus capsid protein amino acid sequence includes (preferably, for)：
1) SEQ ID No.1 amino acid sequence；Or
2) SEQ ID No.1 amino acid sequence is through replacing, lacking or add one or several amino acid and have pig circle
The protein derived from SEQ ID No.1 amino acid sequence of circovirus virus nucleocapsid Cap protein activity.
In an advantageous embodiment, the 226th phenylpropyl alcohol in pig circular ring virus 2 virus capsid protein shown in described SEQ ID No.1
Propylhomoserin is replaced by leucine, such as includes (and being preferably)：SEQ ID No.2 amino acid sequence.
In an advantageous embodiment, the nucleotide series encoding described pig circular ring virus 2 virus capsid protein include and preferred
Sequence shown in SEQ ID No.3
In an advantageous embodiment, in methods described, according to the codon preference of kluyveromyces marxianus, to volume
The nucleotides of the described pig circular ring virus 2 virus capsid protein of code carries out codon optimization, is more preferably ensureing coding pig circular ring virus clothing
Carry out codon optimization under the conditions of glutelin sequence identical.
In an advantageous embodiment, described kluyveromyces marxianus expression vector includes kluyveromyces marxianus chrysanthemum
Powder enzyme promoter gene and terminator gene order, and preferably do not contain non-resistant gene order, the initial duplication of Escherichia coli
Sequence.It is highly preferred that described kluyveromyces marxianus expression vector includes and preferably constitutes core shown in SEQ ID No.6
Nucleotide sequence.
In an advantageous embodiment, described kluyveromyces marxianus expression vector auxotrophy riddled basins.
In a kind of preferred embodiment of the present invention, described recombinant vector includes kluyveromyces marxianus autonomous replication
Sequence, kluyveromyces marxianus inulinase promoter gene sequence, the gene order of coding pig circular ring virus 2 virus capsid protein, horse
Gram this kluyveromyces inulinase terminator gene order, auxotrophy riddled basins sequence；It is highly preferred that do not contain having or not
Resistance gene sequences, Escherichia coli initiate replication sequence.
The auxotrophic strain of kluyveromyces marxianus of the present invention, is kluyveromyces marxianus knockout part
Or whole specific nutrition gene gained.Described specific nutrition gene be preferably selected from URA3 gene, HIS3 gene, in ADE2 gene
Any one or a few, and be preferably URA3 gene.
Wherein, in a kind of more preferred embodiment, described kluyveromyces marxianus auxotrophic strain is in Uracil
Can not grow in auxotrophy culture medium.
In a preferred embodiment of the invention, above-mentioned kluyveromyces marxianus are preferably CGMCC No.10621.Should
Bacterial strain is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, depositary institution address：Beijing is exposed to the sun
Area North Star West Road 1 No. 3 Institute of Microorganism, Academia Sinica of institute, preservation date is on March 13rd, 2015.
In one preferred embodiment of the invention, described conversion can be any one in electricity conversion or chemical conversion
Or it is several.
In one preferred embodiment of the invention, glucose, sulphur are contained in described recombination yeast culture used medium
Sour ammonium, magnesium sulfate, potassium dihydrogen phosphate.
Wherein, described Porcine Circovirus virus-like particle or Porcine Circovirus virus sample particle vaccines are preferably
The medicine of the disease causing for preparation prevention and/or treatment Porcine Circovirus virus and/or vaccine.
Described application preferably comprises but is not limited to as oral vaccine, as in feed addictive, drinking water additive
Any one or a few.
Wherein, the disease that described Porcine Circovirus virus causes includes but is not limited to postweaning multisystemic exhaustion
Syndrome, pigskin inflammation nephrotic syndrome, any one or a few in piglet congenital tremors and sow breeding difficulty.
In one preferred embodiment of the invention, described any vaccine can be preferably solid pharmaceutical preparation, liquid preparation,
Any one or a few in semisolid preparation, gaseous formulation, and it is preferably solid pharmaceutical preparation.
