CN103436499A

CN103436499A - Porcine circovirus-like particle, and vaccine and preparation method thereof

Info

Publication number: CN103436499A
Application number: CN201310230557XA
Authority: CN
Inventors: 李阳春; 曹政
Original assignee: CHONGQING AULEON BIOLOGICALS Co Ltd
Current assignee: CHONGQING AULEON BIOLOGICALS Co Ltd
Priority date: 2013-06-09
Filing date: 2013-06-09
Publication date: 2013-12-11

Abstract

The invention discloses a porcine circovirus-like particle, a vaccine and a preparation method thereof. The virus-like particle is composed of a main structural protein-nucleocapsid protein of 2-type porcine circovirus, can excite cell and humoral immune response, can be used as a virus-like particle vaccine (VLP vaccine) to immune different fauna and can safely and effectively prevent PCV-2 infections after being used. The VLP can be made into injections, nose drops and drinking preparations by adding adjuvants or not. An ideal vaccine is provided for security of different populations of sows, piglets, fattening pigs and for effective immune prevention and control of PCV-2 infections.

Description

A kind of pig circular ring virus sample particle and vaccine and preparation method

Invention field

The invention belongs to field of biological pharmacy, relate to a kind of pig circular ring virus sample particle, particularly the preparation method of a kind of virus sample particle vaccines and vaccine thereof.

Background technology

Pig circular ring virus (Porcine circovirus, PCV) be a kind of virus that causes Swinery immunity power to descend, and multisystem asthenia syndrome (Postweaning Multisystemic Wasting Syndrome after weaning with pig, PMWS), pigskin inflammation and nephrotic syndrome (Porcine Dermatitis and Nephropathy Syndrome, PDNS), pig breeding dysfunction (Porcine reproductive failure), PRDC (porcine respiratory disease complex) (Porcine Respiratory Disease Syndrome, PRDC), pig hyperplasia necrotizing pneumonia (Porcine Necrotizing Pneumonia, PNP), the congenital chatter of pig (Porcine Congenital Tremor, CT) etc. various diseases has contact.PCV finds in the PK-15 of the porcine kidney cell line in a kind of vitro culture in 1974 first, thinks at that time a kind of pollutent of cell cultures, because it does not have the typical viral sample effects such as the cytopathy of causing, so be called small virus sample contaminant nucleic acid.There is successively subsequently report to point out that this small virus sample contaminant nucleic acid is a kind of virus in fact, this virus is a kind of small-sized nonencapsulated 12 precursor virus, core comprises a sub-thread cyclic DNA genome, do not cause animal morbidity and the cultured cells generation pathology that goes down to posterity, and formally by its called after pig circular ring virus.At first the people such as Hines in 1994 have reported and found PCV sample virus (PCV-likeVirus) in the piglets that suffers from congenital chatter (Congenital Tremor), the people such as nineteen ninety-five Allan have also found the antibody of PCV in (Stillborn) stillborn foetus of the stillbirths of several routine pigs, and this contacts PCV and various diseases together.Afterwards the report of PCV pointed to " Novel pig PCV-II (the Novel PCV) " of a kind of separation from sick pig rather than cell culture gradually.Along with the research to this novel PC V is goed deep into gradually, discovery all there are differences with traditional PCV from the genome to serotype, thereupon in the world by this pig circular ring virus called after 2 type pig circular ring virus (PCV-2) novel, can be pathogenic, simultaneously by the non-virulent pig circular ring virus called after 1 type pig circular ring virus (PCV-1) of finding in cell culture.

In clinical, the piggy in age in PCV-2 main infection 5-12 week, sick pig shows as poor growth, by the thick unrest of hair, malnutrition, expiratory dyspnea, jaundice, mucosal pallor, can become cad pig, seriously can cause death.Evidence suggests, PCV-2's is pathogenic mainly because it causes immune damage, the research discovery, and obvious minimizing can occur in the sick pig lymphocyte that infects PCV-2.The reports such as Darwich, suffers from rear multisystem asthenia syndrome (the Postweaning Multisystemic Wasting Syndrome of pig wean, CD3+, CD4+T lymphopenia appear in sick pig PMWS), considerable change does not occur in the CD8+T lymphocyte, and typically by PCV-2, is infected and cause that the lymphocytic minimizing of CD8+T has appearred in the affected pig of PMWS illness.And evidence suggests in the quantity of PCV-2 in lymphoid organ and the lymphocytic consumption of affected pig and peripheral blood that IgM and the lymphocytic minimizing of CD8+T have direct relation.The people such as Nielsen report, affected pig lymphocyte after PCV-2 infects 10 days starts to reduce, and in the time of the 14th day, occur significantly descending, and this decline can be continued until affected pig death.And confirm by test, all t lymphocyte subset groups quantitative minimizing can occur due to the infection of PCV-2.The people such as Sarli report, PCV-2 also comprises dendritic cell and bone-marrow-derived lymphocyte to lymphocytic consumption, the people such as while Chianini are according to the decline degree of bone-marrow-derived lymphocyte and T lymphocyte quantity, it is divided into to minor injury, moderate lesion and severe injury, and wherein severe injury can cause lymphocyte and thoroughly disappears.This has absolutely proved that the infection of PCV-2 can cause immunity function to descend, and also causes the theoretical foundation that provides such as PMWS mono-class disease for affected pig due to the infection of PCV-2 and with the accompanying infection of other pathogenic agent simultaneously.The research discovery, the infection of PCV-2 follows porcine pseudorabies virus (PRV), pig breeding to cause the generation of disease with common infection the such as breathing syndrome virus (PRRSV), pig parvoviral (PCV), Pestivirus suis (CSFV), Pneumocystis carinii (Pneumocystis carinii), chlamydozoan (Chlamydia spp.), pulmonary aspergillosis (pulmonary aspergillosis), Cryptosporidium (Cryptosporidium parvum) usually.Wherein the PCV-2 infection is rear multisystem asthenia syndrome (the Postweaning Multisystemic Wasting Syndrome of pig wean as the disease of Etiological, PMWS), usually be attended by the infection of PRRSV and PPV when PCV-2 infects, and the independent infection of PCV-2 also can cause the classical symptom of PMWS in laboratory.

