CN106381307A - Method for directly importing foreign DNA into fusarium moniliforme resting spores - Google Patents
Method for directly importing foreign DNA into fusarium moniliforme resting spores Download PDFInfo
- Publication number
- CN106381307A CN106381307A CN201610813520.3A CN201610813520A CN106381307A CN 106381307 A CN106381307 A CN 106381307A CN 201610813520 A CN201610813520 A CN 201610813520A CN 106381307 A CN106381307 A CN 106381307A
- Authority
- CN
- China
- Prior art keywords
- spore
- fusarium moniliforme
- plasmid
- resting
- directly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
Abstract
The invention discloses a method for directly importing foreign DNA into fusarium moniliforme resting spores. The method comprises the following three steps: performing fusarium moniliforme culture and spore collection, pretreating fusarium moniliforme spores and performing electric shock on the fusarium moniliforme spores by using a high-density distributed electrode network (HDEN) method, so that the fusarium moniliforme spores imported with to-be-transformed plasmids are obtained. Non-germinated spores serve as starting materials of importing foreign molecules, and the foreign DNA is imported into the fusarium moniliforme resting spores by employing the HDEN electroporation technology, so that a complicated step of germinating the spores can be saved, and the steps of preparing protoplast or performing agrobacterium-mediated transformation and the like in the traditional method are saved. Moreover, the transformation rate is high, and an effect of obtaining not less than 6000 positive transformants can be achieved at least in each transformation reaction system.
Description
Technical field
The invention belongs to biological technical field is and in particular to one kind is directly by Exogenous DNA transfered fusarium moniliforme dormancy spore
The method of son.
Background technology
Fusarium moniliforme(Fusarium moniliforme)Belong to Deuteromycotina, Hyphomycetes, tumor seat spore mesh, tumor seat spore
Section, Fusarium.This bacterium agriculturally can cause disease, often parasitizes the crops such as Semen Maydiss, Herba bromi japonici, Semen Tritici aestivi, Oryza sativa L., except energy
Cause beyond plant root-rot and brown foot rot, also cause the symptoms such as top rot, fringe corruption.The metabolite of this bacterium be moniliformin and
6-(10-hydroxy-6-oxo-trans-1-undecenyl)-.beta.-resorcylic acid lactone, has toxicity, and the gastric cancer with the mankind, esophaguses carcinogenesis, has substantial connection.Fusarium moniliforme and its produced
Toxin is it is easy to pollute the food of the mankind.Therefore, study the toxigenic molecular mechanism of fusarium moniliforme, and the life of cell
Reason is biochemical, is ensuring food safety, is protecting people's health, ensures that the aspects such as agricultural foison are significant, has important society
And economic worth.
Genetic engineering is with molecular genetics as theoretical basiss, with the modernism of molecular biology as means, by difference
The gene in source, by the blueprint being pre-designed, constructed dna molecule in vitro, is then introduced into cell, to change biological original something lost
Pass characteristic, obtain new varieties, produce new product(The enzyme gene such as certain being had Important Economic value, imports to beading sickle
Knife bacterium is intracellular, does the high expression of pheron, produces this enzyme).In this field it is important that a link it is simply that external
DNA, imports to cell interior.For the cell of different plant species and different conditions, need different introduction methods, just can allow outer
The DNA coming, across cell wall and cell membrane, is transported to cell interior.
Currently used for filamentous fungis field(Including fusarium moniliforme)Main DNA method for transformation include:
1. protoplast mediated transformation(protoplast-mediated transformation):The method uses various enzyme water
The cell wall of solution fungal mycelium, exposes cell membrane, under certain electrochemical conditions, cell membrane can absorb foreign DNA.But
It is the structure due to fungal cell wall and complicated component, and the cell wall of different plant species, the different subspecies of even same species
Structure and composition are all different, therefore, it is impossible to the method for unified protoplast preparation, and, a lot of funguses, especially beading sickle
Knife bacterium, protoplast is prepared extremely difficult, and step is extremely loaded down with trivial details, and needs special, expensive cytohydrolist.
2. agrobacterium tumefaciens mediated transformation method(Agrobacterium tumefaciens-mediated
transformation):Agrobacterium tumefaciens(Agrobacterium tumefaciens)It is a kind of gram negative bacteria, can
Infect plant callus and filamentous fungis, the cyclic plasmid Ti-DNA that can stablize heredity is inserted into the base of host in cell
Because in group.But the method step is troublesome, and time-consuming, and Agrobacterium is selective to host, and not all funguses are all suitable
Close in this way.Additionally, the position that foreign DNA inserts host genome is random it is impossible to anticipation.Foreign DNA can only be inserted
Enter host genome it is impossible to enough survive in the Cytoplasm of host freely.
3. Gene Knock-out Mice(Biolistic Transformation):The method adsorbs DNA in specialty metal
The surface of grain, is accelerated with gunpowder explosion or gases at high pressure, by the metallic particles having adsorbed DNA be sent directly into complete tissue or
Person's cell.This method needs very expensive special experimental facilitiess, and metallic particles consumptive material used usually needs to use
Gold material.Additionally, the method transformation efficiency is not high, and host cell mortality rate under metallic particles bombardment is high, regeneration
More difficult, therefore its range is restricted.
4, electroporated(Electroporation):This is that a kind of of short duration acting on of electric pulse contacts foreign DNA
Cell, makes foreign DNA enter cell, so that the method that cell trait changes.Need Agrobacterium with agrobacterium co-cultivation
Need metallic particles different as medium as medium, particle bombardment, this method does not need medium to carry foreign DNA.Pass
The electric shocking method of system, including Exponential Decay Wave electric shock and square wave electric shock.The energy of Exponential Decay Wave electric shock is especially big, the damage to cell
Wound is also very big, and microbial cell is simple due to structure, has cell wall, cell strong stress resistance, and vitality is strong, and much micro- lifes
The shell of thing cell is hard, is resistant to big energy shocks, and therefore Exponential Decay Wave electric shock is typically only used for microbial cell.And
Mammalian cell(Such as Human cell line), for relative microbes, relatively more fragile, easily dead, therefore, square wave electric shock is often
For mammalian cell.Additionally, square wave electric shock is also widely used for toy(As mice)Live body electricity conversion.
The HDEN electricity transformation technology emerging for 2013(high-density distributed electrode
network), be a kind of characteristic being specifically designed for mammalian cell, and open electricity transformation technology, its exploitation purpose be in order to
Improve the efficiency of transmission foreign DNA and medicine into mammalian cell.This technology comprises 3 most contents, and one is applied to
The electric wave form of cell sample, two is the solution environmental in electric shock for the cell sample, and three is cultural method and the electricity of cell sample
Hit front preprocess method.Because this technology is specific to mammalian cell exploitation, therefore, above-mentioned 3 most contents, all
It is to design for the characteristic of mammalian cell.
In the art it is known that the characteristic of microbial cell and cultural method, compared with mammalian cell, thousand is poor
Ten thousand is other.Mammalian cell is different with the structure of microbial cell, and mammalian cell does not have cell wall, microbial cell(Than
As majority of fungal, inclusion fusarium moniliforme)There is cell wall.The cell membrane of mammalian cell and the cell membrane of microorganism
Different.
Therefore, any technology being applied to mammalian cell, is all difficult to directly apply to microbial cell.Existing document
Report HDEN technology in HEK-293A, Hela, Neuro-2A, MCF-7, C2C12,3T3-L1, CHO, MDCK, HL-60,
Application in the mammalian cells such as HUVEC, A375, U251.Not yet there is thing beyond mammalian cell for this technology at present
The Case Report of application in kind.Therefore, HDEN electricity transformation technology can be applied to the species beyond mammalian cell, is also
One unknown number.
Filamentous fungis(Including fusarium moniliforme)It is class eukaryotic microorganisms, the genome of very eurypalynous funguses is many times
Body.When doing genetic engineering modified to living individual, the most difficult is exactly in the face of polyploid phenomenon.Because the transformation to polyploid,
Usually inefficiency(Such as gene targeting only may hit item chromosome, and other one or several homology dyeing of missing the target
Body), and polyploid is in schizogamy, and homologous chromosome separates it is also difficult to a transformation site is entailed all filial generations.This
Well-known in the art.