Wherein, described any vaccine can be but be not limited to dry powder, particle, tablet, capsule, paste, aerosol, spraying
Agent, solution, suspension, any one or a few in emulsion.
In one preferred embodiment of the invention, described any vaccine can also include auxiliary material, and auxiliary material is preferably permissible
Be but be not limited to flavouring, preservative, NMF, disintegrant, lubricant, wetting agent, filler, adhesive or caking inhibiter,
Suspending agent, pigment, release retarding agent, diluent, solubilizer, solvent, flocculant or deflocculant, defoamer or foaming agent, increasing
Thick dose, plasticizer, buffer, pH value regulator, any one or a few in emulsifying agent.
In one preferred embodiment of the invention, described any vaccine can also include adjuvant, and adjuvant is preferably permissible
It is but be not limited to oil-in-water, Water-In-Oil, any one or a few in W/O/W adjuvant.
The above-mentioned various aspects of the present invention and each embodiment can be mutually combined by those skilled in the art, various
Combination is also within the scope of present invention.
The Porcine Circovirus virus-like particle or Porcine Circovirus virus sample particle vaccines, excellent that the present invention provides
Elect oral vaccine as, can reduce and prevent to infect correlative clinical symptom caused by PCV2, there is orally available, immune effect
Good, safe, culture is simple to operate, and yield is high, low production cost and the advantages of can amplify production on a large scale.
Brief description
Fig. 1 is the pcr amplified DNA electrophoretogram of Cap gene；
Fig. 2 is Cap protein kluyveromyces marxianus recombinant vector pUKD-N125/Cap schematic diagram；
Fig. 3 is expression in kluyveromyces marxianus for the pig circular ring virus II Cap protein；Wherein, swimming lane 1：Fim-
1ura3Δ；Swimming lane 2：The full cell pyrolysis liquid of Fim-1ura3 Δ-pUKD-N125/Cap recombination yeast；Swimming lane 3：Fim-1ura3
Δ-pUKD-N125/Cap recombination yeast solution liquid supernatant；
Fig. 4 expresses the Western blotting Western Blot inspection of pig circular ring virus II Cap protein for kluyveromyces marxianus
Survey reaches；Wherein, swimming lane 1：Fim-1ura3Δ；Swimming lane 2：Fim-1ura3 Δ-pUKD-N125/Cap recombination yeast；
Fig. 5 expresses PCV virus-like particle electron microscope observation for kluyveromyces marxianus；
Fig. 6 is Fim-1ura3 Δ-pUKD-N125/Cap recombination yeast pilot scale fermentation growth curve；
Fig. 7 is Cap protein under identical bacterium amount during Fim-1ura3 Δ-pUKD-N125/Cap recombination yeast pilot scale fermentation
Expression；
Fig. 8 is PCV-II vaccine to be administered orally and injects Cap IgG antibody level ratio in serum after import vaccine immune mouse
Relatively；
Fig. 9 is administered orally, for mouse feeding, the Cap IgA antibody level producing in the excrement of PCV-II vaccine.
Specific embodiment
Embodiment 1, the structure of PCV capsid protein recombinant expression carrier pUKD-N125/Cap
In the present embodiment, coding pig circular ring virus 2 virus capsid protein (is also referred to as " pig circular ring virus capsid Cap egg in context
In vain " or " Cap protein ") the gene of amino acid sequence there is the sequence of SEQ ID No.3.According to kluyveromyces marxianus
Codon preference, Cap gene order is carried out with codon optimization, and the Cap gene order after optimizing manually is closed
Become.
Coded Cap protein amino acid sequence can be as shown in SEQ ID No.1, or 226 in SEQ ID No.1
The phenylalanine of position substitutes (as SEQ ID No.2) by leucine.