PCV-2 is a class without coating, dodecahedron, the virus that comprises genomic, a current discovery minimum of sub-thread cyclic DNA, diameter 17nm, belong to altogether PCV-II section, Circovirus with chicken anaemia virus (cAV), parrot beak ptilosis poison (PBFDAV) etc.Evidence suggests that PCV is with very approaching from short and small virus (Nano Virus) sibship of plant, infer that PCV, after plant virus is infected vertebrates, host's migration that restructuring occurs with sudden change occurs.PCV-2 pH3 environment, chloroform process and 56-70 ℃ in activity is arranged.PCV-1 genome total length 1759nt, PCV-2 genome total length 1768nt, PCV-1 7 open reading frame (ORF) of encoding, PCV-2 has 11 potential open reading frame (ORF), the protein of coding 2-36kD, but only have 6 ORF to be confirmed.Wherein main ORF has three, respectively ORF-1, ORF-2 and ORF-3, the ORF-1 replicative enzyme (REP) of encoding, the major structural protein (CAP) of ORF-2 coding PCV-2, be also main immunogenic albumen, the apoptosis of ORF-3 proteins encoded and PCV-2 mediation has direct relation simultaneously.In addition, the bioinformatic analysis based on CAP protein nucleic acid sequence, can be divided into PCV-2 PCV-2a, PCV-2b, tri-hypotypes of PCV-2c.Bibliographical information is arranged, the PCV-2 occurred in China infects and mainly concentrates on the PCV-2b hypotype, but the people such as FangWang report, also have the infection of PCV-2a, PCV-2d, PCV-2e hypotype in China, and PCV-2d, two hypotypes of PCV-2e are that the people such as FangWang in 2009 find in China first.

Vaccine is the effective means that control PCV-2 infects, and the vaccine for PCV-2 emerged at present mainly comprises inactivated vaccine

recombinant viral vaccine Suvaxyn Pcv2One

and subunit vaccine

and

deng, but the relative deficiency part is arranged.As deactivation vaccine remove outside the defect of conventional deactivation vaccine, also exist PCV-2 to cultivate difficulty, and expend the problems such as excessive.And recombinant viral vaccine Suvaxyn Pcv2One

will be from the Cap albumen with pathogenic PCV-2 and the recombinant virus formed from other Protein reconstitutions of non-virulent PCV-1, because PCV-1 still has the lymphocyte quantity of the making characteristics that descend to obtain, the people such as Opriessnig report, the decline of immunity function can cause the failure of other vaccine immunities, that especially in the use of PRRSV vaccine, embodies is especially obvious, this insecurity that vaccine is used increases greatly, there is in addition report to show, recombinant viral vaccine is easy to by the institute of the antibody from source of parents comprehensive, and causes vaccine effect to descend.Although subunit vaccine has higher security in addition; but because the immunity of clinical many employing sows utilizes maternal antibody to prevent Infection in Piglets; and that maternal antibody generally will drop in 5-8 week will be very low, for the protection efficiency of piglet, also lack more statistic data.On the other hand, the adjuvant that current commercial vaccine adopts is still undesirable, as

adopt mineral oil adjuvant, Suvaxyn Pcv2One

employing SL-CD water quality adjuvant,

with

all adopt the water quality adjuvant.As everyone knows, mineral oil adjuvant for mycoplasma pneumonia of swine (MPS) vaccine can excite copying of PCV, thereby cause PCV-2 to infect and aggravate disease also complicated, within 2004 simultaneously, the people such as Resendes have done investigation to adjuvant at present commonly used, result explicitly points out, lack at present a kind of effective adjuvant with in the exploitation that is applied in the PCV-2 vaccine, and applied adjuvant all can not effectively improve the effect of vaccine.Therefore overcome the shortcomings such as the low-security of current PCV-2 seedling, deactivation vaccine and recombinant vaccine alive, low protection; seek new adjuvant simultaneously, research and develop a kind of safe, efficient, non-virus vaccines copied; when protecting preferably PCV-2 to attack; and can avoid preferably common and infect and the generation of secondary infection, be great science problem safe, effective immune prevention and control PCV-2.

Virus-like particle (Virus-like pratical, VLP) consists of the virus particle ghost that does not contain viral nucleic acid viral major structural protein.Due to VLP size, structure and surface antigen and polypeptide epitope almost as broad as long with real virus, so can be identified by the host antigen presenting cells, cause immunne response and effect, and without potential side effect.At first, with live seedling and deactivation vaccine, compare, virus sample particle vaccines does not have unsafe factor; With subunit vaccine, compare, VLP is that a plurality of antigen proteins form, and has very strong immunogenicity; With the virosome that public's praise is arranged (Virosome), compare, VLP is not neither, by live virus preparation, there is no potential danger, do not need a large amount of propagative viruseses yet, there is no that security is low, cost is high and preparation cycle such as grows at the deficiency; The VLP vaccine is described as the new milestone of virus type Vaccine Development now thus.Current hepatitis B VLP vaccine (Recombivax HB, Merck), papilloma VLP vaccine (Gardisil, Merck) and influenza VLP vaccine go on the market, and a plurality of kinds such as penta type VLP vaccine are in clinical study.Therefore at present, have no the report of relevant PCV-2VLP vaccine, be badly in need of a kind of antigen that can assemble VLP, with can induce the good immunne response of laboratory animal after adjuvant mixes.