Fungal spore is the main organ of multiplication of funguses, and spore is in resting state and can survive for a long time.Spore exists
Under suitable external condition, can revive and sprout, form mycelia and carry out schizogamy.Most importantly, a lot of types
The spore of funguses, is natural monoploid, directly haplospore is carried out genetic engineering modified, and efficiency far is higher than that operation is many
Times body.
But, because spore is typically in resting state, its cell wall is very abundant, the cell wall of resting spore, cell
The state of film, is different from sprouting spore and mycelium.And the intracellular vital movement of resting spore be also at least vigorous
State, therefore, it is known in the art that the cell permeability of resting spore is not so good as to sprout spore and mycelia, resting spore is hardly
Exchange material with the external world, of seclusion, it is typically in sleep state.And sprout spore or mycelium, need to absorb respectively from extraneous
Plant nutrient molecule supply vital movement, therefore cell wall and membrane passage is more than resting spore.So it is very difficult to will
Exogenous DNA molecule is importing directly into the inside of sleep spore.
In existing several big mature technology:Protoplast transformation, as the source of the protoplast of host cell, typically
It is the mycelium of funguses(Polyploid).Agrobacterium_mediated method, under agriculture bacillus mediated, Agrobacterium and fungal spore solid
Body media surface co-cultures a couple of days, can be Exogenous DNA transfered fungal cell.But this way is not directly to spore
Converted, because during co-culturing, fungal spore can be sprouted, spore is sprouted in then Agrobacterium invasion and attack, could import outer
Source DNA.And agrobacterium co-cultivation, need Agrobacterium as the medium of mediation, need first to do an Agrobacterium-mediated Transformation, just can do follow-up
Fungal transformation, therefore operate extremely complex and loaded down with trivial details, and the cycle be long.
Traditional electroporated method(Exponential Decay Wave is used to shock by electricity), host cell uses the allergenic of sprouting
Son.The electric-shocking method for fungal spore of the foundation such as such as Ozeki, could be electroporated it is necessary to allow after spore germination(Should
Method discloses and allows the specific experiment step of spore germination and details).The method is pioneering classical technology in industry, is at present
Only no significantly improve, used till today by those skilled in the art always.Present inventor also attempted not sprouted with the method conversion
Spore, success, at present, does not have any successful document report yet.The method of the foundation such as Ozeki is shown in document 1:OZEKI K,
KYOYA F, HIZUME K, KANDA A, HAMACHI M, NUNOKAWA Y. Transformation of intact
Aspergillus niger by electroporation [J]. Biosci Biotechnol Biochem, 1994, 58
(12): 2224-2227.
At present, not yet there are any method, any report, situation about directly exogenous DNA molecule being mediated in no medium can be accomplished
Under, import dormancy(Do not sprout)Inside fungal spore.This is also the technical barrier that one's own profession is never captured in the industry.
Content of the invention
It is an object of the invention to overcoming the deficiencies in the prior art, provide one kind directly by Exogenous DNA transfered beading reaping hook
The method of bacterium resting spore.The step for the method bypasses fungus spore germination, using HDEN electricity transformation technology, directly uses dormancy
Spore, to import foreign DNA.
For achieving the above object, the present invention adopts the following technical scheme that:
A kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, comprise the following steps:
1)Fusarium moniliforme culture and spore are collected
In solid agar medium surface seeding fusarium moniliforme, cultivate and cover with fusarium moniliforme spore to media surface, wash
The fusarium moniliforme spore of lower media surface, suctions out spore suspension and filters removal mycelia, collect the filtrate containing spore, will
Filtrate is centrifuged, and collects the resting spore of precipitation;
2)Fusarium moniliforme spore pretreatment
With the resuspended spore of electroporation buffer, it is centrifuged and collects spore precipitation, after repeating above-mentioned resuspended and centrifugation step 3-4 time, general
The spore precipitation finally collected is resuspended in electroporation buffer, and obtaining spore concentration is 104—1011The fusarium moniliforme of individual/ml
Spore suspension;
Described electroporation buffer is by the 4- hydroxyethyl piperazine ethanesulfonic acid of final concentration of 0.01-100mmol/L(HEPES)And final concentration
Mannitol composition for 0.5-5000mmol/L, the pH of electroporation buffer is 3.0-9.5;
3)Using HDEN method electric shock fusarium moniliforme spore
Fusarium moniliforme spore suspension and plasmid to be transformed that in the hole of Tissue Culture Plate, addition above-mentioned steps obtain, mix
Even, obtain spore and plasmid mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then adopt Etta Biotech
X-Porator H1 electroporation carries out HDEN method electric shock, by the electric shock head insertion spore with matrix form electrode and plasmid mixture
Inside, Tissue Culture Plate, so that producing electric field inside spore and plasmid mixture, is placed in ice bath on ice after electric shock by energising again
Then spore and plasmid mixture are suctioned out by 10-15min, obtain importing the fusarium moniliforme spore of the dormancy of foreign DNA;
The ratio of described fusarium moniliforme suspension and plasmid to be transformed is:The fusarium moniliforme spore suspension of 6-600000 μ l:
The plasmid to be transformed of 0.1-10000 μ g;
Described shock parameters are as follows:Voltage 1 6000V, pulsewidth 2-2000000ms, repeats 1-100 time, every minor tick 5-
50000ms.
Further, described step 1)Culture medium be PDA culture medium, YPD culture medium or Czapek's medium, preferably PDA
The effect of culture medium preferably, produces spore the most most.
Described step 1,)The condition of culture of fusarium moniliforme is:Temperature 16-40 DEG C, humidity 15-85%, cultivate 3-15 day.
Preferably, described step 1), the condition of culture of fusarium moniliforme is:24 DEG C of temperature, humidity 50-60%, cultivate 5.
Further, described step 2), electroporation buffer is by the HEPES and final concentration of 50- of final concentration of 1-10mmol/L
The Mannitol composition of 100mmol/L, the pH of electroporation buffer is 5.0-7.0;
Preferably, described step 2), electroporation buffer is by the HEPES and final concentration of 50mmol/L of final concentration of 1mmol/L
Mannitol forms, and the pH of electroporation buffer is 7.0.
Described step 2)Fusarium moniliforme spore suspension before electric shock, in basis of microscopic observation, confirm in spore suspension
No mycelium mixes pollution and spore is not all sprouted, and is then shocked by electricity again.
Further, described step 3), plasmid to be transformed is recombiant plasmid AnEp8-hygro, described recombiant plasmid AnEp8-
Hygro is formed by hygromycin B resistant gene and AnEp8 plasmid construction, and described electric shock adopts Etta Biotech X-Porator
H1 electroporation.
Preferably, the ratio of fusarium moniliforme suspension and recombiant plasmid AnEp8-hygro is:The fusarium moniliforme spore of 60 μ l
Fullness over the chest during pregnancy liquid:The recombiant plasmid AnEp8-hygro of 1 μ g.
Further, described step 3), voltage 300-3000V, pulsewidth 200-1000000ms, repeats 3-50 time, every minor tick
500-5000ms;It is preferably:Voltage 300V, pulsewidth 1500ms, it is repeated 3 times, every minor tick 500ms.
Further, fusarium moniliforme resting spore, described step 3 have been imported in order to verify foreign DNA), electric shock, again ice
Also comprise the steps after bath:Spore and plasmid mixture are suctioned out, is coated on the HYG containing final concentration of 200 μ g/ml
YPD solid agar medium flat board on, at temperature 16-40 DEG C, humidity 15-85% cultivate(It is preferably 28 DEG C of temperature, humidity
Cultivate under 50-60%), until forming single bacterium colony, and carry out colony counting.
Described HYG(Hygromycin B, CAS number:31282-04-9)With high-purity water dissolution that sterilizes, prepare highly concentrated
Degree mother solution, using front, is added in culture medium according to concentration ratio.
While carrying out above-mentioned experimental procedure, need to prepare matched group:By not shocking by electricity, identical " spore and plasmid
Mixture ", is coated on the YPD solid agar medium flat board of the other one piece HYG containing 200 μ g/ml, the same terms
Lower culture.When this matched group does not form single bacterium colony, can determine whether that the single bacterium colony of experimental group is positive colony.