Using the method for PCR amplification, with PCVN125-F (5'-
) and PCVN125-R (5'- TTTTTTTGTTAGATCCGCGGATGACATATCCAAGGAGGCGTTTC-3'
AGCTTGCGGCCTTAACTAGTTCA CTTAGGGTTAAGTGGAGGGTCCTTAAG-3') it is primer amplification Cap gene.Warp
After 1% agarose gel electrophoresis use DNA gel kit reclaim 700kb about fragment (as Fig. 1).
There is provided pUKD-N125 carrier (SEQ ID No.6), this carrier is by PUKD-N118 carrier (with reference to Chinese invention patent
Apply for PUKDN118 in 201510562564.9 embodiments) build, construction method is as follows：
Forward primer 5'-ACTAGTTAAGGCCGCAAGCTTTGATCTGATCTGC-3' and reverse primer 5'-
TCCCCCGCGGATCTAACAAAAAAAAAATTAAATG-3' enters performing PCR amplification to PUKDN118 plasmid, and amplified fragments include
Inulinase terminator, KmURA3 promoter, KmURA3ORF, yeast autonomously replicating sequence and inulinase promoter；
Carried out plus A process using the many amplified fragments of Taq enzyme, then recovery product is connected with PMD18-T carrier；Sequencing
Afterwards, SacII and SpeI carries out digestion and obtains pUKD-N125 carrier.
In pUKD-N125 carrier, including kluyveromyces marxianus autonomously replicating sequence, kluyveromyces marxianus inulin
Enzyme promoter sequence, kluyveromyces marxianus inulinase terminator sequence, the auxotrophy screening of kluyveromyces marxianus
Marker gene URA3 (KmURA3ORF), does not contain Escherichia coli sequence.
Using Sac II and Spe II two restricted digestion pUKD-N125 carrier, 1% agarose gel electrophoresis, use DNA
Gel reagents box reclaim 8kb about carrier segments
Cap genetic fragment and the method being connected by Gibson Assembly of carrier segments, with NEB company
Gibson Assembly traceless linker system (production code member E2611S/L), builds recombinant vector pUKD-N125/Cap, such as Fig. 2
Shown, the gene order (PCV2CAP) of coding Cap protein is inserted in carrier.
Embodiment 2, PCV capsid protein Cap protein kluyveromyces marxianus genetic engineering bacterium Fim-1ura3 Δ-
The structure of pUKD-N125/Cap and Cap expression analysis
Kluyveromyces marxianus uracil auxotrophy bacterial strain Fim-1ura3 Δ, the preparation method of this bacterial strain are provided
Refer to the construction method of the bacterial strain of Fim-1 (ura3 Δ) disclosed in Chinese patent publication document CN105112313A embodiment 1.
Fim-1ura3 Δ is inoculated in the teat glass of the culture medium of YEPD containing 3mL, and 30 DEG C of incubator overnight are cultivated to OD600
For 12-15.Collects thalline, LiAc-TE solution (100mM LiAc, 10mM Tris-HCl, 1mM EDTA) washs.
Carrier DNA, recombinant vector pUKD-N125/Cap, PEG solution (40%PEG is sequentially added in thalline
4000th, 100m M LiAc, 10mM Tris-HCl pH 7.5,1mM EDTA) and final concentration of 10mM DTT, after fully mixing,
30 DEG C of water-bath 15min, 47 DEG C of water-bath 15min, 8000rpm wink is from abandoning supernatant, plus 100 μ L sterilized water suspension thallines, apply SD flat board
(0.67% no amino yeast nitrogen YNB, 2% glucose, 2% agar), 30 DEG C of cultures 2-4 days are until Clone formation.
The identification of recombinant bacterium is passed through to extract genome, is entered with Cap gene specific PCVN125-F and PCVN125-R primer
PCR verifies, amplify 700bp about band for positive colony, as proceed to the gene of pUKD-N125/Cap recombinant vector
Engineering bacteria Fim-1ura3 Δ-pUKD-N125/Cap.