Summary of the invention

In view of this, one of purpose of the present invention is to provide a kind of virus-like particle of pig circular ring virus; Two of purpose of the present invention is to provide the vaccine containing virus-like particle; Three of purpose of the present invention is to provide the preparation method of virus-like particle.

For achieving the above object, technical scheme is:

1. the virus-like particle of a pig circular ring virus, described virus-like particle is comprised of the nucleocapsid protein of pig circular ring virus.

Preferably, the nucleotide sequence of described nucleocapsid protein is as shown in SEQ ID NO.1～15.

Preferably, the aminoacid sequence of described nucleocapsid protein is as shown in SEQ ID NO.16～30.

2. the vaccine that contains described virus-like particle.

Preferably, described vaccine is injection, nasal drop or drinking-water formulation.

Preferred, the adjuvant of described vaccine is one or more in nano aluminum, aluminium hydroxide or aluminum phosphate, hydrogel, quaternary ammoniated chitosan or restructuring heat-labile.

3. the preparation method of described virus-like particle, comprise the steps: the nucleotide construction recombinant eukaryon expression vector of coding porcine circovirus nucleocapsid protein, then recombinant eukaryon expression vector is transformed to express cell, after cultivation by the purified virus-like particle that obtains of culture.

Preferred, described carrier for expression of eukaryon is the pET32a carrier, pOPI3CAT carrier, pCAGGS carrier, pcDNA6/TR carrier or pCMV-HA carrier.

Preferred, described express cell is the UMNSAH/DF-1 cell, separates 9-10 fowl in age inoblast, the PK-15 cell, the VERO cell, COS cell, human diploid cell, bhk cell, Chinese hamster ovary celI, mdck cell, Hep-G2 cell, Tn5 cell or SF9Cell cell.

Most preferred, the purification process of culture is: the collecting cell nutrient solution, centrifugal 10min under 4 ℃, 5000rmp condition, get supernatant liquor under 100000g, 4 ℃ of conditions centrifugal 2 hours, precipitation suspends with HNE buffer, HNE buffer consists of 25mM Tris-HCl pH7.4,150mM NaCl, 5mM EDTA; Then suspension is carried out to sucrose gradient centrifugation, sucrose adopts HNE buffer preparation, and system adopts 0.3g/mL sucrose 3mL, 0.45g/mL sucrose 3mL, 1.37g/mL sucrose 1mL, then with 4 ℃, 100000g condition under centrifugal 2h, collect middle layer, and use the refractometer measuring density; Carry out gel chromatography with the PBS balance Sepharose6FFTM medium of pH6.5-7.5, collect void volume stream and wear peak; Adopt again the DEAE-SepharoseFFTM medium to carry out ion exchange chromatography, the PBS that balance liquid is pH6.5-7.5, contain 0.05-0.15M sodium-chlor, elutriant is the PBS containing 0.2-0.5M sodium-chlor, pH6.5-7.5, after purifying, liquid is virus-like particle.

Beneficial effect of the present invention: the present invention relates to a kind of pig circular ring virus sample particle, be comprised of the major structural protein of pig circular ring virus, is also major surface antigen CAP, can excite good dual cell and humoral immunoresponse(HI); After the injection type that VLP antigen through forming adds or do not add adjuvant to prepare, form of nose drops, drinking-water formulation immunization different animals colony, can safely, effectively prevent PCV-2 to infect, for different population sow, piggy, growing and fattening pigs safety, effective immune prevention and control PCV-2 infect desirable vaccine is provided.

The present invention has carried out effect experiment, the humoral immunization and cellullar immunologic response and the natural immunity and Acquired immune response and the mucosal immune response effect that by the approach such as injection, collunarium, drinking-water immunity piggy and farrowing sow, produce respectively, after immune animal, the morbidity sign of not finding immunologic injury or being caused by vaccine inoculation, have security; Pig circular ring virus sample particle vaccines of the present invention immunity is without twice of the piggy of PCV-2 immunity background, sow and growing and fattening pigs, further by the wild strain of the PCV-2 of PCV-2a, PCV-2b, PCV-2e, PCV-2d type strain and China's clinical separation in different areas, attack poison, the immune protective effect more than 95% is arranged; With pig circular ring virus sample particle vaccines inoculation of the present invention different areas, the sow of population, piggy, 0, twice of immunity in 21 days, adopt respectively injection, collunarium, drinking-water formulation vaccine immunity, all show that each department, each population sow, piggy do not have the morbidity phenomenon caused by vaccine inoculation to occur, there is security.

By VLP with can strengthen preferably immunogenicity after nano aluminum is mixed; can't cause the aggravation of PCV-2 virus replication; show thus the pig circular ring virus sample particle vaccines of research and development in the situation that contain or do not contain adjuvant, contain the novel nano aluminium adjuvant especially, the swinery of different areas, population is all had to immune protective effect preferably.