After experimental group forms single bacterium colony, extract the DNA of experimental group single bacterium colony, using may contain in pcr amplified DNA
External source hygromycin B resistant gene, amplified production judges stripe size using agarose gel electrophoresiies, when stripe size meets expection
Afterwards, using Sanger DNA sequencing method, determine whether its DNA sequence is coincide with external source hygromycin B resistant gene.If coincide,
Then can accurately judge that positive colony is successful transformant.
Fusarium moniliforme of the present invention is fusarium moniliforme ATCC 46493, and described electric shock adopts Etta Biotech
X-Porator H1 electroporation, buys and reaches biotech firm from Suzhou one.
The present invention collects the spore do not sprouted, and follow-up electricity turns experimentation, if no specified otherwise, experimental implementation is equal
Not higher than 23 degrees Celsius of constant temperature laboratory operates, centrifugation step is 4 DEG C of frozen centrifugations, each of spore is not sprouted in contact
Plant liquid all in advance in pre-cooling on ice.Do not sprout spore forbid to touch any containing the factor that it can be promoted to sprout and material
(Germination medium such as with YEPD etc. as representative), to ensure the resting state of spore.
Fusarium moniliforme incubation of the present invention, when fusarium moniliforme surface covers with spore(Can by color and form Lai
Judge)Afterwards, pour sterilized water into media surface, wash the fusarium moniliforme spore of lower media surface, suction out spore with pipettor
Fullness over the chest during pregnancy liquid, using the lens paper sterilizing(Or sand core funnel, filter paper etc.)Filter, remove mycelia, retain spore, without
Filtration step, then can be contaminated with mycelia in spore suspension, the transformant that subsequent step obtains is it is impossible to judging is by spore actually
The positive colony being formed after conversion DNA, or mycelia converts the false positive of formation after DNA.The spore obtaining chromosome also to be used
Staining is to its chromosome dyeing, and observes and confirm that the chromosome in spore is haploid state.
The water that the present invention prepares solid agar medium should be the molecular biology high purity water of MillQ rank or double steaming
Water, resistivity of water is not less than 18.2M Ω-cm.
During using HDEN method electric shock fusarium moniliforme spore, the hole of Tissue Culture Plate adds the beading sickle of proper proportion
Knife bacterium spore suspension and plasmid to be transformed, mixing is even, container is placed in and carries out ice bath on ice.For example in 96 hole cell culture
In the hole of plate(Nunclon Surface 96 porocyte culture plates of NUNC company, article No. Cat.No.167008), add 60 μ l
Fusarium moniliforme spore suspension, and 1 μ g recombiant plasmid AnEp8-hygro.Described Tissue Culture Plate can also be 384 orifice plates,
24 orifice plates, 6 orifice plates or other are bigger, less container, then according to container volume size, zoom in or out spore
With plasmid mixture system.
The present invention adopts above technical scheme, is used as importing the parent material of exogenous molecules with the spore do not sprouted, non-
Often easy because can save do this complicated step of spore germination it is often more important that, the spore of sprouting, may produce
Give birth to polyploid, and the spore do not sprouted has been it is ensured that be monoploid, much engineered application is it is desirable to host cell must
Must be monoploid, can be only achieved result or the efficiency of anticipation.Meanwhile, present invention application HDEN electricity transformation technology is by foreign DNA
Import fusarium moniliforme resting spore.HDEN electricity transformation technology employs high-density matrix formula electrode, and it can produce high uniformity
And the enough electric fields of intensity, in electric field, the condition of each cell acceptance electric shock is almost completely the same, during operation, as long as cell is put
In universal container, such as Tissue Culture Plate, then in the electric shock head insertion container with matrix form electrode, be energized.And
It is usually to use special electric shock cup that traditional electricity turns technology, places cell between two pieces of metallic plates being placed in parallel, and to gold
Belong to plate to power up, form electric field electric shock.Therefore, the discharge mode of the two is entirely different, inside the former electrode insertion cell suspension,
Internally produce electric field, and the latter is in the overall outside generation electric field of cell suspension;The former electrode tip is by many metal needles
Composition, produces voltage between pin and pin, and the latter only has two pieces of metallic plates, one piece of positive pole, one piece of negative pole, produces between
Raw voltage.HDEN technology also essentially eliminates the cathode effect of traditional electric shock technology, it is to avoid produce a large amount of hydroxide ions, it is to avoid
Kill cell, improve the cell survival rate after electric shock.And traditional electric shock technology very difficult elimination cathode effect.In addition, traditional electricity
Method of hitting typically only shocks by electricity 1 time, if because traditional electric-shocking method electric shock is multiple, then cell mortality can greatly increase, and
The HDEN method of the present invention can shock by electricity repeatedly, can be superimposed the effect of multiple electric shock, and it is dead cell will not to be dramatically increased
Die rate.
HDEN electricity transformation technology is a kind of characteristic being specifically designed for mammalian cell and opens electricity transformation technology, it is opened
Send out the efficiency that purpose is to improve transmission foreign DNA and medicine into mammalian cell.And in the art it is known that
The characteristic of microbial cell and cultural method, compared with mammalian cell, vary.Mammalian cell and microorganism are thin
The structure of born of the same parents is different, and mammalian cell does not have cell wall, microbial cell(Such as majority of fungal, inclusion beading reaping hook
Bacterium)There is cell wall.The cell membrane of the cell membrane of mammalian cell and microorganism is also different.Even same biology, it
Different tissues, Different Organs or different cell types, respective cell membrane, the structure of cell wall, state, chemical composition,
Also all different.Even same biological same tissue, same organ, same cell type, in different lifes
The long stage of development, or in different external environments, respective cell membrane, the structure of cell wall, state, chemical composition,
All different.And cell wall and cell membrane, it is to stop that exogenous molecules enter the barrier of cell, barrier is different(Structure is different, chemistry
Composition is different), the method determining breakthrough barrier is also different.Additionally, different exogenous molecules, because having different knots
Structure, molecular weight, volume and chemical composition, in the face of identical barrier when, the method that different exogenous molecules break through barriers is also to differ
Sample.If in the face of different barriers, then different exogenous molecules break through method and the mechanism of different barriers, even more vary
?.
Therefore, any technology being applied to mammalian cell, is all difficult to directly apply to microbial cell.At present not yet
There is the Case Report that HDEN technology is applied in the species beyond mammalian cell.The present invention is directed to fusarium moniliforme cell
Characteristic, using HDEN technology by Exogenous DNA transfered fusarium moniliforme resting spore, the method determines the culture side of cell sample
Preprocess method before method and electric shock, the solution environmental in electric shock for the cell sample, and the electric wave form putting on cell sample.
Very easy to be quick using the inventive method, wild spore is directly used as raw material, competence system need not be carried out to spore
Standby process, need not be with various loaded down with trivial details methods(As enzyme hydrolysis method)Remove archespore wall, as long as wild spore wash clean,
It is resuspended in electroporation buffer again, step is the easiest.Protoplasm body in traditional method, needs special cell wall hydrolysis
Enzyme, the step needing complicated preparation and regeneration protoplast;Traditional electric shocking method, needs first spore germination to be processed, treats it
Just can be electroporated after sprouting, and conversion ratio is low;Traditional agrobacterium co-cultivation, needs first to do Agrobacterium-mediated Transformation, after just doing
Continuous fusarium moniliforme conversion;Traditional particle bombardment, needs expensive consumptive material, and conversion ratio is low.
The inventive method high conversion rate, each conversion reaction system, at least can reach no less than 6000 positive transformants
The effect of son, the AnEp8-hygro plasmid volume of such as embodiment 1 is 12.4 kb, with 1 μ g plasmid(About 124.26 fmol
Individual plasmid molecule), electric shock 6 × 106The resting spore that individual fusarium moniliforme is not sprouted, can produce and be no less than 8000 positive transformants
Son.
It is known that the volume of plasmid and conversion ratio are inversely proportional to, the bigger plasmid of volume, be less susceptible to through cell wall and
Cell membrane, the plasmid of the 12.4kb used by the present invention belongs to ultra-large type plasmid, the fusarium moniliforme conversion of existing document report(Former
Raw plastid transformation, electricity conversion)Plasmid volume major part is all in below 8kb.