Embodiment 3, kluyveromyces marxianus genetic engineering bacterium Fim-1ura3 Δ-pUKD-N125/Cap expresses Cap egg
The assembling of bletilla virus-like particle
The positive clone of PCR checking is inoculated in the YP culture medium (1% yeast extract (Yeast equipped with 50ml
Extract), 2% glucose) triangle shaking flask in, 30 DEG C, 220rpm culture 96h after cell is collected by centrifugation, using high-pressure homogeneous
Method smudge cells, cell pyrolysis liquid carries out polyacrylamide gel protein electrophoresis SDS-PAG (polyacrylamide gel
Electrophoresis, PAGE) and PCV antibody immunoblotting Western Blot detection pig circular ring virus (PCV) Cap protein
Expression in kluyveromyces.
Contrast with compareing bacterium Fim-1ura3 Δ (the 1st swimming lane), genetic engineering bacterium Fim-1ura3 Δ-pUKD-N125/Cap
Full cell pyrolysis liquid and supernatant (the 2nd and the 3rd swimming lane) in the many one article of protein bands (as Fig. 3) of 35-40kD size, this albumen
Band is the Cap protein of pig circular ring virus, and obtains solubility expression.
Verify the Cap protein of Fim-1ura3 Δ-pUKD-N125/Cap expression further with Western Blot.Experiment
Step is as follows：By cell pyrolysis liquid sample after protein electrophorese SDS-PAGE, the Trans-Blot using Bio-Rad company will
Protein delivery (220mA, 100min) to nitrocellulose filter, then by film containing 5% skimmed milk power TBST buffer solution
Incubated at room 2h in (20mM Tris-HCl pH 8.0,137mM NaCl, 0.1%Tween 20), anti-PCV antibody Swine serum
Resist 1 400 dilutions, after 4 degree of night incubation, TBST washes 3 times more, the 1 2500 times of dilutions of goat-anti pig HRP ELIAS secondary antibody, incubated at room
After 1.5h, TBST wash 3 times, add pig circular ring virus antibody A, the nitrite ion of B mixed in equal amounts, observe result.
Result：Fim-1ura3 Δ (the 1st swimming lane) does not have Western blotting band, and Fim-1ura3 Δ-pUKD-N125/Cap
The Strip Immunoblot of 25-35kD in sample (the 2nd swimming lane), basically identical with the theoretical molecular 28kD of Cap protein it was demonstrated that egg
Informal voucher band is the Cap protein (Fig. 4) of PCV-II.
Using Electron Microscope images technology, observe the Cap that Fim-1ura3 Δ-pUKD-N125/Cap expresses PCV-II
Whether albumen completes self assembly becomes virus-like particle VLPs, finds Fim-1ura3 Δ-pUKD-N125/ after Shaking culture 92h
Cap exist size about 17-20nm about virion (as Fig. 5).
Embodiment 4, kluyveromyces marxianus genetic engineering bacterium Fim-1ura3 Δ-pUKD-N125/Cap ferments and is administered orally
The preparation of vaccine
Kluyveromyces marxianus genetic engineering bacterium Fim-1ura3 Δ-pUKD-N125/Cap enters in 5 liters of fermentation tank
Row high density fermentation, using synthetic media (containing compositions such as glucose, ammonium sulfate, magnesium sulfate, potassium dihydrogen phosphates), is added by stream
Fed-batch fermentation, after fermentation 48h, cell density OD600 reaches 271 (as Fig. 6), and biomass reaches 102g/L (dry cell weight), by electrophoresis
Detection and gray scale scanning, the yield of Porcine circovirus type 2 Cap reaches 2g/L (as Fig. 7).
Fermentation 48 hours after collects thalline, be washed with deionized 3 times, with phosphate buffer PBS resuspended after, using high pressure
The method smudge cells of homogeneous, adds protective agent sucrose or Direct spraying that the oral Porcine Circovirus oral virus of system is dried
Sample particle vaccines.