Embodiment

The preferred embodiments of the present invention are described in detail.The experimental technique of unreceipted actual conditions in embodiment, usually according to normal condition, for example condition described in molecular cloning experiment guide (third edition, the work such as J. Pehanorm Brooker), or the condition of advising according to manufacturer.

Embodiment 1 prepares the expression vector of pig circular ring virus sample particle vaccines

With the Nucleotide of the CAP albumen of the BJ-HB from PCV-2b, GD, GD-TS, BJ0401, HB0402, TJ04, ZJ0401, TJ05, HB0601, CQ08, HuB08, LN08, HN08, SC07 and JX0601 hypotype, wherein the nucleotide sequence of the CAP albumen of BJ-HB hypotype is as shown in SEQ ID NO.1; The nucleotide sequence of the CAP albumen of GD hypotype is as shown in SEQ ID NO.2; The nucleotide sequence of the CAP albumen of GD-TS hypotype is as shown in SEQ ID NO.3; The nucleotide sequence of the CAP albumen of BJ0401 hypotype is as shown in SEQ ID NO.4; The nucleotide sequence of the CAP albumen of HB0402 hypotype is as shown in SEQ ID NO.5; The nucleotide sequence of the CAP albumen of TJ04 hypotype is as shown in SEQ ID NO.6; The nucleotide sequence of the CAP albumen of ZJ0401 hypotype is as shown in SEQ ID NO.7; The nucleotide sequence of the CAP albumen of TJ05 hypotype is as shown in SEQ ID NO.8; The nucleotide sequence of the CAP albumen of HB0601 hypotype is as shown in SEQ ID NO.9; The nucleotide sequence of the CAP albumen of CQ08 hypotype is as shown in SEQ ID NO.10; The nucleotide sequence of the CAP albumen of HuB08 hypotype is as shown in SEQ ID NO.11; The nucleotide sequence of the CAP albumen of LN08 hypotype is as shown in SEQ ID NO.12; The nucleotide sequence of the CAP albumen of HN08 hypotype is as shown in SEQ ID NO.13; The nucleotide sequence of the CAP albumen of SC07 hypotype is as shown in SEQ ID NO.14; The nucleotide sequence of the CAP albumen of JX0601 hypotype is as shown in SEQ ID NO.15.According to sequence alignment, show, high from the Nucleotide similarity of different subtype.

Then with 5 ' gctacgtctc tctagattaagggttaagrggghh-3 ' is upstream primer, and underscore is Xba I restriction enzyme site; 5 '- ctcgagctggccctgctccccgatcaccc3 ' is downstream primer, underscore is Xho I restriction enzyme site, then take respectively and carry out pcr amplification containing the sample of SEQ ID NO.1～SEQ ID NO.15 sequence as template, obtain after the product enzyme is cut and be connected in the pET32a expression vector, obtain restructuring pET32a-CAP expression vector.

Embodiment 2 cell cultures and cell are criticized storehouse and are set up

Take UMNSAH/DF-1 cell cultures build storehouse as example, the UMNSAH/DF-1 cell derived is in US mode culture collection warehousing (American Type Culture Collection, ATCC).Substratum adopts DMEM substratum (Dulbecco ' s modified Eagle medium), add 100U/mL penicillin and 100 μ g/mL Streptomycin sulphates in substratum, then add the foetal calf serum that volume fraction is 2-10%, then at cell factory or cell fermentation tank, cultivated, set up cell work seed lot storehouse, and, to the calibrating comprehensively such as the exogenous factor after going down to posterity, tumorigenicity and stability, cell is used algebraically to be controlled in 60 generations, all meets the requirement of production of vaccine medium.

Can also use other zooblasts in the present embodiment, as: the PK-15 cell; 2. VERO cell; 3. COS cell; 4. human diploid cell; 5. bhk cell; 6. Chinese hamster ovary celI; 7. mdck cell; 8. Hep-G2 cell etc., also can be used this area other cells commonly used.

Embodiment 3 plasmid transfections reach to be stablized the screening of high expressing cell system and builds storehouse

The UMNSAH/DF-1 cell of selecting embodiment 2 to set up is target cell, the restructuring pHWD2000-CAP expression vector transfection UMNSAH/DF-1 cell that adopts liposome method that embodiment 1 is built, and then the clone of high expression level PC VLP-2 is stablized in screening.Concrete steps are as follows: 1., in the 35mm hole, add pHWD2000-CAP expression vector 1.5 μ g; 2. the liposome that adds 5 μ LOptiMEM configurations, incubated at room 45min.Then join by the host cell of OptiMEM rinse, hatch 5h; 3. centrifugal removal carrier-liposome mixture, and add DMEM to be cultivated in cell; 4. the pHWD2000-CAP recombinant vectors is expressed in clone, but self-assembly PC VLP-2; 5. screen the UMNSAH/DF-1 cell strain of expressing PCVLP-2 by pressurization.Result shows, screen the cell strain of stablizing high expression level PC VLP-2 at the UMNSAH/DF-1 cell in 10 generations, being passaged to for 40 generations through clone stably express and output, VLP size and structure, exogenous factor and tumorigenicity, karyomit(e) integrity etc. does not have phenotypic alternation.Thus, set up the UMNSAH/DF-1 clone of stable high expression level PCV-2VLP.Further set up three grades of cell seed lot storehouses with PCV-2VLP, through comprehensive calibrating is met to the production of vaccine requirement, place in liquid nitrogen and save backup.