There are multiple description methods with regard to conversion ratio height this area at present, including:How many μ g plasmids can produce how many
Positive transformant;How many plasmids(Molal quantity, DNA molecular number)How many positive transformants can be produced;How many hosts are thin
Born of the same parents can produce how many positive transformants, etc..This patent discloses host cell number, the quality of plasmid, the molecule of plasmid
Number, the various index of molecular weight of plasmid etc., evaluate anyway, evaluated the conversion ratio of a transformation system with what mode
Just, can be calculated using these indexs that this patent discloses and be converted.
Brief description
Fig. 1 is embodiment 1 uses in PCR amplification verification sample, whether the agarose gel containing hygromycin gene is electric
Swimming figure.
Specific embodiment
Below example is easy to be better understood from the present invention, but does not limit the present invention.
The all operations of experimentation are intended to follow sterile working's principle of Experiment on Microbiology, and vessel, consumptive material, reagent are intended to sterilize
Process.
Embodiment 1
A kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, comprise the following steps:
1)Fusarium moniliforme culture and spore are collected
In 15cm culture dish, prepare solid agar medium(PDA culture medium), in solid agar medium surface seeding beading
Fusarium spp. ATCC 46493, in 24 DEG C of temperature, under humidity 50-60%, cultivates 5, allows media surface cover with fusarium moniliforme spore
Son.
Pour sterilized water into media surface, wash down(Concussion, or gently scratched with smooth sterile glass spreading rod)
The fusarium moniliforme spore of media surface, suctions out spore suspension with pipettor, using the lens paper sterilizing(Or core leaks
Bucket, filter paper etc.)Filter, remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after centrifugation, collects the dormancy spore of precipitation
Son, removes supernatant fluid.The spore obtaining also uses chromosome dyeing method to its chromosome dyeing, and observes and confirm in spore
Chromosome be haploid state.
2)Fusarium moniliforme spore pretreatment
With electroporation buffer resuspended spore precipitation(The volume adding electroporation buffer should be able to fill full centrifuge tube), then be centrifuged, receive
Collection spore precipitation, removes supernatant fluid.Repeat the above steps twice after, again spore is resuspended in electroporation buffer, micro-
Sem observation, confirms that in spore suspension, no mycelium mixes pollution, and confirms that spore is not all sprouted.Last that spore is resuspended
The volume of electroporation buffer when electroporation buffer, should be controlled, keep fusarium moniliforme spore suspension miospore concentration to be 108
Individual/ml.
Described electroporation buffer is made up of the Mannitol of the HEPES and final concentration of 50mmol/L of final concentration of 1mmol/L,
The pH of electroporation buffer is 7.0.
3)Using HDEN method electric shock fusarium moniliforme spore
The fusarium moniliforme spore suspension of 60 μ l is added in the hole of 96 porocyte culture plates, and 1 μ g recombiant plasmid AnEp8-
Hygro, mixes, obtains spore and plasmid mixture, container is placed in ice bath 10min on ice, then adopts Etta Biotech
X-Porator H1 electroporation carries out HDEN method electric shock, by the electric shock head insertion spore with matrix form electrode and plasmid mixture
Inside, Tissue Culture Plate, so that producing electric field inside spore and plasmid mixture, is placed in ice bath on ice after electric shock by energising again
Then spore and plasmid mixture are suctioned out by 10min, obtain importing the fusarium moniliforme spore of the dormancy of foreign DNA;
The present embodiment shock parameters are as follows:Voltage 300V, pulsewidth 1500ms, it is repeated 3 times, every minor tick 500ms.
4)Confirmatory experiment
By the spore of above-mentioned sucking-off and plasmid mixture, it is coated on the YPD solid of the HYG containing final concentration of 200 μ g/ml
On agar culture medium flat board, in 28 DEG C of temperature, cultivating under humidity 50-60%, until forming single bacterium colony, and carrying out colony counting, meter
Calculate conversion ratio.
While carrying out above-mentioned experimental procedure, need to prepare matched group:By not shocking by electricity, identical " spore and plasmid
Mixture ", is coated on the YPD solid agar medium flat board of the other one piece HYG containing 200 μ g/ml, the same terms
Lower culture.When matched group does not form single bacterium colony, the single bacterium colony of therefore judgment experiment group is positive colony.
After experimental group forms single bacterium colony, extract the DNA of experimental group single bacterium colony, using may contain in pcr amplified DNA
External source hygromycin B resistant gene, amplified production judges stripe size using agarose gel electrophoresiies, electrophoresis result as shown in figure 1,
Electrophoresis swimming direction is from bottom to top, and Marker is takara 250bp DNA ladder marker, and swimming lane 1 is negative right
According to, swimming lane 2 in 1kb about visible clearly band, this band is consistent with hygromycin B resistant gene band, illustrates to convert successfully,
I.e. swimming lane 2 is the hygromycin B resistant gene band being amplified.Then using Sanger DNA sequencing method, result shows its DNA sequence
Row are coincide with external source hygromycin B resistant gene, therefore can accurately judge that the positive colony of the present embodiment is successful transformant.
The present embodiment AnEp8-hygro plasmid volume is 12.4 kb, with 1 μ g plasmid(About 124.26 fmol plasmids
Molecule), electric shock 6 × 106The resting spore that individual fusarium moniliforme is not sprouted, creates no less than 8000 positive transformants.
The recombiant plasmid AnEp8-hygro of the present embodiment is formed by hygromycin B resistant gene and AnEp8 plasmid construction.Weight
The construction method of group plasmid AnEp8-hygro is as follows:
Hygromycin B resistant gene is as shown in SEQ ID NO.1.
Coded protein sequence is as shown in SEQ ID NO.2.
Using following primer, PCR expands above-mentioned hygromycin B resistant gene:
F:CATTAGCTAGCATGAAAAAGCCTGAACTCACCG
R:TCTGGCGCGCCCTATTCCTTTGCCCTCGG
PCR system(50μL):Template 3 μ L, primers F(10μM)2 μ L, primer R(10μM)2 μ L, 2X Taq PCR mix 25 μ L,
ddH2O mends to 50 μ L.
PCR program:94 DEG C of 10min,(94 DEG C of 30s, 61.8 DEG C of 30s, 72 DEG C of 90s)35 circulations of X, 72 DEG C of 10min.
PCR primer is entered with row agarose gel electrophoresis detection, after detection is errorless, using Thermo GeneJET Gel
Extraction and DNA Cleanup Micro Kit reclaims PCR primer.
AnEp8 plasmid is given by U.S.'s FGSC Culture Collection, and the disclosure of AnEp8 plasmid is shown in document 2: STORMS R,
ZHENG Y, LI H, SILLAOTS S, MARTINEZ-PEREZ A, TSANG A. Plasmid vectors for
protein production, gene expression and molecular manipulations in
Aspergillus niger [J]. Plasmid, 2005, 53(3): 191-204.
Using the AnEp8 plasmid in document 2.AnEp8 plasmid sequence is as shown in SEQ ID NO.3.AnEp8 plasmid is given birth to using Shanghai
Work plasmid extraction kit extracts, and AnEp8 plasmid and hygromycin B resistant gene PCR primer after purification are all used Fermentas
Company Fastdigest series of restriction restriction endonuclease Nhe 1 and Asc 1 enzymes double zyme cutting, after agarose gel electrophoresiies reclaim
(Reclaimed using Thermo GeneJET Gel Extraction and DNA Cleanup Micro Kit), with T4 DNA even
Connect enzyme(Fermentas Products), hygromycin B gene and AnEp8 plasmid are connected, above-mentioned enzyme action and attended operation are all strict
Carry out according to shop instruction.Convert escherichia coli, construction recombination plasmid Anep8-hygro afterwards again.Recombiant plasmid Anep8-
Hygro with Sanger sequencing sequence verification and double digestion checking errorless after, mass propgation escherichia coli, public with Qiagen
The plasmid extraction kit of department(EndoFree Plasmid Maxi Kit)Extract recombiant plasmid(According to shop instruction behaviour
Make).