Embodiment 5, the PCV-II vaccine immune mouse of oral kluyveromyces marxianus preparation
From 6 week old Healthy female SPF level Balb/c mouse, random packet, every group each 7.First group is blank group, feeds
Food PBS (PBS) is not cooked immunity；Second group is control group, injection import company circovirus type II vaccine (0.3mL/ is only), the
Three groups is immune group：The oral virus-like oral vaccine of the Porcine Circovirus (KM is administered orally) that the feeding present invention provides, every
Mouse feeding dosage 100 μ g Cap protein/time, after head exempts from 1 week, repeat 4 (feeding times of feeding by identical approach and dosage：0
My god, 7 days, 14 days, 21 days, 28 days).
Before feeding, mouse orbit rear vein beard takes blood, and the blood taken is put into 1h in 37 degree of incubators, then 4 DEG C,
3000rpm is centrifuged 4min, draws serum in new EP with the pipettor of 10 μ l, puts -20 DEG C of Refrigerator stores.The excrement of collection claims
Weight, adds ten times of TBST (sodium azide containing 0.01%), and after vortex oscillation mixes, 14000rpm is centrifuged 10min, takes
Clearly in new EP manages, carry out mark, put -20 DEG C of refrigerators.
In mice serum, the detection of the content of anti-PCV cap IgG antibody adopts Wuhan Ke Qian biological products Co., Ltd pig
Circovirus type II ELISA antibody assay kit, detecting step is as follows：
1) take antigen coated microplate, every hole adds TBST 200ul, outwells, pat dry on blotting paper after static 3min, washing
Twice.
2) serum to be checked of 1 100 dilutions, static 45min in 37 degree of incubators are added.
3) discard the sample in hole, add 200ul TBST after being patted dry with blotting paper, outwell after static 3min, pat dry, altogether
Meter washing 5 times.
4) every hole adds the sheep anti-mouse igg ELIAS secondary antibody of 1 33000 dilutions, 37 degree of standing 30min.
5) discard the liquid in plate, cleaning, method same 3)
6) add substrate solution A and B of 100ul mixed in equal amounts, lucifuge colour developing 10min under room temperature.
7) add sulfuric acid reaction terminate liquid 50ul in every hole, detect the light absorption value under 450nm with ELIASA.
Antibody is produced, mice serum produces in the 2 weeks serum of oral circovirus type II vaccine of mouse feeding present invention preparation
Raw anti-PCV Cap IgG antibody (as Fig. 8).After immunity 6 weeks, the PCV Cap IgG antibody in mice serum reaches peak value, averagely
Titre reaches more than 10000, and vaccinate (purifying PCV Cap protein) antibody horizontal is suitable with import, but the present invention more premature labor
Raw antibody.Additionally, the antibody that the PCV-II epidemic disease II type vaccine that the oral present invention provides produces can continue more than 20 weeks, and resist
Body titre is maintained at more than 10000, illustrates that the oral PCV-II of present invention preparation has good immune effect.
In excrement, the detection of anti-PCV Cap IgA antibody content adopts ELIAS secondary antibody to use sheep anti mouse IgA α chain-HRP (English
Abcam company of state, article No. ab97235), method of operating is with the detection of PCV Cap IgG antibody anti-in serum.With reference to Fig. 9, mouse
Feed and of the present invention PCV-II vaccine (KM be administered orally) is administered orally after 28 and 35 days, the IgA antibody in excrement is significantly higher than blank control group
(PBS), illustrate that the PCV-II oral vaccine of present invention preparation can significantly improve the mucosal immunity effect of mouse, produce PCV
Cap IgA antibody.
Above the specific embodiment of the present invention is described in detail, but it has been intended only as example, the present invention has not limited
It is formed on particular embodiments described above.To those skilled in the art, any equivalent modifications that the present invention is carried out and
Substitute also all among scope of the invention.Therefore, the impartial conversion made without departing from the spirit and scope of the invention and
Modification, all should cover within the scope of the invention.