In the present embodiment, the clone of the stable high table of preparation PCV-2VLP includes but not limited to: 1. UMNSAH/DF-1 cell; 2. PK-15 cell; 3. VERO cell; 4. COS cell; 5. human diploid cell; 6. bhk cell; 7. Chinese hamster ovary celI; 8. mdck cell; 9. Hep-G2 cell.

Embodiment 4PCVLP-2 large-scale production

Get the UMNSAH/DF-1 work batch storehouse cell of stably express PCV-2VLP, with DMEM cell culture fluid (do not add or add the 10-2% foetal calf serum, add the heparin of 10 μ g/mL) by the 20L cell factory or add the production of microcarrier 30L cell fermentation tank amplification culture to make cell density reach 1 * 10 ^7-8when above, collecting cell is cultivated the PCV-2VLP vaccinogen liquid.

The PCV-2VLP clone of large-scale production in the present embodiment includes but not limited to: 1. UMNSAH/DF-1 cell; 2. PK-15 cell; 3. VERO cell; 4. COS cell; 5. human diploid cell; 6. bhk cell; 7. Chinese hamster ovary celI; 8. mdck cell; 9. Hep-G2 cell.

The purifying of embodiment 5PCV-2VLP vaccine

Collect respectively the PCV-2VLP vaccinogen liquid of the different subtype of large-scale production, 4 ℃ of centrifugal 10min of 5000rmp, remove cell and impurity; Get supernatant liquor 100000g4 ℃ of centrifugal 2h, precipitation suspends with 1 times of volume HNE buffer (25mM Tris-HCl pH7.4,150mM NaCl, 5mM EDTA); Suspension is carried out to sucrose gradient centrifugation, and sucrose adopts HNE buffer preparation, and system adopts 0.3g/mL sucrose 3mL; 0.45g/mL sucrose 3mL; 1.37g/mL sucrose 1mL; 4 ℃ of centrifugal 2h of 100000g; Collect middle layer, and use the refractometer measuring density; Carry out gel chromatography with the PBS balance Sepharose6FFTM medium of pH6.5-7.5, collect void volume stream and wear peak, foreign protein is removed and can be reached more than 95%; Then adopt the DEAE-SepharoseFFTM medium to carry out ion exchange chromatography, the PBS that balance liquid is pH6.5-7.5, contain 0.05-0.15M sodium-chlor, elutriant is the PBS containing 0.2-0.5M sodium-chlor, pH6.5-7.5, foreign protein is removed and can be reached more than 99%, and liquid is PC VLP-2 vaccinogen liquid.

The outward appearance of vaccinogen liquid is clarified liq; the pH value is 7.0-7.2; carry out the miscellaneous bacteria qualification result by blood agar negative; cultivate by semi-fluid and broth culture that to carry out the mycoplasma qualification result negative; show that the purpose band is clear, without other, mix and be with by PAGE-SDS electrophoresis detection result, adopt Reed& The Muench method is calculated the antiserum(antisera) neutralization and is tired all higher than 1: 2800.

The preparation of embodiment 6PCV-2VLP vaccine formulation

1. injection type preparation: respectively the PCV-2VLP vaccinogen liquid of purifying is not added to adjuvant, prepare 10 μ g/0.5mL low dosage, 20 μ g/1.0mL high dosages without the adjuvant injection type; Respectively purifying PCV-2VLP vaccinogen liquid being added to aluminium hydroxide or aluminum phosphate configuration PCV-2VLP concentration is 15 μ g/mL, the vaccine that aluminium hydroxide or aluminum phosphate are 1mg/mL, or PCV-2VLP concentration is 30 μ g/mL, aluminium hydroxide or aluminum phosphate concentration are 2mg/mL adjuvant injection-type vaccine; Respectively purifying PCV-2VLP vaccinogen liquid is added to nano-class aluminum adjuvant, for preparing respectively 5.0 μ g/0.5mL low dosages, 10 μ g/1.0mL high dosages has an adjuvant injection-type vaccine.Above vaccinate solution is packed into and is inhaled the top bottle, put 2-8 ℃ standby.

2. nasal spray type preparation: respectively purifying PCV-2VLP is not added to adjuvant absorption, for preparing 7.5 μ g/0.2mL low dosages, 15 μ g/0.2mL high dosages sprays nose vaccine formulation without adjuvant; Respectively the PCV-2VLP of purifying is added to equal-volume Quaterisation chitosan hydrogel mucous membrane adjuvant and transfer system, preparing 5.0 μ g/0.2mL, 10 μ g/0.2mL has adjuvant spray nose vaccine formulation; Respectively purifying PCV-2VLP albumen is added to equal-volume Quaterisation chitosan hydrogel and 10 μ g rLT mucous membrane adjuvant and transfer systems, preparing 4.0 μ g/0.2ml, 8 μ g/0.2ml has adjuvant spray nose pig circular ring virus sample particle vaccines formulation.The above spray nose vaccine solution quantitative nose sprayer of packing into, put 2-8 ℃ standby.

3. the formulation of drinking water preparation: respectively purifying PCV-2VLP10 μ g, 20 μ g are added respectively to 5% sucrose (quality), 0.2% vitamins C (quality), 0.1% thiaminogen (quality) and 0.1% skim-milk (quality), adjust PH7.2 with phosphate buffered saline buffer, spraying drying, prepare 10 μ g/ agent low dosages, 20 μ g/ agent high dosages without adjuvant sublingual lozenge formulation; Respectively purifying PCV-2VLP albumen 7.5 μ g, 15 μ g and 15 μ g rLT are added respectively to 5% sucrose, 0.2% vitamins C, 0.1% thiaminogen and 0.1% skim-milk, adjust PH7.2 with phosphate buffered saline buffer, spraying drying, for preparing 7.5 μ g/ agent low dosages, 15 μ g/ agent high dosages has an adjuvant pig circular ring virus sample particle vaccines drinking-water formulation; Above drinking-water vaccine is packed in sealed plastic bag, put 2-8 ℃ standby.