Embodiment 2
A kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, comprise the following steps:
1)Fusarium moniliforme culture and spore are collected
In 15cm culture dish, prepare solid agar medium(YPD culture medium), in solid agar medium surface seeding beading
Fusarium spp. ATCC 46493, in 16 DEG C of temperature, under humidity 15-50%, cultivates 15, allows media surface cover with fusarium moniliforme
Spore.
Pour sterilized water into media surface, wash down(Concussion, or gently scratched with smooth sterile glass spreading rod)
The fusarium moniliforme spore of media surface, suctions out spore suspension with pipettor, using the lens paper sterilizing(Or core leaks
Bucket, filter paper etc.)Filter, remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after centrifugation, collects the dormancy spore of precipitation
Son, removes supernatant fluid.The spore obtaining also uses chromosome dyeing method to its chromosome dyeing, and observes and confirm in spore
Chromosome be haploid state.
2)Fusarium moniliforme spore pretreatment
With electroporation buffer resuspended spore precipitation(The volume adding electroporation buffer should be able to fill full centrifuge tube), then be centrifuged, receive
Collection spore precipitation, removes supernatant fluid.Repeat the above steps twice after, again spore is resuspended in electroporation buffer, micro-
Sem observation, confirms that in spore suspension, no mycelium mixes pollution, and confirms that spore is not all sprouted.Last that spore is resuspended
The volume of electroporation buffer when electroporation buffer, should be controlled, keep fusarium moniliforme spore suspension miospore concentration to be 1011
Individual/ml.
Described electroporation buffer by final concentration of 0.01mmol/L HEPES and final concentration of 0.5mmol/L Mannitol
Composition, the pH of electroporation buffer is 3.0.
3)Using HDEN method electric shock fusarium moniliforme spore
The fusarium moniliforme spore suspension of 6 μ l is added in the hole of 96 porocyte culture plates, and 0.1 μ g recombiant plasmid AnEp8-
Hygro, mixes, obtains spore and plasmid mixture, container is placed in ice bath 15min on ice, then adopts Etta Biotech
X-Porator H1 electroporation carries out HDEN method electric shock, by the electric shock head insertion spore with matrix form electrode and plasmid mixture
Inside, Tissue Culture Plate, so that producing electric field inside spore and plasmid mixture, is placed in ice bath on ice after electric shock by energising again
Then spore and plasmid mixture are suctioned out by 15min, obtain importing the fusarium moniliforme spore of the dormancy of foreign DNA;
The present embodiment shock parameters are as follows:Voltage 1V, pulsewidth 2000000ms, repeats 100 times, every minor tick 5ms.
4)Confirmatory experiment
By the spore of above-mentioned sucking-off and plasmid mixture, it is coated on the YPD solid of the HYG containing final concentration of 200 μ g/ml
On agar culture medium flat board, in 16 DEG C of temperature, cultivating under humidity 15-50%, until forming single bacterium colony, and carrying out colony counting, meter
Calculate conversion ratio.
Likewise, while carrying out above-mentioned experimental procedure, needing to prepare matched group(With embodiment 1).
After experimental group forms single bacterium colony, extract the DNA of experimental group single bacterium colony, according to this reality of method validation of embodiment 1
The positive colony applying example is successful transformant.
The present embodiment AnEp8-hygro plasmid volume is 12.4 kb, with 0.1 μ g plasmid(About 12.426 fmol matter
Grain molecule), electric shock 6 × 108The resting spore that individual fusarium moniliforme is not sprouted, creates no less than 6000 positive transformants.
The construction method of the recombiant plasmid AnEp8-hygro of the present embodiment is with embodiment 1.
Embodiment 3
A kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, comprise the following steps:
1)Fusarium moniliforme culture and spore are collected
In 15cm culture dish, prepare solid agar medium(PDA culture medium), in solid agar medium surface seeding beading
Fusarium spp. ATCC 46493, in 40 DEG C of temperature, under humidity 60-85%, cultivates 3, allows media surface cover with fusarium moniliforme spore
Son.
Pour sterilized water into media surface, wash down(Concussion, or gently scratched with smooth sterile glass spreading rod)
The fusarium moniliforme spore of media surface, suctions out spore suspension with pipettor, using the lens paper sterilizing(Or core leaks
Bucket, filter paper etc.)Filter, remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after centrifugation, collects the dormancy spore of precipitation
Son, removes supernatant fluid.The spore obtaining also uses chromosome dyeing method to its chromosome dyeing, and observes and confirm in spore
Chromosome be haploid state.
2)Fusarium moniliforme spore pretreatment
With electroporation buffer resuspended spore precipitation(The volume adding electroporation buffer should be able to fill full centrifuge tube), then be centrifuged, receive
Collection spore precipitation, removes supernatant fluid.Repeat the above steps twice after, again spore is resuspended in electroporation buffer, micro-
Sem observation, confirms that in spore suspension, no mycelium mixes pollution, and confirms that spore is not all sprouted.Last that spore is resuspended
The volume of electroporation buffer when electroporation buffer, should be controlled, keep fusarium moniliforme spore suspension miospore concentration to be 104
Individual/ml.
Described electroporation buffer by final concentration of 100mmol/L HEPES and final concentration of 5000mmol/L Mannitol
Composition, the pH of electroporation buffer is 7.0.
3)Using HDEN method electric shock fusarium moniliforme spore
The fusarium moniliforme spore suspension of 600000 μ l is added in the hole of 96 porocyte culture plates, and 10000 μ g recombiant plasmid
AnEp8-hygro, mixes, obtains spore and plasmid mixture, container is placed in ice bath 10min on ice, then adopts Etta
Biotech X-Porator H1 electroporation carries out HDEN method electric shock, by the electric shock head insertion spore with matrix form electrode and matter
Inside grain mixture, Tissue Culture Plate, so that producing electric field inside spore and plasmid mixture, is placed in after electric shock by energising again
Then spore and plasmid mixture are suctioned out by ice bath 10min on ice, obtain importing the fusarium moniliforme spore of the dormancy of foreign DNA
Son;
The present embodiment shock parameters are as follows:Voltage 6000V, pulsewidth 2ms, it is repeated 1 times, be spaced 50000ms.
4)Confirmatory experiment
By the spore of above-mentioned sucking-off and plasmid mixture, it is coated on the YPD solid of the HYG containing final concentration of 200 μ g/ml
On agar culture medium flat board, in 40 DEG C of temperature, cultivating under humidity 60-85%, until forming single bacterium colony, and carrying out colony counting, meter
Calculate conversion ratio.
Likewise, while carrying out above-mentioned experimental procedure, needing to prepare matched group(With embodiment 1).
After experimental group forms single bacterium colony, extract the DNA of experimental group single bacterium colony, according to this reality of method validation of embodiment 1
The positive colony applying example is successful transformant.
The present embodiment AnEp8-hygro plasmid volume is 12.4 kb, with 10000 μ g plasmids(About 1242600 fmol
Plasmid molecule), electric shock 6 × 106The resting spore that individual fusarium moniliforme is not sprouted, produces and is no less than 7000 positive transformants.
The construction method of the recombiant plasmid AnEp8-hygro of the present embodiment is with embodiment 1.
Embodiment 4
The present embodiment shock parameters are:Voltage 30V, pulsewidth 1000000ms, shocks by electricity 50 times, is spaced 5000ms, other same embodiments
1, create no less than 6500 positive transformants.
Embodiment 5
The present embodiment shock parameters are:Voltage 3000V, pulsewidth 100ms, shock by electricity 5 times, interval 25000ms, the other the same as in Example 1,
Create no less than 7200 positive transformants.
The mode by Exogenous DNA transfered fusarium moniliforme resting spore that the present invention provides, can be in fusarium moniliforme spore
Import arbitrary plasmid under sub- resting state, be not limited only to recombiant plasmid AnEp8-hygro.