Claims (17)
1. a kind of restructuring kluyveromyces marxianus recombination engineering is it is characterised in that convert Marx's Crewe by recombinant vector
Constructed by dimension yeast nutrition deficient strain,
Wherein, described recombinant vector passes through for the nucleotides inserted of coding pig circular ring virus 2 virus capsid protein to tie up ferment to Marx's Crewe
Constructed by female expression vector, wherein, described kluyveromyces marxianus expression vector includes kluyveromyces marxianus inulinase
Promoter gene sequence, kluyveromyces marxianus inulinase terminator gene order, and do not contain non-resistant gene order, big
Enterobacteria initiates replication sequence.
2. restructuring kluyveromyces marxianus recombination engineering according to claim 1 is it is characterised in that include Marx
Kluyveromyces autonomously replicating sequence, kluyveromyces marxianus inulinase promoter gene sequence, coding pig circular ring virus clothing
The gene order of glutelin, kluyveromyces marxianus inulinase terminator gene order, auxotrophy riddled basins sequence
Row；And do not contain non-resistant gene order, the initial replication sequence of Escherichia coli.
3. restructuring kluyveromyces marxianus recombination engineering according to claim 1 is it is characterised in that described Marx
The nucleotides sequence of kluyveromyces lactis expression vector is classified as SEQ ID No.6.
4. restructuring kluyveromyces marxianus recombination engineering according to claim 1 is it is characterised in that described pig annulus
Viral capsid proteins amino acid sequence includes：
1) SEQ ID No.1 nucleotide sequence；Or
2) SEQ ID No.1 nucleotide sequence is through replacing, lacking or add one or several amino acid and have pig circular ring virus 2
The protein derived from SEQ ID No.1 nucleotide sequence of malicious nucleocapsid Cap protein activity.
5. restructuring kluyveromyces marxianus recombination engineering according to claim 4 is it is characterised in that described pig annulus
Viral capsid proteins amino acid sequence includes SEQ ID No.2 nucleotide sequence.
6. restructuring kluyveromyces marxianus recombination engineering according to claim 1 is it is characterised in that described Marx
The auxotrophic strain of kluyveromyces, is that kluyveromyces marxianus knock out part or all of specific nutrition gene gained.
7. restructuring kluyveromyces marxianus recombination engineering according to claim 6 is it is characterised in that described nutrition is sieved
Gene is selected to be selected from kluyveromyces marxianus URA3 gene.
8. restructuring kluyveromyces marxianus recombination engineering according to claim 6 is it is characterised in that described Marx
Kluyveromyces are CGMCC No.10621.
9. a kind of method of Porcine Circovirus virus-like particle is it is characterised in that step includes：
Described in claim 1, restructuring kluyveromyces marxianus recombination engineering cultivation and fermentation, is assembled into pig annulus in the cell
Virus Type II virus-like particle；
Collect the bacterium of cultivation and fermentation, or the bacterium of collection is crushed.
10. method according to claim 9 is it is characterised in that also include described restructuring Marx Crewe dimension is constructed as below
The step of yeast recombination engineering：
By the nucleotides inserted of coding pig circular ring virus 2 virus capsid protein to kluyveromyces marxianus expression vector, build restructuring and carry
Body,
Described recombinant conversion is expressed kluyveromyces marxianus auxotrophic strain, builds and obtain described restructuring Marx gram
Yeast recombination engineering is tieed up in Shandong.
11. methods according to claim 9 it is characterised in that according to the codon preference of kluyveromyces marxianus,
Carry out codon optimization under the conditions of ensureing coding pig circular ring virus capsid protein sequence identical.
Restructuring kluyveromyces marxianus recombination engineering or pig annulus described in claim 9 described in a kind of 12. claims 6
The application of virus Type II virus-like particle is it is characterised in that draw for preparation prevention and/or treatment Porcine Circovirus virus
The medicine of disease sent out and/or vaccine.
13. applications according to claim 12 are it is characterised in that described application is selected from as oral vaccine, as feed
Any one or a few in additive, drinking water additive.