The experiment of experimental example 7PCV-2VLP vaccine assay

Utilize PCV-2VLP vaccine injecta, nasal drop, the drinking-water formulation outward appearance of embodiment 6 preparations to see all, free from extraneous odour and microbiological contamination; By cavy, rabbit test pyrogen-free, undue toxicity and acute toxic reaction; By 3 age in days suckling mouse intracranial inoculations, and 3 age in days piggy musculi colli test injections are without the morbidity phenomenon; Measure protein content all at dosage range by the Lorry method; By electron microscopic observation VLP diameter 17nm, consistent with natural viral; ELISA measures DNA content all below 50EU; By SDS-PAGE and WB detectable antigens protein ingredient, exist; By 1 serum NAT of immune Balb/C mouse more than 3200.

Experimental example 8PCV-2VLP vaccine is tested the immunne response effect in the experiment pig body

Injection, collunarium, drinking-water vaccine formulation that the PCV-2VLP vaccine that utilizes embodiment 6 to prepare adds respectively or do not add corresponding adjuvant to prepare, and be control group with PBS, aluminium salt, nano aluminum, rLT, press respectively approach immunity 3 age in days piggys separately, and its immunizing dose of replacement gilt is pressed embodiment 6 vaccine low dose group, twice (0,21 day) of immunity; The last immunity gathers peripheral blood, separation of serum and the immunocyte of respectively organizing piggy and sow in latter 14 days, gathers splenic lymphocyte, lung and nasal lavage fluid; Measure serum antibody titer more than 6400 by the ELISA method, adopt mtt assay to measure NAT more than 3200, adopt the dynamic changes such as drain cell instrument, ELISPOT instrument mensuration immunocyte and serum important cytokine, inflammatory molecule, the interestization factor and eosinophilic granulocyte, neutrophil leucocyte to make TH2/Th1 reply balance, adopt ELISA method nasal cavity, lung-douching fluid SIgA antibody titer more than 160.Result shows, PCV-2VLP vaccine of the present invention adds adjuvant and does not have adjuvant all can produce satisfied dual immunne response no matter be, and test group has the adjuvant group to be better than without adjuvant group, high dosage to be better than low dose group immunne response effect, and control group does not produce dual immunne response; The PCV-2VLP vaccine of preparation is no matter be that injection or collunarium, drinking-water formulation all can produce satisfied dual immunne response, and the injection type serum antibody titer is higher than collunarium, drinking-water formulation, and collunarium, drinking-water formulation mucous membrane and cell immunoreceptor are better than injection type.

Experimental example 9PCV-2VLP vaccine is tested the immune protective effect in the experiment pig body

Injection, collunarium, drinking-water formulation that the PCV-2VLP vaccine that utilizes embodiment 6 to prepare adds respectively or do not add corresponding adjuvant to prepare are experimental group, and with PBS, aluminium salt, nano aluminum, rLT, and PCV-2 formalin-inactivated virus be control group, press respectively approach immunity 3 age in days piggys, replacement gilt separately, its immunizing dose is pressed embodiment 6 vaccine low dose group, twice (0 of immunity, 21 days), latter 14 days each test group of last immunity, control group experiment pig are with 10 ^5.0tCID ₅₀clinical separation PCV-2 strain musculi colli injection is respectively attacked poison observation protection effect.The result demonstration, PCV-2VLP vaccine of the present invention all can produce high-caliber protection effect, and immune protective rate, more than 90%, is 0% and control group PCV-2 formalin-inactivated virus vaccines protection ratio reaches 60%, other each control group protection ratios reach.The PCV-2VLP vaccine of preparation has efficient immune protective effect in piggy and sow body thus.

Immunne response and the immune protective effect experiment of experimental example 10PCV-2VLP vaccine to farrowing sow

Injection, collunarium, drinking-water formulation that the PCV-2VLP vaccine that utilizes embodiment 6 to prepare adds respectively or do not add corresponding adjuvant to prepare, and be control group with PBS, aluminium salt, nano aluminum, rLT and PCV-2 formalin-inactivated virus vaccines, press respectively the conceived 60 days sows of approach immunity separately, its immunizing dose is pressed embodiment 6 vaccine high dose group, twice (0,21 day) of immunity; Within 14 days after the last immunity, gather peripheral blood, separation of serum and the immunocyte of respectively organizing sow.Part sow gathers splenic lymphocyte, lung and nasal lavage fluid after putting to death; Measure serum antibody titer more than 12800 by the ELISA method, adopt mtt assay to measure NAT more than 6400, adopt the dynamic changes such as drain cell instrument, ELISPOT instrument mensuration immunocyte and serum important cytokine, inflammatory molecule, the interestization factor and eosinophilic granulocyte, neutrophil leucocyte to make TH2/Th1 reply balance, adopt ELISA method nasal cavity, lung-douching fluid SIgA antibody titer more than 200.Another part sow continues to raise, and after Farrowing, observes and there is no premature labor, miscarriage, weak young situation.Result shows, PCV-2VLP vaccine of the present invention adds adjuvant and does not have adjuvant all can produce satisfied dual immunne response no matter be, and test group has the adjuvant group to be better than without adjuvant group, high dosage higher than low dose group immunne response effect, and control group does not produce dual immunne response; PCV-2VLP vaccine of the present invention is no matter be that injection or collunarium, drinking-water formulation all can produce satisfied dual immunne response, and the injection serum antibody titer is higher than collunarium, drinking-water formulation, and collunarium, drinking-water formulation mucous membrane and cell immunoreceptor are better than injection type.The immunne response effect that the PCV-2VLP vaccine of preparation has had in the farrowing sow body thus.

Above-mentioned PCV-2VLP vaccine passes through the front sow of the immune breeding of method separately, breeds and within latter 21 days, carries out 2 immunity, conceived 80 days each test group, control group pregnancy mothers, lives with 10 ^5.0tCID ₅₀clinical separation PCV-2 strain musculi colli injection is respectively attacked poison, observes the protection effect after the sow natural production.The result demonstration, PCV-2VLP vaccine of the present invention all can produce high-caliber protection effect, and immune protective rate, more than 90%, is 0% and control group PCV-2 formalin-inactivated virus vaccines protection ratio reaches 78%, other each control group protection ratios reach.The PCV-2VLP vaccine of preparation firmly has efficient immune protective effect to conceived mother thus.

The safety experiment of experimental example 11PCV-2VLP vaccine

(1) aseptic, mycoplasma test: the PCV-2VLP vaccine of embodiment 6 preparations is inoculated respectively to sulphur glycollate culture medium, nutrient agar slant medium and improvement Martin culture medium culturing 14d, and do negative control with stroke-physiological saline solution, culture temperature is 25 ℃, 35 ℃.The result demonstration, the PCV-2VLP vaccine all has no bacterial growth.Respectively by semi-fluid and broth culture for the PCV-2VLP vaccine, 37 ℃ of first culture 21 days, inferior culture 21 days, stroke-physiological saline solution is done negative control, and result shows that the PCV-2VLP vaccine grows without mycoplasma; By the DNA staining, seed culture of viruses is inoculated to the Vero cell cultures 3 days, go down to posterity once, use the dibenzamide fluorescent dyeing.The result demonstration, the PCV-2VLP vaccine is all grown without mycoplasma.

(2) hemolytic test: choosing body weight is the cavy of 350g left and right, gathers fresh guinea pig blood 1mL, with PBS washing 3 times, then blood cell volume is recovered and dilute 10 times.PBS dilution PCV-2VLP vaccine (by embodiment 6 preparations), be respectively 2 times, 4 times, 8 times, the guinea pig blood cell joined in the adjuvant to be checked of dilution, after 8 hours, estimate haemolysis and detect and be as the criterion with range estimation or supernatant concentration, and detect absorbancy at the 570nm place.Result shows, blood cell does not occur and break, without haemolysis.Illustrate that the composition in the PCV-2VLP vaccine can not make erythrocyte splitting.Therefore, the PCV-2VLP vaccine is all without hemolytic reaction.

(3) acute toxicity test: the PCV-2VLP vaccine 0.5mL abdominal injection body weight of getting embodiment 6 preparations is 12～18gBalb/C mouse, 10 every group, establish the PBS negative control group simultaneously, and within continuous 2 weeks, observe active state, body weight change and the survival rate of mouse.Result shows, experiment mice is all survived, perpendicular hair does not appear, One's spirits are drooping, the ill symptoms such as be slow in action, and body weight presents increase, prove that thus the PCV-2VLP vaccine is safe to animal under the concentration of test, and within 14 days, put to death and carry out the gross anatomy inspection afterwards, having no internal organs has pathological change.Acute toxicity result in the Beagle dog body that is 8～10kg in body weight: get the PCV-2VLP vaccine intramuscular injection 15mL of embodiment 6 preparations, 10 every group, establish the PBS negative control group simultaneously, observed behavior in continuous 2 weeks, body weight and survival rate change.Result is visible, and the Beagle dog has no toxic reaction, and behavior is normal, there is no death, and with control group dog indifference relatively, each dog body weight increases to some extent, and puts to death gross anatomy and have no internal organs obvious pathological change is arranged.Therefore, the PCV-2VLP vaccine is all without acute toxic reaction, and use is safe.

(4) hypersensitive test research: the PCV-2VLP vaccine subcutaneous vaccination body weight of getting embodiment 6 preparation is 250～350gHartley cavy, 5 of each sample inoculation cavys, every inoculation 0.5mL, the next day once, totally 3 times.The 3rd time the injection latter 21 days, ear vein gives respectively identical PCV-2VLP vaccine 0.5mL, and with human serum albumin and physiological saline using same method inoculate respectively 3 cavys as the positive, negative control.Inject latter 30 minutes and 3 days and observe animal, positive, negative control is all set up, and PCV-2VLP vaccine group cavy is without death, and without allergic symptoms such as rhiocnesmus, sneeze, dysphoria, expiratory dyspnea, shock, spasm.Therefore, the PCV-2VLP vaccine is in animal body all without anaphylaxis.

(5) rabbit thermal source matter test: getting the qualified body weight of preliminary examination is that 3 of 2～3kg rabbit are fixing, and take temperature after 30 minutes, survey 2 times altogether, and 30 minutes, interval requires 2 temperature difference to be not more than 0.2 ℃, and 2 medial temperatures of each rabbit are at 38.6-39.5 ℃.The PCV-2VLP vaccine of embodiment 6 preparations is preheated to 38 ℃, and after the 2nd thermometric, in 15 minutes, oneself rabbit ear limit vein only slowly injects respectively 0.5mL/.After injection every 30 minutes take temperatures 1 time, tie-in 6 times.Result shows: the PCV-2VLP vaccine gives individual intensification of rabbit and does not all surpass 0.2 ℃, and 3 rabbit intensification summations do not surpass 0.4 ℃, do not cause the exothermic reaction of rabbit.Therefore, the PCV-2VLP vaccine of preparation is all without thermal source matter.

(6) immunopathogenesis damage test: the PCV-2VLP vaccine by embodiment 8 preparations passes through the detections such as piggy, sow, boar and growing and fattening pigs peripheral blood antibody subtype, the interestization factor, inflammatory factor, eosinophilic granulocyte, neutrophil leucocyte, basophilic cell and tracheae, lungs, liver, spleen, kidney.The test-results demonstration, PCV-2VLP vaccine immunization Th2/Th1 immunne response in experiment sucking pig, sow, boar and growing and fattening pigs body tends to balance, and there is no the sign of immune organ damage, therefore has security.

The experiment of experimental example 12:PCV-2VLP vaccine stability

PCV-2VLP vaccine by embodiment 6 preparations, be placed in respectively 2-8 ℃, room temperature (20-25 ℃), 37 ℃ 1 week, 2 weeks, 1 month, 3 months, 6 months, 12 months, 18 months and 24 months, outward appearance, pH value, aseptic, electron microscopic observation particle diameter, immune animal observation security are observed in sampling.Result shows: the PCV-2VLP vaccine place 2-8 ℃ in 24 months all without phenomenons such as variable color layerings, the pH value is unchanged between 7.0-7.2, the electron microscopic observation size is consistent, and injection or collunarium are acted normally to mouse or experiment pig; The PCV-2VLP vaccine is placed the stability that 25 ℃ of room temperatures have all had in 3 months; The PCV-2VLP vaccine is placed the stabilizing effect that 37 ℃ of room temperatures have all had in 1 month.By presentation of results, the PCV-2VLP vaccine is placed 2-8 ℃ of physico-chemical property, biology performance is stable, validity period at least 24 months.

Finally explanation is, above preferred embodiment is only unrestricted in order to technical scheme of the present invention to be described, although the present invention is described in detail by above preferred embodiment, but those skilled in the art are to be understood that, can make various changes to it in the form and details, and not depart from the claims in the present invention book limited range.

Claims

1. the virus-like particle of a pig circular ring virus, it is characterized in that: described virus-like particle is comprised of the nucleocapsid protein of pig circular ring virus.

2. virus-like particle according to claim 1, it is characterized in that: the nucleotide sequence of described nucleocapsid protein is as shown in SEQ ID NO.1～15.

3. virus-like particle according to claim 1, it is characterized in that: the aminoacid sequence of described nucleocapsid protein is as shown in SEQ ID NO.16～30.

4. the vaccine that contains the described virus-like particle of claim 1-3 any one.

5. vaccine according to claim 1 is characterized in that: described vaccine is injection, nasal drop or drinking-water formulation.

6. vaccine according to claim 4 is characterized in that: the adjuvant of described vaccine is one or more in nano aluminum, aluminium hydroxide or aluminum phosphate, hydrogel, quaternary ammoniated chitosan or restructuring heat-labile.

7. the preparation method of the described virus-like particle of claim 1-3 any one, it is characterized in that, comprise the steps: the nucleotide construction recombinant eukaryon expression vector of coding porcine circovirus nucleocapsid protein, then recombinant eukaryon expression vector is transformed to express cell, after cultivation by the purified virus-like particle that obtains of culture.

8. preparation method according to claim 7, it is characterized in that: described carrier for expression of eukaryon is the pET32a carrier, pOPI3CAT carrier, pCAGGS carrier, pcDNA6/TR carrier or pCMV-HA carrier.

9. preparation method according to claim 7, it is characterized in that: described express cell is the UMNSAH/DF-l cell, separates 9-10 fowl in age inoblast, the PK-15 cell, the VERO cell, the COS cell, human diploid cell, bhk cell, Chinese hamster ovary celI, mdck cell, Hep-G2 cell, Tn5 cell or SF9Cell cell.

10. according to the described preparation method of claim 7-9 any one, it is characterized in that, the purification process of culture is: the collecting cell nutrient solution, centrifugal 10min under 4 ℃, 5000rmp condition, get supernatant liquor under 100000g, 4 ℃ of conditions centrifugal 2 hours, precipitation suspends with HNE buffer, and HNE buffer consists of 25mM Tris-HCl pH7.4,150mM NaCl, 5mM EDTA; Then suspension is carried out to sucrose gradient centrifugation, sucrose adopts HNE buffer preparation, and system adopts 0.3g/mL sucrose 3mL, 0.45g/mL sucrose 3mL, 1.37g/mL sucrose 1mL, then with 4 ℃, 100000g condition under centrifugal 2h, collect middle layer, and use the refractometer measuring density; Carry out gel chromatography with the PBS balance Sepharose6FFTM medium of pH6.5-7.5, collect void volume stream and wear peak; Adopt again the DEAE-SepharoseFFTM medium to carry out ion exchange chromatography, the PBS that balance liquid is pH6.5-7.5, contain 0.05-0.15M sodium-chlor, elutriant is the PBS containing 0.2-0.5M sodium-chlor, pH6.5-7.5, after purifying, liquid is virus-like particle.