SEQUENCE LISTING
<110>University of Fuzhou
<120>A kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore
<130> 1
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 1026
<212> DNA
<213>Artificial sequence
<400> 1
atgaaaaagc ctgaactcac cgcgacgtct gtcgagaagt ttctgatcga aaagttcgac 60
agcgtctccg acctgatgca gctctcggag ggcgaagaat ctcgtgcttt cagcttcgat 120
gtaggagggc gtggatatgt cctgcgggta aatagctgcg ccgatggttt ctacaaagat 180
cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt gcttgacatt 240
ggggaattca gcgagagcct gacctattgc atctcccgcc gtgcacaggg tgtcacgttg 300
caagacctgc ctgaaaccga actgcccgct gttctgcagc cggtcgcgga ggccatggat 360
gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg accgcaagga 420
atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat 480
cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag 540
ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc 600
tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg gagcgaggcg 660
atgttcgggg attcccaata cgaggtcgcc aacatcttct tctggaggcc gtggttggct 720
tgtatggagc agcagacgcg ctacttcgag cggaggcatc cggagcttgc aggatcgccg 780
cggctccggg cgtatatgct ccgcattggt cttgaccaac tctatcagag cttggttgac 840
ggcaatttcg atgatgcagc ttgggcgcag ggtcgatgcg acgcaatcgt ccgatccgga 900
gccgggactg tcgggcgtac acaaatcgcc cgcagaagcg cggccgtctg gaccgatggc 960
tgtgtagaag tactcgccga tagtggaaac cgacgcccca gcactcgtcc gagggcaaag 1020
gaatag 1026
<210> 2
<211> 341
<212> PRT
<213>Artificial sequence
<400> 2
Met Lys Lys Pro Glu Leu Thr Ala Thr Ser Val Glu Lys Phe Leu Ile
1 5 10 15
Glu Lys Phe Asp Ser Val Ser Asp Leu Met Gln Leu Ser Glu Gly Glu
20 25 30
Glu Ser Arg Ala Phe Ser Phe Asp Val Gly Gly Arg Gly Tyr Val Leu
35 40 45
Arg Val Asn Ser Cys Ala Asp Gly Phe Tyr Lys Asp Arg Tyr Val Tyr
50 55 60
Arg His Phe Ala Ser Ala Ala Leu Pro Ile Pro Glu Val Leu Asp Ile
65 70 75 80
Gly Glu Phe Ser Glu Ser Leu Thr Tyr Cys Ile Ser Arg Arg Ala Gln
85 90 95
Gly Val Thr Leu Gln Asp Leu Pro Glu Thr Glu Leu Pro Ala Val Leu
100 105 110
Gln Pro Val Ala Glu Ala Met Asp Ala Ile Ala Ala Ala Asp Leu Ser
115 120 125
Gln Thr Ser Gly Phe Gly Pro Phe Gly Pro Gln Gly Ile Gly Gln Tyr
130 135 140
Thr Thr Trp Arg Asp Phe Ile Cys Ala Ile Ala Asp Pro His Val Tyr
145 150 155 160
His Trp Gln Thr Val Met Asp Asp Thr Val Ser Ala Ser Val Ala Gln
165 170 175
Ala Leu Asp Glu Leu Met Leu Trp Ala Glu Asp Cys Pro Glu Val Arg
180 185 190
His Leu Val His Ala Asp Phe Gly Ser Asn Asn Val Leu Thr Asp Asn
195 200 205
Gly Arg Ile Thr Ala Val Ile Asp Trp Ser Glu Ala Met Phe Gly Asp
210 215 220
Ser Gln Tyr Glu Val Ala Asn Ile Phe Phe Trp Arg Pro Trp Leu Ala
225 230 235 240
Cys Met Glu Gln Gln Thr Arg Tyr Phe Glu Arg Arg His Pro Glu Leu
245 250 255
Ala Gly Ser Pro Arg Leu Arg Ala Tyr Met Leu Arg Ile Gly Leu Asp
260 265 270
Gln Leu Tyr Gln Ser Leu Val Asp Gly Asn Phe Asp Asp Ala Ala Trp
275 280 285
Ala Gln Gly Arg Cys Asp Ala Ile Val Arg Ser Gly Ala Gly Thr Val
290 295 300
Gly Arg Thr Gln Ile Ala Arg Arg Ser Ala Ala Val Trp Thr Asp Gly
305 310 315 320
Cys Val Glu Val Leu Ala Asp Ser Gly Asn Arg Arg Pro Ser Thr Arg
325 330 335
Pro Arg Ala Lys Glu
340
<210> 3
<211> 6638
<212> DNA
<213>Artificial sequence
<400> 3
atgtcttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 60
gctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct 120
ttcgtctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga 180
cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag 240
cgggtgttgg cgggtgtcgg ggctggctta actatgcggc atcagagcag attgtactga 300
gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca 360
ggcgccattc gccattcagg ctgcgcaact gttgggaagg gcgatcggtg cgggcctctt 420
cgctattacg ccagctggcg aaagggggat gtgctgcaag gcgattaagt tgggtaacgc 480
cagggttttc ccagtcacga cgttgtaaaa cgacggccag tgccaagctt gcatgcctgc 540
aggtccgcga atattccgga gatcctgatc atccgtgaga atgaagagga agttgggttt 600
gcgtgcagag accgatggct cctcatccag cagtacctgc tgctgcacag cgagggcatc 660
gcatcccacg aatagggcca acaaagccgg caagaacatc atgatgggag cgacaattcc 720
gtatcaatct cccttgcacg atgttggttg tcactcaccg acactccgtc accaagatca 780
ctattaaaac aagagtgagt tcaaggttgc gatcaagata gcgattgcgc agcaacggca 840
cgggataacg ccatagctct gatggagccg atcagaccag taggtaaact agtcagtcag 900
cgttggactg gagctgcaga gagagttgaa cctggacgcc gcgcaaaaag caaagacgcg 960
cctcgtgggc ggtggatcaa tgatcggatt tagtggcaga tggcatcaca ggcggccaat 1020
gaccaccggg ccaactggcc ccgacattcc agcaatactg cctaattgac tccaccatgc 1080
atctcggcta ttattgaact gggtttgatg gatggggacc ctcttggaat tgtcaaagat 1140
tttgaagcga agacgatcta ttggacggta gagatatact cttgatttag tcgttgggag 1200
gcccctgggg aaagcaatga tggggaatgt tgctgctcca ctgtggacct cggctatgga 1260
attacgtgct tggatctaag atgagctcat ggctatgcat tgaatgacag tgatatcagc 1320
agagcaagca gagaaggatg gaatgctaat tttctagtgc tttgtgcaag ggtaaatcag 1380
ggactgtctg tctggtcttc tacacgaagg gaagaccatg gctttcacgg tgtctgtatt 1440
tccggatatc ctcaattccg tcggtcgatt acaatcacat gacttggctt ccatttcact 1500
actattatgc acacccacta catacatgat catataacca attgccctca tccccatcct 1560
ttaactatag cgaaatggat tgattgtcta ccgccaggtg tcagtcaccg tcgcggtcgg 1620
gccggccggc gcgccgttta aacttaatta agctagctga ttgatctcta ctgaaccggg 1680
ggggaagaca gaagagaagg gattgatgaa gatgggagaa agaatggagg gagagaaggg 1740
aggagaagag ggagagataa tagggaagga aaagacgggg ccggtgagcg agagaagaga 1800
gagatggtgg actagaggag gggtgcccgg gaaggaaaaa tgttggcggc ggtgattggc 1860
tggatcggcc ctttttggtg ggattcctgc tttgggacgc ttttttctgt cggtcggttc 1920
cccgcgggtt gagagctggc ttgttagttg tgcctccagc tacggagtag ttacaatcac 1980
acttcccatc gcctacataa ttcccattat taatgacttt ttctcccccc cggcactatc 2040
gctgggtatc aaaactcaat tatttgctgg gtgatccacc tttcactgct ttgctactat 2100
tctttgatcg tagatacacc tgctgcctcc gtccgctctt ttcactggtc agccaagggt 2160
ttccgcccag cgatcagcag catttgtcca ctacatcctc aggcaccttc cctccgcgca 2220
tctcaggcat tcatacgccg catgcaataa taattggttg ggaagaccaa aagcaattca 2280
cgcccaagcc acaatcagac acccacacaa cattctgcga agtatctggc aggaccacat 2340
gataccctct cactctgtcc agttgacccc acatcgtcgc ggatccattc tctcctagcg 2400
aggtggattt ggatgctttg tcggtgctga attttctcct cgcaaaaaag cccaatgccc 2460
ttcgcaagaa ctatttccct gactccatcg gaacccataa ggctgaattt tgctctgctc 2520
ggacggaccc agttgccagt tatggagaag ctgtctccct ttttattttt attttatttt 2580
atttttttgt ccagtgggta attaatcata gtaatgagga cgagactctg gccagtagac 2640
agggacccta agtaagtact cggaggtttt ctcttccatt tacgcgtggt atatgccctt 2700
cattaatatg gctagtacta ttatgatccc catatatcct tttccgaggc cagacacgtc 2760
catcattcat ctcataaggc taagttcctg accgtccgga cccctccgcc aatggcatca 2820
gatgtgggac gtcccctttt agtcaatacc gttacacatt tccactcaca ctcaaagtcc 2880
aactcttttc tcgtaagctt tccagccttc ctcccggtac ctctgaaccg cctcgactgg 2940
atcgtccgcc ttatagatgc ccctacccgc aatgataaag tccgcacctc gcccaaccgc 3000
cgacccaggt gtctgatact gctgccccag cttatccccc ttatccgaca gattcacccc 3060
agtcgtaaag acgacaaaat cctcgctctc ctctttctgt tcgggcagca cctcactcaa 3120
cgcccttgta ctcacgaatc ccatcacaaa ccccttatac ttccgcgcgt actcaaccga 3180
gcgtgccgtg tactcccctg tcgcaagaga tcccttactc gtcatctcgg caagaatcag 3240
gagacctcgt tgattcgcgt ctttaaagtc aggagacttg gttgtctgtg cgagggcctc 3300
gacgatccct tcgcccggca ggatggcgca gttgatgatg tgtgcccatt cggagatgcg 3360
gagagcgcca ccgtggtact gcttttgcac ggtgttgccg atgtcgatga acttgcggtc 3420
ctcaaagatg aggaagttgt gctttgtcgc gagggattgg agcgaggaaa gggtcgacgg 3480
ggtgagatcg gtgaggatgt cgatgtgggt tttcagaact gcgatatagg ggcctaggcc 3540
tgtactcact acgcatcagc tatttgttat cctggagggg cattggtgca ggatgtacgg 3600
tcagcaagat cgaggagctc ggcggaagta gtaacgtctg cggagacggt gacgttggtt 3660
ttcttctcct cggcgatgga gaagagttta gatgttaaag ggttgggatg gttggttgcg 3720
cgaattgcgt aggggaggtg ggacttcgaa gacatgatgg cggttctcca atgattgaat 3780
tgggctggat taaactgaca atttgaagct ggaagtggga tggctgtata acgaaaactc 3840
accccgctgc ggtggaattt ttgctccggc ccgataagat aggcgcagac ctatctccac 3900
tatcacgaat ataggtcacg aacccgacta tcattcaaac agaccacatt ttatcaactc 3960
tcccctctgt gctaagatgt cgactacatt tacatcaaat cctttgcaac accaaatgcg 4020
ctcaatcccc aaagacccgc ttgcgcaagc aagtacagcg aaccattgta cctgccggtg 4080
ccgttcggct tgtcgctata aatatagccc agcatgtaga gggtgcggag aacaacccag 4140
gccgctccta agcccgctgc tgcctctggg tacttgacgc ctgccaccag gatagagagc 4200
attgtctgcg gcgcgttctc gaggaagttg cgcggccgca agcttatttt ttgtatactg 4260
ttttgtgata gcacgaagtt tttccacggt atcttgttaa aaatatatat ttgtggcggg 4320
cttacctaca tcaaattaat aagagactaa ttataaacta aacacacaag caagctactt 4380
tagggtaaaa gtttataaat gcttttgacg tataaacgtt gcttgtattt attattacaa 4440
ttaaaggtgg atagaaaacc tagagactag ttagaaacta atctcaggtt tgcgttaaac 4500
taaatcagag cccgagaggt taacagaacc tagaagggga ctagatatcc gggtagggaa 4560
acaaaaaaaa aaaacaagac agccacatat tagggagact agttagaagc tagttccagg 4620
actaggaaaa taaaagacaa tgataccaca gtctagttga caactagata gattctagat 4680
tgaggccaaa gtctctgaga tccaggttag ttgcaactaa tactagttag tatctagtct 4740
cctataactc tgaagctaga ataacttact actattatcc tcaccactgt tcagctgcgc 4800
aaacggagtg attgcaaggt gttcagagac tagttattga ctagtcagtg actagcaata 4860
actaacaagg tattaaccta ccatgtctgc catcaccctg cacttcctcg ggctcagcag 4920
ccttttcctc ctcattttca tgctcatttt ccttgtttaa gactgtgact agtcaaagac 4980
tagtccagaa ccacaaagga gaaatgtctt accactttct tcattgcttg tctcttttgc 5040
attatccatg tctgcaacta gttagagtct agttagtgac tagtccgacg aggacttgct 5100
tgtctccgga ttgttggagg aactctccag ggcctcaaga tccacaacag agccttctag 5160
aagactggtc aataactagt tggtctttgt ctgagtctga cttacgaggt tgcatactcg 5220
ctccctttgc ctcgtcaatc gatgagaaaa agcgccaaaa ctcgcaatat ggctttgaac 5280
cacacggtgc tgagactagt tagaatctag tcccaaacta gcttggatag cttacctttg 5340
ccctttgcgt tgcgacaggt cttgcagggt atggttcctt tctcaccagc tgatttagct 5400
gccttgctac cctcacggcg gatctgcata aagagtggct agaggttata aattagcact 5460
gatcctaggt acggggctga atgtaacttg cctttccttt ctcatcgcgc ggcaagacag 5520
gcttgctcaa attcctacca gtcacagggg tatgcacggc gtacggacca cttgaactag 5580
tcacagatta gttagcaact agtctgcatt gaatggctgt acttacgggc cctcgccatt 5640
gtcctgatca tttccagctt caccctcgtt gctgcaaagt agttagtgac tagtcaagga 5700
ctagttgaaa tgggagaaga aactcacgaa ttctcgacac ccttagtatt gtggtccttg 5760
gacttggtgc tgctatatat tagctaatac actagttaga ctcacagaaa cttacgcagc 5820
tcgcttgcgc ttcttggtag gagtcggggt tgggagaaca gtgccttcaa acaagccttc 5880
ataccatgct acttgactag tcagggacta gtcaccaagt aatctagata ggacttgcct 5940
ttggcctcca tcagttcctt catagtggga ggtccattgt gcaatgtaaa ctccatgccg 6000
tgggagttct tgtccttcaa gtgcttgacc aatatgtttc tgttggcaga gggaacctgt 6060
caactagtta ataactagtc agaaactagt atagcagtag actcactgta cgcttgaggc 6120
atcccttcac tcggcagtag acttcatatg gatggatatc aggcacgcca ttgtcgtcct 6180
gtggactagt cagtaactag gcttaaagct agtcgggtcg gcttactatc ttgaaatccg 6240
gcagcgtaag ctccccgtcc ttaactgcct cgagatagtg acagtactct ggggactttc 6300
ggagatcgtt atcgcgaatg ctcggcatac taatcgttga ctagtcttgg actagtcccg 6360
agcaaaaagg attggaggag gaggaggaag gtgagagtga gacaaagagc gaaataagag 6420
cttcaaaggc tatctctaag cagtatgaag gttaagtatc tagttcttga ctagatttaa 6480
aagagatttc gactagttat gtacctggag tttggatata ggaatgtgtt gtggtaacga 6540
aatgtaaggg ggaggaaaga aaaagtcggt caagaggtaa ctctaagtcg gccattcctt 6600
tttgggaggc gctaaccata aacggcatgg cggcatgg 6638
Claims (10)
1. a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore it is characterised in that:Methods described include with
Lower step:
1)Fusarium moniliforme culture and spore are collected
In solid agar medium surface seeding fusarium moniliforme, cultivate and cover with fusarium moniliforme spore to media surface, wash
The fusarium moniliforme spore of lower media surface, suctions out spore suspension and filters removal mycelia, collect the filtrate containing spore, will
Filtrate is centrifuged, and collects the resting spore of precipitation;
2)Fusarium moniliforme spore pretreatment
With the resuspended spore of electroporation buffer, it is centrifuged and collects spore precipitation, after repeating above-mentioned resuspended and centrifugation step 3-4 time, general
The spore precipitation finally collected is resuspended in electroporation buffer, and obtaining spore concentration is 104-1011The fusarium moniliforme spore of individual/ml
Fullness over the chest during pregnancy liquid;
Described electroporation buffer is by the 4- hydroxyethyl piperazine ethanesulfonic acid of final concentration of 0.01-100mmol/L and final concentration of 0.5-
The Mannitol composition of 5000mmol/L, the pH of electroporation buffer is 3.0-9.5;
3)Using HDEN method electric shock fusarium moniliforme spore
Fusarium moniliforme spore suspension and plasmid to be transformed that in the hole of Tissue Culture Plate, addition above-mentioned steps obtain, mix
Even, obtain spore and plasmid mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then adopt Etta Biotech
X-Porator H1 electroporation carries out HDEN method electric shock, by the electric shock head insertion spore with matrix form electrode and plasmid mixture
Inside, Tissue Culture Plate, so that producing electric field inside spore and plasmid mixture, is placed in ice bath on ice after electric shock by energising again
Then spore and plasmid mixture are suctioned out by 10-15min, obtain importing the fusarium moniliforme spore of the dormancy of foreign DNA;
The ratio of described fusarium moniliforme suspension and plasmid to be transformed is:The fusarium moniliforme spore suspension of 6-600000 μ l:
The plasmid to be transformed of 0.1-10000 μ g;
Described shock parameters are as follows:Voltage 1-6000V, pulsewidth 2-2000000ms, repeats 1-100 time, every minor tick 5-
50000ms.
2. according to claim 1 a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, its feature
It is:Described step 1)Culture medium be PDA culture medium, YPD culture medium or Czapek's medium.
3. according to claim 1 a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, its feature
It is:Described step 1,)The condition of culture of fusarium moniliforme is:Temperature 16-40 DEG C, humidity 15-85%, cultivate 3-15 day.
4. according to claim 3 a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, its feature
It is:Described step 1), the condition of culture of fusarium moniliforme is:24 DEG C of temperature, humidity 50-60%, cultivate 5.
5. according to claim 1 a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, its feature
It is:Described step 2), electroporation buffer is by the 4- hydroxyethyl piperazine ethanesulfonic acid of final concentration of 1mmol/L and final concentration of
The Mannitol composition of 50mmol/L, the pH of electroporation buffer is 7.0.
6. according to claim 1 a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, its feature
It is:Described step 2)Fusarium moniliforme spore suspension before electric shock, in basis of microscopic observation, confirm aseptic in spore suspension
Filament mixes pollution and spore is not all sprouted, and is then shocked by electricity again.
7. according to claim 1 a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, its feature
It is:Described step 3), plasmid to be transformed is recombiant plasmid AnEp8-hygro, and described recombiant plasmid AnEp8-hygro is mould by tide
Plain B resistant gene and AnEp8 plasmid construction form.
8. according to claim 7 a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, its feature
It is:Described step 3), the ratio of fusarium moniliforme suspension and recombiant plasmid AnEp8-hygro is:The fusarium moniliforme of 60 μ l
Spore suspension:The recombiant plasmid AnEp8-hygro of 1 μ g.
9. according to claim 1 a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, its feature
It is:Described step 3), shock parameters are as follows:Voltage 300V, pulsewidth 1500ms, it is repeated 3 times, every minor tick 500ms.
10. according to claim 1 a kind of directly by the method for Exogenous DNA transfered fusarium moniliforme resting spore, it is special
Levy and be:Described step 3), also include processing as follows:Spore and plasmid mixture are suctioned out, is coated on containing final concentration of 200
On the YPD solid agar medium flat board of the HYG of μ g/ml, cultivate at temperature 16-40 DEG C, humidity 15-85%, until shape
Become single bacterium colony, and carry out colony counting.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610813520.3A CN106381307A (en) | 2016-09-09 | 2016-09-09 | Method for directly importing foreign DNA into fusarium moniliforme resting spores |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610813520.3A CN106381307A (en) | 2016-09-09 | 2016-09-09 | Method for directly importing foreign DNA into fusarium moniliforme resting spores |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106381307A true CN106381307A (en) | 2017-02-08 |
Family
ID=57935796
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610813520.3A Pending CN106381307A (en) | 2016-09-09 | 2016-09-09 | Method for directly importing foreign DNA into fusarium moniliforme resting spores |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106381307A (en) |
-
2016
- 2016-09-09 CN CN201610813520.3A patent/CN106381307A/en active Pending
Non-Patent Citations (3)
Title |
---|
GUO LIQIONG 等: "Highly efficient transformation of intact yeast-like co-nidium cells of Tremella fuciformis by electroporation", 《SCIENCE IN CHINA SERIES C: LIFE SCIENCES》 * |
WU,M.X.等: "High-density distributed electrode network, a multi-functional electroporation method for delivery of molecules of different sizes", 《SCIENTIFIC REPORTS》 * |
潘波: "水稻品种抗稻曲病鉴定和病菌酰胺酶基因的克隆及原核表达", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
De Groot et al. | Agrobacterium tumefaciens-mediated transformation of filamentous fungi | |
CN103865948B (en) | A kind of method of fusarium oxysporum sesame protoplastis genetic transformation of PEG mediation | |
CN106086058A (en) | A kind of method reducing Cordyceps militaris (L.) Link. fruiting time and raising fruiting yield | |
CN106148389A (en) | A kind of direct conversion foreign DNA enters the method that Buddhist nun's fine jade penicillium sp does not sprouts spore | |
CN112195186B (en) | Application of SlBBX20 gene in regulation and control of tomato gray mold resistance | |
CN112251419A (en) | Method for generating new mutation in organism and application | |
CN111534525A (en) | Fusarium graminearum FgARL1 gene and application thereof | |
CN106496313B (en) | Disease-resistance-related protein IbSWEET10 and its encoding gene and application | |
CN106148387A (en) | The method directly penicillium expansum resting spore being converted external source DNA (deoxyribonucleic acid) | |
CN106244620A (en) | It is independent of medium and directly converts the method that foreign DNA enters aspergillus niger resting spore | |
CN106244616A (en) | A kind of method making foreign DNA penetration cell barrier inlet point penicillium sp resting spore | |
CN106191098A (en) | Foreign DNA is allowed to pass through the method that volume branch Mucor does not sprouts spore cell wall and cell membrane | |
CN106148386A (en) | A kind of non-Medium Dependent directly method to aspergillus oryzae resting spore conversion foreign DNA | |
CN109627303B (en) | Gene of pseudo-ginseng disease course related protein PnPR3 and application thereof | |
CN106381307A (en) | Method for directly importing foreign DNA into fusarium moniliforme resting spores | |
CN106381306A (en) | Method for delivering exogenous DNA (deoxyribonucleic acid) into Aspergillus fumigatus ungerminated spores | |
CN106244617A (en) | A kind of foreign DNA that delivers enters the method that Mucor racemosus Fres does not sprouts spore | |
CN106244618A (en) | A kind of method converting external source DNA (deoxyribonucleic acid) entrance Rhizopus stolonifer resting spore | |
CN106148384A (en) | Non-Medium Dependent directly converts the method that foreign DNA enters aspergillus nidulans resting spore | |
CN106191097A (en) | Directly deliver external source DNA (deoxyribonucleic acid) to the method within monascus resting spore | |
CN106244619A (en) | It is independent of medium and directly converts the method that foreign DNA enters Rhizopus oryzae resting spore | |
CN106148383A (en) | It is independent of medium and directly converts the method that foreign DNA enters trichoderma reesei resting spore | |
CN106148388A (en) | A kind of method that geotrichum candidum resting spore is converted foreign DNA | |
CN106148382A (en) | The method being introduced directly into external source DNA (deoxyribonucleic acid) in Magnaporthe grisea resting spore | |
CN106148385A (en) | A kind of method to aspergillus flavus resting spore conversion foreign DNA |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170208 |
|
RJ01 | Rejection of invention patent application after publication |