14. method according to claim 12 is it is characterised in that the disease that described Porcine Circovirus virus causes is selected
From in postweaning multisystemic wasting syndrome, pigskin inflammation nephrotic syndrome, piglet congenital tremors and sow breeding difficulty
Any one or a few.
A kind of 15. methods preparing Porcine Circovirus virus-like particle oral drugs and/or vaccine are it is characterised in that walk
Rapid inclusion：
Obtain with after rupturing after collects thalline step in the thalline of collected cultivation and fermentation in claim 9 or claim 9
Virus-like particle, as active component or as one of active component, prepare Porcine Circovirus virus sample particle vaccines.
16. methods according to claim 15 it is characterised in that after collects thalline, direct broken wall, products therefrom is as mouth
Take vaccine.
The oral drugs of disease of a kind of 17. preventions and/or treatment Porcine Circovirus virus initiation and/or vaccine, it is special
Levy and be, including Porcine Circovirus virus-like particle described in claim 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610807435.6A CN106399138B (en) | 2016-09-07 | 2016-09-07 | Porcine Circovirus takes orally virus sample particle vaccines and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610807435.6A CN106399138B (en) | 2016-09-07 | 2016-09-07 | Porcine Circovirus takes orally virus sample particle vaccines and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106399138A true CN106399138A (en) | 2017-02-15 |
| CN106399138B CN106399138B (en) | 2019-11-12 |
Family
ID=57998771
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610807435.6A Active CN106399138B (en) | 2016-09-07 | 2016-09-07 | Porcine Circovirus takes orally virus sample particle vaccines and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399138B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107661496A (en) * | 2017-10-25 | 2018-02-06 | 复旦大学 | A kind of pig parvoviral immune composition and preparation method and application |
| CN108096573A (en) * | 2017-10-25 | 2018-06-01 | 复旦大学 | A kind of pig parvoviral oral vaccine composition and preparation method and application |
| CN108273055A (en) * | 2018-01-03 | 2018-07-13 | 复旦大学 | Canine parvovirus vaccine composition and the preparation method and application thereof |
| CN108864259A (en) * | 2018-07-03 | 2018-11-23 | 复旦大学 | A kind of dissolving-out method of 2 porcine circovirus virus-like particle |
| CN112501186A (en) * | 2020-11-26 | 2021-03-16 | 浙江鼎持生物制品有限公司 | Porcine circovirus 2 d-type CAP protein and application thereof in preparation of subunit vaccine |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102827259A (en) * | 2012-08-30 | 2012-12-19 | 青岛康地恩药业股份有限公司 | Porcine circovirus type 2 (PCV2) Cap protein gene and application thereof |
| CN105063081A (en) * | 2015-09-07 | 2015-11-18 | 复旦大学 | Recombinant vector used in Kluyveromyces marxianus auxotrophic strain |
| CN105112313A (en) * | 2015-08-28 | 2015-12-02 | 复旦大学 | Auxotrophic kluyveromyces marxianus strain and traceless genome modification method |
| CN105658660A (en) * | 2013-10-02 | 2016-06-08 | 勃林格殷格翰动物保健公司 | Pcv2 orf2 protein variant and virus like particles composed thereof |
-
2016
- 2016-09-07 CN CN201610807435.6A patent/CN106399138B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102827259A (en) * | 2012-08-30 | 2012-12-19 | 青岛康地恩药业股份有限公司 | Porcine circovirus type 2 (PCV2) Cap protein gene and application thereof |
| CN105658660A (en) * | 2013-10-02 | 2016-06-08 | 勃林格殷格翰动物保健公司 | Pcv2 orf2 protein variant and virus like particles composed thereof |
| CN105112313A (en) * | 2015-08-28 | 2015-12-02 | 复旦大学 | Auxotrophic kluyveromyces marxianus strain and traceless genome modification method |
| CN105063081A (en) * | 2015-09-07 | 2015-11-18 | 复旦大学 | Recombinant vector used in Kluyveromyces marxianus auxotrophic strain |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107661496A (en) * | 2017-10-25 | 2018-02-06 | 复旦大学 | A kind of pig parvoviral immune composition and preparation method and application |
| CN108096573A (en) * | 2017-10-25 | 2018-06-01 | 复旦大学 | A kind of pig parvoviral oral vaccine composition and preparation method and application |
| CN108273055A (en) * | 2018-01-03 | 2018-07-13 | 复旦大学 | Canine parvovirus vaccine composition and the preparation method and application thereof |
| CN108864259A (en) * | 2018-07-03 | 2018-11-23 | 复旦大学 | A kind of dissolving-out method of 2 porcine circovirus virus-like particle |
| CN112501186A (en) * | 2020-11-26 | 2021-03-16 | 浙江鼎持生物制品有限公司 | Porcine circovirus 2 d-type CAP protein and application thereof in preparation of subunit vaccine |
| CN112501186B (en) * | 2020-11-26 | 2023-04-07 | 浙江鼎持生物制品有限公司 | Porcine circovirus 2 d-type CAP protein and application thereof in preparation of subunit vaccine |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106399138B (en) | 2019-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399138B (en) | Porcine Circovirus takes orally virus sample particle vaccines and its preparation method and application | |
| CN106399350B (en) | Porcine circovirus type II virus-like particle vaccine and preparation method thereof | |
| US8728487B2 (en) | Attenuated live vaccine for prevention of porcine reproductive and respiratory syndrome | |
| CN102488895A (en) | Porcine circovirus, porcine parvovirus and porcine reproductive and respiratory syndrome virus triple virus-like particle vaccine and its preparation method | |
| CN103436499A (en) | Porcine circovirus-like particle, and vaccine and preparation method thereof | |
| CN104593388B (en) | Crucian herpesvirus disease JDORF25 vaccine as well as preparation method and application thereof | |
| US20170268011A1 (en) | rDNA NTS-BASED GENE MULTIPLE INSERTION CASSETTE SET AND GRAS-GRADE RECOMBINANT YEAST STRAIN | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| KR101873682B1 (en) | Novel Lactobacillus acidophilus KNU-02 having immune enhancing activity and use thereof | |
| CN117018174B (en) | Saccharomyces cerevisiae oral vaccine for avian bacillus paragallinarum A and application | |
| CN107868131A (en) | A kind of porcine parvovirus subunit vaccine and preparation method thereof | |
| CN112294953A (en) | PCV2 type baculovirus vector, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and preparation method thereof | |
| CN112386685A (en) | PCV2 type baculovirus, mycoplasma hyopneumoniae, swine influenza virus and haemophilus parasuis quadruple inactivated vaccine | |
| CN117431200A (en) | Recombinant bacillus subtilis for displaying Newcastle disease virus HN protein on spore surface, construction method and application | |
| KR20230081996A (en) | Vaccine platform to produce foot-and-mouth disease virus-like particles | |
| CN107338227B (en) | Bovine parainfluenza virus PBIV3-B strain and application thereof | |
| US20220002350A1 (en) | Bovine rotavirus fusion protein and calf diarrhea multivalent vaccine | |
| WO2023020737A1 (en) | Fmdv virus-like particle with stabilizing mutation | |
| KR20190014263A (en) | ORF2 recombinant gene of porcine circovirus type 2 and vaccine composition using the same | |
| CN115521881A (en) | Coxsackie virus 16 type recombinant virus-like particle expression system, virus-like particles prepared by expression system and hand-foot-and-mouth disease vaccine | |
| CN115845041A (en) | Duck circovirus bivalent subunit vaccine and preparation method thereof | |
| CN114058524A (en) | Bursal disease subviral particle vaccine and preparation method thereof | |
| CN116102660A (en) | Porcine parvovirus gene engineering epitope vaccine and preparation method thereof | |
| CN110974951B (en) | Bivalent inactivated vaccine and preparation method thereof | |
| CN108273055A (en) | Canine parvovirus vaccine composition and the preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |