CN106148388A - A kind of method that geotrichum candidum resting spore is converted foreign DNA - Google Patents
A kind of method that geotrichum candidum resting spore is converted foreign DNA Download PDFInfo
- Publication number
- CN106148388A CN106148388A CN201610812882.0A CN201610812882A CN106148388A CN 106148388 A CN106148388 A CN 106148388A CN 201610812882 A CN201610812882 A CN 201610812882A CN 106148388 A CN106148388 A CN 106148388A
- Authority
- CN
- China
- Prior art keywords
- spore
- geotrichum candidum
- plasmid
- foreign dna
- resting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
Abstract
The invention discloses a kind of method that geotrichum candidum resting spore is converted foreign DNA, cultivate including geotrichum candidum and spore collection, geotrichum candidum spore pretreatment and use HDEN method electric shock three steps of geotrichum candidum spore, obtain importing the geotrichum candidum spore of plasmid to be transformed.The present invention is used as importing the parent material of exogenous molecules with the spore do not sprouted, and apply HDEN electricity transformation technology by Exogenous DNA transfered geotrichum candidum resting spore, the step doing this complexity of spore germination can be saved, save the step etc. preparing protoplast or Agrobacterium-mediated Transformation in traditional method, and conversion ratio is high, each conversion reaction system, at least can reach the effect no less than 6000 positive transformants.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of method that geotrichum candidum resting spore is converted foreign DNA.
Background technology
Geotrichum candidum is a kind of common mycete, can glucose fermentation, mannose, fructose;The weak ferment galactose of some energy;Also
Have can assimilate alcohols: glycerol, ethanol, sorbitol, mannitol;And decompose pectin, oils and fats, produce feed yeast and nucleotide
Etc. a series of, there is the product that Important Economic is worth, be a kind of important industrial fermentation strain.But at present geotrichum candidum is converted
Foreign DNA is extremely difficult, constrains it genetic engineering modified.
Genetic engineering is with molecular genetics as theoretical basis, with the modernism of molecular biology as means, by difference
Source gene by the blueprint being pre-designed, constructed dna molecule in vitro, be then introduced into cell, to change biological original something lost
Pass characteristic, it is thus achieved that new varieties, produce new product and (such as certain is had the enzyme gene that Important Economic is worth, imports to geotrichum candidum
Intracellular, do pheron high expressed, produce this enzyme).In this field, it is important that a link, it is simply that external DNA,
Import to cell interior.For different plant species and the cell of different conditions, need different introduction methods, just can allow external
DNA strides across cell wall and cell membrane, is transported to cell interior.
The main DNA method for transformation being currently used for filamentous fungi field (including geotrichum candidum) includes:
1. protoplast mediated transformation (protoplast-mediated transformation): the method uses various enzyme water
Solving the cell wall of fungal mycelium, expose cell membrane, under certain electrochemical conditions, cell membrane can absorb foreign DNA.But
It is the structure due to fungal cell wall and complicated component, and the cell wall of the different subspecies of different plant species, the most same species
Structure and composition are the most different, therefore, it is impossible to method prepared by unified protoplast, and, a lot of funguses, the most in vain
Mould, protoplast is prepared extremely difficult, and step is the most loaded down with trivial details, and needs special, expensive cytohydrolist.
2. agrobacterium tumefaciens mediated transformation method (Agrobacterium tumefaciens-mediated
Transformation): agrobacterium tumefaciens (Agrobacterium tumefaciens) is a kind of gram negative bacteria, it is possible to
Infect plant callus and filamentous fungi, in cell, will can be inserted into the base of host by the cyclic plasmid Ti-DNA of stable heredity
Because of in group.But the method step is troublesome, the longest, and Agrobacterium is selective to host, and not all fungus is the suitableeest
Close in this way.Additionally, the position that foreign DNA inserts host genome is random, it is impossible to anticipation.Foreign DNA can only be inserted
Enter host genome, it is impossible to enough survive in the Cytoplasm of host freely.
3. DNA is adsorbed at specialty metal by Gene Knock-out Mice (Biolistic Transformation): the method
The surface of grain, accelerates with gunpowder explosion or gases at high pressure, the metallic particles having adsorbed DNA is sent directly into complete tissue or
Person's cell.This method needs much more expensive special experimental facilities, and metallic particles consumptive material used usually needs to use
Gold material.Additionally, the method transformation efficiency is the highest, and host cell mortality rate under metallic particles bombards is high, regeneration
More difficult, therefore its range is restricted.
4, electroporated (Electroporation): this is that of short duration the acting on of a kind of electric pulse contacts foreign DNA
Cell, makes foreign DNA enter cell, so that the method that cell trait changes.Agrobacterium is needed with agrobacterium co-cultivation
Needing metallic particles different as medium as medium, particle bombardment, this method need not medium to carry foreign DNA.Pass
The electric shocking method of system, shocks by electricity including Exponential Decay Wave electric shock and square wave.The energy of Exponential Decay Wave electric shock is big especially, the damage to cell
Wound is the biggest, and microbial cell is due to simple in construction, has cell wall, cell strong stress resistance, and vitality is strong, and a lot of micro-life
The shell of thing cell is hard, it is possible to tolerating big energy shocks, therefore Exponential Decay Wave electric shock is typically only used for microbial cell.And
Mammalian cell (such as Human cell line), for relative microbes, the most fragile, easily dead, therefore, square wave electric shock is often
For mammalian cell.Additionally, the live body electricity that square wave electric shock is also widely used for toy (such as mice) converts.
HDEN electricity transformation technology (the high-density distributed electrode that 2013 emerge
Network), be a kind of characteristic being specifically designed for mammalian cell, and open electricity transformation technology, its exploitation purpose be in order to
Improve in mammalian cell, transmit foreign DNA and the efficiency of medicine.This technology comprises 3 most contents, and one is applied to
The electric wave form of cell sample, two is the cell sample solution environmental when electric shock, and three is cultural method and the electricity of cell sample
Hit front preprocess method.Owing to this technology is specific to mammalian cell exploitation, therefore, above-mentioned 3 most contents, all
It is to design for the characteristic of mammalian cell.
In this field it is known that the characteristic of microbial cell and cultural method, compared with mammalian cell, thousand is poor
Ten thousand is other.Mammalian cell is different with the structure of microbial cell, and mammalian cell does not has cell wall, microbial cell (ratio
Such as majority of fungal, include geotrichum candidum) there is cell wall.The cell membrane of mammalian cell and the cell membrane of microorganism also differ
Sample.
Therefore, any technology being applied to mammalian cell, all it is difficult to directly apply to microbial cell.Existing document
Report HDEN technology at HEK-293A, Hela, Neuro-2A, MCF-7, C2C12,3T3-L1, CHO, MDCK, HL-60,
Application in the mammalian cells such as HUVEC, A375, U251.Not yet there is this technology thing beyond mammalian cell at present
The Case Report of application in kind.Therefore, HDEN electricity transformation technology can be applied to the species beyond mammalian cell, is also
One unknown number.
Filamentous fungi (including geotrichum candidum) is a class eukaryotic microorganisms, and the genome of the most eurypalynous fungus is polyploid.
When doing genetic engineering modified to living individual, the most difficult is exactly in the face of polyploid phenomenon.Since the transformation to polyploid, usually
Inefficiency (such as gene targeting may only hit item chromosome, and additionally one or several homologous chromosome that misses the target), and
And polyploid is when schizogamy, homologous chromosome separates, it is also difficult to transformation site is entailed all filial generations.This is in this area
Interior well-known.
Fungal spore is the main organ of multiplication of fungus, and spore is resting state and can survive for a long time.Spore exists
Under suitable external condition, it is possible to revive and sprout, form mycelia and carry out schizogamy.Most importantly, a lot of types
The spore of fungus, is natural monoploid, directly carries out genetic engineering modified to haplospore, and efficiency far is many higher than operation
Times body.
But, owing to spore is typically in resting state, its cell wall is the most abundant, the cell wall of resting spore, cell
The state of film, is different from sprouting spore and mycelium.And the intracellular vital movement of resting spore is also at the most vigorous
State, therefore, it is known in the art that the cell permeability of resting spore not as sprouting spore and mycelia, resting spore is hardly
Material is exchanged with the external world, of seclusion, it is typically in sleep state.And sprout spore or mycelium, need to absorb respectively from the external world
Planting nutrient molecule supply vital movement, therefore cell wall and membrane passage are more than resting spore.So, it is very difficult to will
Exogenous DNA molecule is importing directly into the inside of sleep spore.
In existing several big mature technology: protoplast transformation, as the source of the protoplast of host cell, typically
It it is the mycelium (polyploid) of fungus.Agrobacterium_mediated method, under agriculture bacillus mediated, is consolidating Agrobacterium and fungal spore
Body media surface co-cultures a couple of days, can be Exogenous DNA transfered fungal cell.But this way is not directly to spore
Converting, because during co-culturing, fungal spore can be sprouted, and then Agrobacterium invasion and attack sprout spore, outside could importing
Source DNA.And agrobacterium co-cultivation, need Agrobacterium as the medium of mediation, need first to do an Agrobacterium-mediated Transformation, just can do follow-up
Fungal transformation, therefore operate extremely complex and loaded down with trivial details, and the cycle be long.
Traditional electroporated method (using Exponential Decay Wave to shock by electricity), host cell uses the allergenic of sprouting
Son.The electric-shocking method for fungal spore that such as Ozeki etc. found, it is necessary to allow after spore germination, could electroporated (be somebody's turn to do
Method discloses and allows the specific experiment step of spore germination and details).The method is classical technology pioneering in industry, is at present
Only without significantly improving, used till today by those skilled in the art always.Present inventor also attempted converting by the method not sprouting
Spore, success, at present, does not has any successful document to report yet.The method that Ozeki etc. found is shown in document 1:OZEKI K,
KYOYA F, HIZUME K, KANDA A, HAMACHI M, NUNOKAWA Y. Transformation of intact
Aspergillus niger by electroporation [J]. Biosci Biotechnol Biochem, 1994, 58
(12): 2224-2227.
At present, not yet have any method, any report, can accomplish directly exogenous DNA molecule in situation about mediating without medium
Under, import inside (sprouting) fungal spore of dormancy.This is also the technical barrier never captured in the industry.
Summary of the invention
It is an object of the invention to overcome the deficiencies in the prior art, it is provided that a kind of to geotrichum candidum resting spore conversion external source
The method of DNA, the step for that the method walking around fungus spore germination, uses HDEN electricity transformation technology, directly with the spore of dormancy,
Import foreign DNA.
For achieving the above object, the present invention adopts the following technical scheme that
A kind of method that geotrichum candidum resting spore is converted foreign DNA, comprises the following steps:
1) geotrichum candidum is cultivated and spore is collected
At solid agar medium surface seeding geotrichum candidum, cultivate and cover with geotrichum candidum spore to media surface, wash lower culture medium
The geotrichum candidum spore on surface, sucking-off spore suspension also filters removal mycelia, collects the filtrate containing spore, filtrate be centrifuged, receive
The resting spore of collection precipitation;
2) geotrichum candidum spore pretreatment
With the resuspended spore of electroporation buffer, centrifugal and collect spore precipitation, after repeating above-mentioned resuspended and centrifugation step 3-4 time, general
The spore precipitation finally collected is resuspended in electroporation buffer, and obtaining spore concentration is 104—1011The geotrichum candidum spore of individual/ml
Suspension;
Described electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid (HEPES) of final concentration of 0.01-100mmol/L and final concentration
Mannitol for 0.5-5000mmol/L forms, and the pH of electroporation buffer is 3.0-9.5;
3) HDEN method electric shock geotrichum candidum spore is used
In the hole of Tissue Culture Plate, add geotrichum candidum spore suspension and plasmid to be transformed that above-mentioned steps obtains, mixing, obtain
To spore and plasmid mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then uses Etta Biotech X-
Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and plasmid mixture by the electric shock head with matrix form electrode
Portion, energising so that spore is internal with plasmid mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath more on ice
10-15min, then by spore and plasmid mixture sucking-off, obtains importing the geotrichum candidum spore of the dormancy of foreign DNA;
Described geotrichum candidum suspension with the ratio of plasmid to be transformed is: the geotrichum candidum spore suspension of 6-600000 μ l: 0.1-10000 μ g
Plasmid to be transformed;
Described shock parameters is as follows: voltage 1 6000V, pulsewidth 2-2000000ms, repeats 1-100 time, every minor tick 5-
50000ms。
Further, the culture medium of described step 1) is PDA culture medium, YPD culture medium or Czapek's medium, preferably PDA
The effect of culture medium is best, produces spore the fastest at most.
Described step 1) condition of culture of geotrichum candidum is: temperature 16-40 DEG C, humidity 15-85%, cultivates 3-15 day.
Preferably, described step 1), the condition of culture of geotrichum candidum is: temperature 28 DEG C, humidity 50-60%, cultivates 7.
Further, described step 2), electroporation buffer is by the HEPES and final concentration of 50-of final concentration of 1-10mmol/L
The mannitol composition of 100mmol/L, the pH of electroporation buffer is 5.0-7.0;
Preferably, described step 2), electroporation buffer is by the HEPES and final concentration of 50mmol/L of final concentration of 1mmol/L
Mannitol forms, and the pH of electroporation buffer is 7.0.
Described step 2) geotrichum candidum spore suspension before electric shock, in basis of microscopic observation, confirm in spore suspension aseptic
Filament mixes pollution and spore is not all sprouted, and shocks by electricity the most again.
Further, described step 3), plasmid to be transformed is recombiant plasmid AnEp8-hygro, described recombiant plasmid AnEp8-
Hygro is formed by hygromycin B resistant gene and AnEp8 plasmid construction, and described electric shock uses Etta Biotech X-Porator
H1 electroporation.
Preferably, geotrichum candidum suspension with the ratio of recombiant plasmid AnEp8-hygro is: the geotrichum candidum spore suspension of 60 μ l: 1
The recombiant plasmid AnEp8-hygro of μ g.
Further, described step 3), voltage 300-3000V, pulsewidth 200-1000000ms, repeats 1-50 time, every minor tick
500-5000ms;It is preferably: voltage 520V, pulsewidth 2000ms, is repeated 4 times, every minor tick 300ms.
Further, in order to verify that foreign DNA has imported geotrichum candidum resting spore, described step 3), after electric shock, again ice bath
Also comprise the steps: spore and plasmid mixture sucking-off, be coated on HYG containing final concentration of 700 μ g/ml
On YPD solid agar medium flat board, at temperature 16-40 DEG C, humidity 15-85%, cultivate (preferably temperature 28 DEG C, humidity 50-
Cultivate for 60% time), until forming single bacterium colony, and carry out colony counting.
(hygromycin B, CAS number described HYG: 31282-04-9) dissolve with sterilizing high purity water, prepare highly concentrated
Degree mother solution, before using, adds in culture medium according to concentration ratio.
While carrying out above-mentioned experimental procedure, need to prepare matched group: by that do not shock by electricity, identical " spore and plasmid
Mixture ", it is coated on the YPD solid agar medium flat board of other one piece of HYG containing 700 μ g/ml, the same terms
Lower cultivation.When this matched group is formed without single bacterium colony, can determine whether that single bacterium colony of experimental group is positive colony.
After experimental group forms single bacterium colony, extract the DNA of experimental group list bacterium colony, use pcr amplified DNA may contain
External source hygromycin B resistant gene, amplified production uses agarose gel electrophoresis to judge stripe size, when stripe size meets expection
After, use Sanger DNA sequencing method, determine whether its DNA sequence coincide with external source hygromycin B resistant gene.If coincide,
Then can accurately judge that positive colony is successful transformant.
Geotrichum candidum of the present invention is geotrichum candidum CICC 32222, and described electric shock uses Etta Biotech X-Porator
H1 electroporation, buys and reaches biotech firm from Suzhou one.
The present invention collects the spore do not sprouted, and follow-up electricity turns experimentation, if without specified otherwise, experimental implementation is equal
Operating in the constant temperature laboratory of not higher than 23 degrees Celsius, centrifugation step is 4 DEG C of frozen centrifugations, and each of spore is not sprouted in contact
Plant liquid all in advance in pre-cooling on ice.Do not sprout spore and forbid to touch any containing promoting its factor sprouted and material
(the such as germination medium with YEPD etc. as representative), to ensure the resting state of spore.
Geotrichum candidum incubation of the present invention, after geotrichum candidum surface covers with spore (can be judged) by color and form,
Pouring sterilized water into media surface, wash the geotrichum candidum spore of lower media surface, with pipettor sucking-off spore suspension, use is gone out
The lens paper (or sand core funnel, filter paper etc.) that bacterium crosses filters, and removes mycelia, retains spore, without filtration step, then
Spore suspension can be contaminated with mycelia, the transformant that subsequent step obtains, it is impossible to judge it is to be formed by after spore transforming DNA actually
Positive colony, or after mycelia transforming DNA formed false positive.It is dyeed by spore chromosome dyeing the to be used method obtained
Body dyes, and observation and the chromosome confirmed in spore are haploid states.
The present invention prepares the molecular biology high purity water or double steaming that the water of solid agar medium should be MillQ rank
Water, resistivity of water is not less than 18.2M Ω-cm.
When using HDEN method electric shock geotrichum candidum spore, the hole of Tissue Culture Plate adds the geotrichum candidum spore of proper proportion
Suspension and plasmid to be transformed, mix even, is placed in by container and carries out ice bath on ice.Such as in the hole of 96 porocyte culture plates
(the Nunclon Surface 96 porocyte culture plate of NUNC company, article No. Cat.No.167008), adds the geotrichum candidum of 60 μ l
Spore suspension, and 1 μ g recombiant plasmid AnEp8-hygro.Described Tissue Culture Plate can also be 384 orifice plates, 24 orifice plates, 6 orifice plates,
Or other more greatly, less container, then according to container volume size, zoom in or out spore and plasmid mixture body
System.
The present invention uses above technical scheme, is used as importing the parent material of exogenous molecules with the spore do not sprouted, non-
It is often easy, because the step doing this complexity of spore germination can be saved, it is often more important that, the spore of sprouting, may multiparity
Give birth to polyploid, and the spore do not sprouted, it is ensured that it is monoploid, a lot of engineered application, it is desirable to host cell must
Must be monoploid, can be only achieved result or the efficiency of anticipation.Meanwhile, present invention application HDEN electricity transformation technology is by foreign DNA
Import geotrichum candidum resting spore.HDEN electricity transformation technology have employed high-density matrix formula electrode, and it can produce high uniformity and strong
Spending enough electric fields, the condition that in electric field, each cell accepts to shock by electricity is the most completely the same, during operation, as long as cell being placed on logical
With in container, such as Tissue Culture Plate, then the electric shock head with matrix form electrode is inserted in container, it is energized.And it is traditional
Electricity turn technology and usually use special electric shock cup, between two pieces of metallic plates being placed in parallel, place cell, and to metallic plate
Power up, form electric field electric shock.Therefore, the discharge mode of the two is entirely different, and the former electrode inserts inside cell suspension, including
Portion produces electric field, and the latter is to produce electric field in the outside that cell suspension is overall;The former electrode tip is made up of many metal needles,
Between pin and pin, produce voltage, and the latter only has two pieces of metallic plates, one piece of positive pole, one piece of negative pole, produces electricity between
Pressure.HDEN technology also essentially eliminates the cathode effect of tradition electric shock technology, it is to avoid produce a large amount of hydroxide ion, it is to avoid kill
Cell, improves the cell survival rate after electric shock.And tradition electric shock technology is difficult to eliminate cathode effect.It addition, traditional electric shock side
Method the most only shocks by electricity 1 time, if because tradition electric-shocking method shocks by electricity repeatedly, then cell mortality can be greatly increased, and this
Bright HDEN method can shock by electricity repeatedly, the effect that repeatedly can shock by electricity with superposition, and cell mortality will not be dramatically increased.
HDEN electricity transformation technology is a kind of characteristic being specifically designed for mammalian cell and opens electricity transformation technology, and it is opened
Sending out purpose is to transmit foreign DNA and the efficiency of medicine in mammalian cell to improve.And in this field it is known that
The characteristic of microbial cell and cultural method, compared with mammalian cell, vary.Mammalian cell and microorganism are thin
The structure of born of the same parents is different, and mammalian cell does not has a cell wall, and microbial cell (such as majority of fungal, include geotrichum candidum) has
Cell wall.The cell membrane of mammalian cell and the cell membrane of microorganism are the most different.Even if same is biological, its difference
Tissue, Different Organs or different cell types, respective cell membrane, the structure of cell wall, state, chemical composition, the most not
Equally.Even the same tissue of same biology, same organ, same cell type, at different growth promoter
Stage, or in different external environments, respective cell membrane, the structure of cell wall, state, chemical composition, the most all differ
Sample.And cell wall and cell membrane, it is to stop the barrier that exogenous molecules enters cell, barrier is different, and (structure is different, and chemical composition is not
With), the method determining breakthrough barrier is also different.Additionally, different exogenous molecules because have different structure, point
Son amount, volume and chemical composition, when identical barrier, the method that different exogenous molecules break through barrier is also different.
If in the face of different barriers, then different exogenous molecules break through method and the mechanism of different barrier, vary especially.
Therefore, any technology being applied to mammalian cell, all it is difficult to directly apply to microbial cell.The most not yet
There is the Case Report of application in HDEN technology species beyond mammalian cell.The present invention is directed to the spy of geotrichum candidum cell
Property, use HDEN technology by Exogenous DNA transfered geotrichum candidum resting spore, the method determines cultural method and the electricity of cell sample
Hit front preprocess method, the cell sample solution environmental when electric shock, and put on the electric wave form of cell sample.Use this
Inventive method is the easiest quickly, directly uses wild spore as raw material, it is not necessary to spore carries out competence preparation process,
Without removing archespore wall by various loaded down with trivial details methods (such as enzyme hydrolysis method), if wild spore wash clean more resuspended
In electroporation buffer, step is the easiest.Protoplasm body in traditional method, needs special cytohydrolist, needs
Want complicated preparation and the step of regeneration protoplast;Traditional electric shocking method, needs first spore germination to be processed, after it is sprouted
Just can be electroporated, and conversion ratio is low;Traditional agrobacterium co-cultivation, needs first to do Agrobacterium-mediated Transformation, just can do follow-up white
The mould conversion in ground;Traditional particle bombardment, needs expensive consumptive material, and conversion ratio is low.
The inventive method conversion ratio is high, and each conversion reaction system at least can reach no less than 6000 positive transformants
The effect of son, the AnEp8-hygro plasmid volume of such as embodiment 1 is 12.4 kb, with 1 μ g plasmid (about 124.26 fmol
Individual plasmid molecule), electric shock 6 × 106The resting spore that individual geotrichum candidum is not sprouted, can produce no less than 8000 positive transformants.
It is known that the volume of plasmid and conversion ratio are inversely proportional to, the plasmid that volume is the biggest, be less susceptible to through cell wall and
Cell membrane, the plasmid of the 12.4kb used by the present invention belongs to ultra-large type plasmid, and the geotrichum candidum of existing document report converts (protoplasm
Body convert, electricity convert) plasmid volume major part all at below 8kb.
There is the multiple description method about conversion ratio height this area at present, including: how many μ g plasmids can produce how many
Positive transformant;How many plasmids (molal quantity, DNA molecular number) can produce how many positive transformants;How many hosts are thin
Born of the same parents can produce how many positive transformants, etc..This patent discloses host cell number, the quality of plasmid, the molecule of plasmid
Number, the various index of molecular weight of plasmid etc., in any case evaluate, evaluate the conversion ratio of a transformation system by what mode
Just, these indexs that this patent can be used to disclose calculate and convert.
Accompanying drawing explanation
Fig. 1 is that embodiment 1 uses the agarose gel electricity whether containing hygromycin gene in PCR amplification verification sample
Swimming figure.
Detailed description of the invention
Below example is easy to be better understood from the present invention, but does not limit the present invention.
The all operations of experimentation is intended to follow sterile working's principle of Experiment on Microbiology, and vessel, consumptive material, reagent are intended to sterilizing
Process.
Embodiment 1
A kind of method that geotrichum candidum resting spore is converted foreign DNA, comprises the following steps:
1) geotrichum candidum is cultivated and spore is collected
In 15cm culture dish, prepare solid agar medium (PDA culture medium), at solid agar medium surface seeding in vain
Mould CICC 32222, temperature 28 DEG C, humidity 50-60%, cultivate 7, allow media surface cover with geotrichum candidum spore.
Sterilized water is poured into media surface, wash down (concussion, or scratch gently with smooth sterile glass spreading rod)
The geotrichum candidum spore of media surface, with pipettor sucking-off spore suspension, use sterilizing lens paper (or sand core funnel,
Filter paper etc.) filter, to remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after being centrifuged, collects the resting spore of precipitation,
Remove supernatant fluid.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and observes and in confirmation spore
Chromosome is haploid state.
2) geotrichum candidum spore pretreatment
Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then be centrifuged, receive
Collection spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer, micro-
Sem observation, confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last that spore is resuspended
When electroporation buffer, should control the volume of electroporation buffer well, keeping geotrichum candidum spore suspension miospore concentration is 108Individual/
ml。
Described electroporation buffer is made up of the mannitol of the HEPES and final concentration of 50mmol/L of final concentration of 1mmol/L,
The pH of electroporation buffer is 7.0.
3) HDEN method electric shock geotrichum candidum spore is used
The geotrichum candidum spore suspension of 60 μ l, and 1 μ g recombiant plasmid AnEp8-hygro is added in the hole of 96 porocyte culture plates,
Mixing, obtains spore and plasmid mixture, container is placed in ice bath 10min on ice, then uses Etta Biotech X-
Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and plasmid mixture by the electric shock head with matrix form electrode
Portion, energising so that spore is internal with plasmid mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath more on ice
10min, then by spore and plasmid mixture sucking-off, obtains importing the geotrichum candidum spore of the dormancy of foreign DNA;
The present embodiment shock parameters is as follows: voltage 520V, pulsewidth 2000ms, is repeated 4 times, every minor tick 300ms.
4) confirmatory experiment
By spore and the plasmid mixture of above-mentioned sucking-off, it is coated on the YPD solid of HYG containing final concentration of 700 μ g/ml
On agar culture medium flat board, in temperature 28 DEG C, cultivating under humidity 50-60%, until forming single bacterium colony, and carrying out colony counting, meter
Calculate conversion ratio.
While carrying out above-mentioned experimental procedure, need to prepare matched group: by that do not shock by electricity, identical " spore and plasmid
Mixture ", it is coated on the YPD solid agar medium flat board of other one piece of HYG containing 700 μ g/ml, the same terms
Lower cultivation.When matched group is formed without single bacterium colony, therefore single bacterium colony of judgment experiment group is positive colony.
After experimental group forms single bacterium colony, extract the DNA of experimental group list bacterium colony, use pcr amplified DNA may contain
External source hygromycin B resistant gene, amplified production use agarose gel electrophoresis judge stripe size, electrophoresis result as it is shown in figure 1,
Electrophoresis swimming direction is from bottom to top, and Marker is takara 250bp DNA ladder marker, and swimming lane 1 is negative right
According to, swimming lane 2 at band clearly seen from about 1kb, this band is consistent with hygromycin B resistant gene band, illustrates to convert successfully,
I.e. swimming lane 2 is the hygromycin B resistant gene band being amplified.Then using Sanger DNA sequencing method, result shows its DNA sequence
Row coincide with external source hygromycin B resistant gene, therefore can accurately judge that the positive colony of the present embodiment is successful transformant.
The present embodiment AnEp8-hygro plasmid volume is 12.4 kb, with 1 μ g plasmid (about 124.26 fmol plasmids
Molecule), electric shock 6 × 106The resting spore that individual geotrichum candidum is not sprouted, creates no less than 8000 positive transformants.
The recombiant plasmid AnEp8-hygro of the present embodiment is formed by hygromycin B resistant gene and AnEp8 plasmid construction.Weight
The construction method of group plasmid AnEp8-hygro is as follows:
Hygromycin B resistant gene is as shown in SEQ ID NO.1.
Coded protein sequence is as shown in SEQ ID NO.2.
Using following primer, PCR expands above-mentioned hygromycin B resistant gene:
F:CATTAGCTAGCATGAAAAAGCCTGAACTCACCG
R:TCTGGCGCGCCCTATTCCTTTGCCCTCGG
PCR system (50 μ L): template 3 μ L, primers F (10 μMs) 2 μ L, primer R(10 μM) 2 μ L, 2X Taq PCR mix 25 μ L,
ddH2O mends to 50 μ L.
PCR program: 94 DEG C of 10min, (94 DEG C of 30s, 61.8 DEG C of 30s, 72 DEG C of 90s) X 35 circulation, 72 DEG C of 10min
PCR primer is carried out agarose gel electrophoresis detection, detect errorless after, use Thermo GeneJET Gel
Extraction and DNA Cleanup Micro Kit reclaims PCR primer.
AnEp8 plasmid is given by U.S.'s FGSC Culture Collection, and the disclosure of AnEp8 plasmid is shown in document 2:STORMS R,
ZHENG Y, LI H, SILLAOTS S, MARTINEZ-PEREZ A, TSANG A. Plasmid vectors for
protein production, gene expression and molecular manipulations in
Aspergillus niger [J]. Plasmid, 2005, 53(3): 191-204.
Use the AnEp8 plasmid in document 2.AnEp8 plasmid sequence is as shown in SEQ ID NO.3.AnEp8 plasmid uses Shanghai raw
Work plasmid extraction kit extracts, and AnEp8 plasmid and hygromycin B resistant gene PCR primer after purification are all used Fermentas
Company Fastdigest series of restriction restriction endonuclease Nhe 1 and Asc 1 enzymes double zyme cutting, after agarose gel electrophoresis reclaims
(using Thermo GeneJET Gel Extraction and DNA Cleanup Micro Kit to reclaim), with T4 DNA even
Connecing enzyme (Fermentas Products), hygromycin B gene and AnEp8 plasmid are connected, above-mentioned enzyme action and attended operation are the strictest
Carry out according to shop instruction.Convert escherichia coli, construction recombination plasmid Anep8-hygro the most again.Recombiant plasmid Anep8-
Hygro Sanger sequencing sequence verification and double digestion checking errorless after, mass propgation escherichia coli, public with Qiagen
The plasmid extraction kit (EndoFree Plasmid Maxi Kit) of department extracts recombiant plasmid and (grasps according to shop instruction
Make).
Embodiment 2
A kind of method that geotrichum candidum resting spore is converted foreign DNA, comprises the following steps:
1) geotrichum candidum is cultivated and spore is collected
In 15cm culture dish, prepare solid agar medium (YPD culture medium), at solid agar medium surface seeding in vain
Mould CICC 32222, temperature 16 DEG C, under humidity 15-50%, cultivates 15, allows media surface cover with geotrichum candidum spore.
Sterilized water is poured into media surface, wash down (concussion, or scratch gently with smooth sterile glass spreading rod)
The geotrichum candidum spore of media surface, with pipettor sucking-off spore suspension, use sterilizing lens paper (or sand core funnel,
Filter paper etc.) filter, to remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after being centrifuged, collects the resting spore of precipitation,
Remove supernatant fluid.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and observes and in confirmation spore
Chromosome is haploid state.
2) geotrichum candidum spore pretreatment
Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then be centrifuged, receive
Collection spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer, micro-
Sem observation, confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last that spore is resuspended
When electroporation buffer, should control the volume of electroporation buffer well, keeping geotrichum candidum spore suspension miospore concentration is 1011Individual/
ml。
Described electroporation buffer is by the HEPES of final concentration of 0.01mmol/L and the mannitol of final concentration of 0.5mmol/L
Composition, the pH of electroporation buffer is 3.0.
3) HDEN method electric shock geotrichum candidum spore is used
The geotrichum candidum spore suspension of 6 μ l, and 0.1 μ g recombiant plasmid AnEp8-hygro is added in the hole of 96 porocyte culture plates,
Mixing, obtains spore and plasmid mixture, container is placed in ice bath 15min on ice, then uses Etta Biotech X-
Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and plasmid mixture by the electric shock head with matrix form electrode
Portion, energising so that spore is internal with plasmid mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath more on ice
15min, then by spore and plasmid mixture sucking-off, obtains importing the geotrichum candidum spore of the dormancy of foreign DNA;
The present embodiment shock parameters is as follows: voltage 1V, pulsewidth 2000000ms, repeats 100 times, every minor tick 5ms.
4) confirmatory experiment
By spore and the plasmid mixture of above-mentioned sucking-off, it is coated on the YPD solid of HYG containing final concentration of 700 μ g/ml
On agar culture medium flat board, in temperature 16 DEG C, cultivating under humidity 15-50%, until forming single bacterium colony, and carrying out colony counting, meter
Calculate conversion ratio.
Same, while carrying out above-mentioned experimental procedure, need to prepare matched group (with embodiment 1).
After experimental group forms single bacterium colony, extract the DNA of experimental group list bacterium colony, according to this reality of method validation of embodiment 1
The positive colony executing example is successful transformant.
The present embodiment AnEp8-hygro plasmid volume is 12.4 kb, by 0.1 μ g plasmid (about 12.426 fmol matter
Grain molecule), electric shock 6 × 108The resting spore that individual geotrichum candidum is not sprouted, creates no less than 6000 positive transformants.
The construction method of the recombiant plasmid AnEp8-hygro of the present embodiment is with embodiment 1.
Embodiment 3
A kind of method that geotrichum candidum resting spore is converted foreign DNA, comprises the following steps:
1) geotrichum candidum is cultivated and spore is collected
In 15cm culture dish, prepare solid agar medium (PDA culture medium), at solid agar medium surface seeding in vain
Mould CICC 32222, temperature 40 DEG C, under humidity 60-85%, cultivates 3, allows media surface cover with geotrichum candidum spore.
Sterilized water is poured into media surface, wash down (concussion, or scratch gently with smooth sterile glass spreading rod)
The geotrichum candidum spore of media surface, with pipettor sucking-off spore suspension, use sterilizing lens paper (or sand core funnel,
Filter paper etc.) filter, to remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after being centrifuged, collects the resting spore of precipitation,
Remove supernatant fluid.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and observes and in confirmation spore
Chromosome is haploid state.
2) geotrichum candidum spore pretreatment
Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then be centrifuged, receive
Collection spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer, micro-
Sem observation, confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last that spore is resuspended
When electroporation buffer, should control the volume of electroporation buffer well, keeping geotrichum candidum spore suspension miospore concentration is 104Individual/
ml。
Described electroporation buffer is by the HEPES of final concentration of 100mmol/L and the mannitol of final concentration of 5000mmol/L
Composition, the pH of electroporation buffer is 7.0.
3) HDEN method electric shock geotrichum candidum spore is used
The geotrichum candidum spore suspension of 600000 μ l, and 10000 μ g recombiant plasmid are added in the hole of 96 porocyte culture plates
AnEp8-hygro, mixing, obtain spore and plasmid mixture, container is placed in ice bath 10min on ice, then uses Etta
Biotech X-Porator H1 electroporation carries out HDEN method electric shock, and the electric shock head with matrix form electrode is inserted spore and matter
Inside grain mixture, energising so that spore is internal with plasmid mixture produces electric field, is placed in by Tissue Culture Plate after electric shock again
Ice bath 10min on ice, then by spore and plasmid mixture sucking-off, obtains importing the geotrichum candidum spore of the dormancy of foreign DNA;
The present embodiment shock parameters is as follows: voltage 6000V, pulsewidth 2ms, is repeated 1 times, and is spaced 50000ms.
4) confirmatory experiment
By spore and the plasmid mixture of above-mentioned sucking-off, it is coated on the YPD solid of HYG containing final concentration of 700 μ g/ml
On agar culture medium flat board, in temperature 40 DEG C, cultivating under humidity 60-85%, until forming single bacterium colony, and carrying out colony counting, meter
Calculate conversion ratio.
Same, while carrying out above-mentioned experimental procedure, need to prepare matched group (with embodiment 1).
After experimental group forms single bacterium colony, extract the DNA of experimental group list bacterium colony, according to this reality of method validation of embodiment 1
The positive colony executing example is successful transformant.
The present embodiment AnEp8-hygro plasmid volume is 12.4 kb, with 10000 μ g plasmids (about 1242600 fmol
Plasmid molecule), electric shock 6 × 106The resting spore that individual geotrichum candidum is not sprouted, produces no less than 7000 positive transformants.
The construction method of the recombiant plasmid AnEp8-hygro of the present embodiment is with embodiment 1.
Embodiment 4
The present embodiment shock parameters is: voltage 30V, pulsewidth 1000000ms, shocks by electricity 50 times, is spaced 5000ms, other same embodiment
1, create no less than 6500 positive transformants.
Embodiment 5
The present embodiment shock parameters is: voltage 3000V, pulsewidth 100ms, shocks by electricity 5 times, interval 25000ms, the other the same as in Example 1,
Create no less than 7200 positive transformants.
The mode by Exogenous DNA transfered geotrichum candidum resting spore that the present invention provides, can be at geotrichum candidum spore dormancy shape
Import arbitrary plasmid under state, be not limited only to recombiant plasmid AnEp8-hygro.
SEQUENCE LISTING
<110>University of Fuzhou
<120>a kind of method that geotrichum candidum resting spore is converted foreign DNA
<130> 1
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 1026
<212> DNA
<213>artificial sequence
<400> 1
atgaaaaagc ctgaactcac cgcgacgtct gtcgagaagt ttctgatcga aaagttcgac 60
agcgtctccg acctgatgca gctctcggag ggcgaagaat ctcgtgcttt cagcttcgat 120
gtaggagggc gtggatatgt cctgcgggta aatagctgcg ccgatggttt ctacaaagat 180
cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt gcttgacatt 240
ggggaattca gcgagagcct gacctattgc atctcccgcc gtgcacaggg tgtcacgttg 300
caagacctgc ctgaaaccga actgcccgct gttctgcagc cggtcgcgga ggccatggat 360
gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg accgcaagga 420
atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat 480
cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag 540
ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc 600
tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg gagcgaggcg 660
atgttcgggg attcccaata cgaggtcgcc aacatcttct tctggaggcc gtggttggct 720
tgtatggagc agcagacgcg ctacttcgag cggaggcatc cggagcttgc aggatcgccg 780
cggctccggg cgtatatgct ccgcattggt cttgaccaac tctatcagag cttggttgac 840
ggcaatttcg atgatgcagc ttgggcgcag ggtcgatgcg acgcaatcgt ccgatccgga 900
gccgggactg tcgggcgtac acaaatcgcc cgcagaagcg cggccgtctg gaccgatggc 960
tgtgtagaag tactcgccga tagtggaaac cgacgcccca gcactcgtcc gagggcaaag 1020
gaatag 1026
<210> 2
<211> 341
<212> PRT
<213>artificial sequence
<400> 2
Met Lys Lys Pro Glu Leu Thr Ala Thr Ser Val Glu Lys Phe Leu Ile
1 5 10 15
Glu Lys Phe Asp Ser Val Ser Asp Leu Met Gln Leu Ser Glu Gly Glu
20 25 30
Glu Ser Arg Ala Phe Ser Phe Asp Val Gly Gly Arg Gly Tyr Val Leu
35 40 45
Arg Val Asn Ser Cys Ala Asp Gly Phe Tyr Lys Asp Arg Tyr Val Tyr
50 55 60
Arg His Phe Ala Ser Ala Ala Leu Pro Ile Pro Glu Val Leu Asp Ile
65 70 75 80
Gly Glu Phe Ser Glu Ser Leu Thr Tyr Cys Ile Ser Arg Arg Ala Gln
85 90 95
Gly Val Thr Leu Gln Asp Leu Pro Glu Thr Glu Leu Pro Ala Val Leu
100 105 110
Gln Pro Val Ala Glu Ala Met Asp Ala Ile Ala Ala Ala Asp Leu Ser
115 120 125
Gln Thr Ser Gly Phe Gly Pro Phe Gly Pro Gln Gly Ile Gly Gln Tyr
130 135 140
Thr Thr Trp Arg Asp Phe Ile Cys Ala Ile Ala Asp Pro His Val Tyr
145 150 155 160
His Trp Gln Thr Val Met Asp Asp Thr Val Ser Ala Ser Val Ala Gln
165 170 175
Ala Leu Asp Glu Leu Met Leu Trp Ala Glu Asp Cys Pro Glu Val Arg
180 185 190
His Leu Val His Ala Asp Phe Gly Ser Asn Asn Val Leu Thr Asp Asn
195 200 205
Gly Arg Ile Thr Ala Val Ile Asp Trp Ser Glu Ala Met Phe Gly Asp
210 215 220
Ser Gln Tyr Glu Val Ala Asn Ile Phe Phe Trp Arg Pro Trp Leu Ala
225 230 235 240
Cys Met Glu Gln Gln Thr Arg Tyr Phe Glu Arg Arg His Pro Glu Leu
245 250 255
Ala Gly Ser Pro Arg Leu Arg Ala Tyr Met Leu Arg Ile Gly Leu Asp
260 265 270
Gln Leu Tyr Gln Ser Leu Val Asp Gly Asn Phe Asp Asp Ala Ala Trp
275 280 285
Ala Gln Gly Arg Cys Asp Ala Ile Val Arg Ser Gly Ala Gly Thr Val
290 295 300
Gly Arg Thr Gln Ile Ala Arg Arg Ser Ala Ala Val Trp Thr Asp Gly
305 310 315 320
Cys Val Glu Val Leu Ala Asp Ser Gly Asn Arg Arg Pro Ser Thr Arg
325 330 335
Pro Arg Ala Lys Glu
340
<210> 3
<211> 6638
<212> DNA
<213>artificial sequence
<400> 3
atgtcttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 60
gctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct 120
ttcgtctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga 180
cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag 240
cgggtgttgg cgggtgtcgg ggctggctta actatgcggc atcagagcag attgtactga 300
gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca 360
ggcgccattc gccattcagg ctgcgcaact gttgggaagg gcgatcggtg cgggcctctt 420
cgctattacg ccagctggcg aaagggggat gtgctgcaag gcgattaagt tgggtaacgc 480
cagggttttc ccagtcacga cgttgtaaaa cgacggccag tgccaagctt gcatgcctgc 540
aggtccgcga atattccgga gatcctgatc atccgtgaga atgaagagga agttgggttt 600
gcgtgcagag accgatggct cctcatccag cagtacctgc tgctgcacag cgagggcatc 660
gcatcccacg aatagggcca acaaagccgg caagaacatc atgatgggag cgacaattcc 720
gtatcaatct cccttgcacg atgttggttg tcactcaccg acactccgtc accaagatca 780
ctattaaaac aagagtgagt tcaaggttgc gatcaagata gcgattgcgc agcaacggca 840
cgggataacg ccatagctct gatggagccg atcagaccag taggtaaact agtcagtcag 900
cgttggactg gagctgcaga gagagttgaa cctggacgcc gcgcaaaaag caaagacgcg 960
cctcgtgggc ggtggatcaa tgatcggatt tagtggcaga tggcatcaca ggcggccaat 1020
gaccaccggg ccaactggcc ccgacattcc agcaatactg cctaattgac tccaccatgc 1080
atctcggcta ttattgaact gggtttgatg gatggggacc ctcttggaat tgtcaaagat 1140
tttgaagcga agacgatcta ttggacggta gagatatact cttgatttag tcgttgggag 1200
gcccctgggg aaagcaatga tggggaatgt tgctgctcca ctgtggacct cggctatgga 1260
attacgtgct tggatctaag atgagctcat ggctatgcat tgaatgacag tgatatcagc 1320
agagcaagca gagaaggatg gaatgctaat tttctagtgc tttgtgcaag ggtaaatcag 1380
ggactgtctg tctggtcttc tacacgaagg gaagaccatg gctttcacgg tgtctgtatt 1440
tccggatatc ctcaattccg tcggtcgatt acaatcacat gacttggctt ccatttcact 1500
actattatgc acacccacta catacatgat catataacca attgccctca tccccatcct 1560
ttaactatag cgaaatggat tgattgtcta ccgccaggtg tcagtcaccg tcgcggtcgg 1620
gccggccggc gcgccgttta aacttaatta agctagctga ttgatctcta ctgaaccggg 1680
ggggaagaca gaagagaagg gattgatgaa gatgggagaa agaatggagg gagagaaggg 1740
aggagaagag ggagagataa tagggaagga aaagacgggg ccggtgagcg agagaagaga 1800
gagatggtgg actagaggag gggtgcccgg gaaggaaaaa tgttggcggc ggtgattggc 1860
tggatcggcc ctttttggtg ggattcctgc tttgggacgc ttttttctgt cggtcggttc 1920
cccgcgggtt gagagctggc ttgttagttg tgcctccagc tacggagtag ttacaatcac 1980
acttcccatc gcctacataa ttcccattat taatgacttt ttctcccccc cggcactatc 2040
gctgggtatc aaaactcaat tatttgctgg gtgatccacc tttcactgct ttgctactat 2100
tctttgatcg tagatacacc tgctgcctcc gtccgctctt ttcactggtc agccaagggt 2160
ttccgcccag cgatcagcag catttgtcca ctacatcctc aggcaccttc cctccgcgca 2220
tctcaggcat tcatacgccg catgcaataa taattggttg ggaagaccaa aagcaattca 2280
cgcccaagcc acaatcagac acccacacaa cattctgcga agtatctggc aggaccacat 2340
gataccctct cactctgtcc agttgacccc acatcgtcgc ggatccattc tctcctagcg 2400
aggtggattt ggatgctttg tcggtgctga attttctcct cgcaaaaaag cccaatgccc 2460
ttcgcaagaa ctatttccct gactccatcg gaacccataa ggctgaattt tgctctgctc 2520
ggacggaccc agttgccagt tatggagaag ctgtctccct ttttattttt attttatttt 2580
atttttttgt ccagtgggta attaatcata gtaatgagga cgagactctg gccagtagac 2640
agggacccta agtaagtact cggaggtttt ctcttccatt tacgcgtggt atatgccctt 2700
cattaatatg gctagtacta ttatgatccc catatatcct tttccgaggc cagacacgtc 2760
catcattcat ctcataaggc taagttcctg accgtccgga cccctccgcc aatggcatca 2820
gatgtgggac gtcccctttt agtcaatacc gttacacatt tccactcaca ctcaaagtcc 2880
aactcttttc tcgtaagctt tccagccttc ctcccggtac ctctgaaccg cctcgactgg 2940
atcgtccgcc ttatagatgc ccctacccgc aatgataaag tccgcacctc gcccaaccgc 3000
cgacccaggt gtctgatact gctgccccag cttatccccc ttatccgaca gattcacccc 3060
agtcgtaaag acgacaaaat cctcgctctc ctctttctgt tcgggcagca cctcactcaa 3120
cgcccttgta ctcacgaatc ccatcacaaa ccccttatac ttccgcgcgt actcaaccga 3180
gcgtgccgtg tactcccctg tcgcaagaga tcccttactc gtcatctcgg caagaatcag 3240
gagacctcgt tgattcgcgt ctttaaagtc aggagacttg gttgtctgtg cgagggcctc 3300
gacgatccct tcgcccggca ggatggcgca gttgatgatg tgtgcccatt cggagatgcg 3360
gagagcgcca ccgtggtact gcttttgcac ggtgttgccg atgtcgatga acttgcggtc 3420
ctcaaagatg aggaagttgt gctttgtcgc gagggattgg agcgaggaaa gggtcgacgg 3480
ggtgagatcg gtgaggatgt cgatgtgggt tttcagaact gcgatatagg ggcctaggcc 3540
tgtactcact acgcatcagc tatttgttat cctggagggg cattggtgca ggatgtacgg 3600
tcagcaagat cgaggagctc ggcggaagta gtaacgtctg cggagacggt gacgttggtt 3660
ttcttctcct cggcgatgga gaagagttta gatgttaaag ggttgggatg gttggttgcg 3720
cgaattgcgt aggggaggtg ggacttcgaa gacatgatgg cggttctcca atgattgaat 3780
tgggctggat taaactgaca atttgaagct ggaagtggga tggctgtata acgaaaactc 3840
accccgctgc ggtggaattt ttgctccggc ccgataagat aggcgcagac ctatctccac 3900
tatcacgaat ataggtcacg aacccgacta tcattcaaac agaccacatt ttatcaactc 3960
tcccctctgt gctaagatgt cgactacatt tacatcaaat cctttgcaac accaaatgcg 4020
ctcaatcccc aaagacccgc ttgcgcaagc aagtacagcg aaccattgta cctgccggtg 4080
ccgttcggct tgtcgctata aatatagccc agcatgtaga gggtgcggag aacaacccag 4140
gccgctccta agcccgctgc tgcctctggg tacttgacgc ctgccaccag gatagagagc 4200
attgtctgcg gcgcgttctc gaggaagttg cgcggccgca agcttatttt ttgtatactg 4260
ttttgtgata gcacgaagtt tttccacggt atcttgttaa aaatatatat ttgtggcggg 4320
cttacctaca tcaaattaat aagagactaa ttataaacta aacacacaag caagctactt 4380
tagggtaaaa gtttataaat gcttttgacg tataaacgtt gcttgtattt attattacaa 4440
ttaaaggtgg atagaaaacc tagagactag ttagaaacta atctcaggtt tgcgttaaac 4500
taaatcagag cccgagaggt taacagaacc tagaagggga ctagatatcc gggtagggaa 4560
acaaaaaaaa aaaacaagac agccacatat tagggagact agttagaagc tagttccagg 4620
actaggaaaa taaaagacaa tgataccaca gtctagttga caactagata gattctagat 4680
tgaggccaaa gtctctgaga tccaggttag ttgcaactaa tactagttag tatctagtct 4740
cctataactc tgaagctaga ataacttact actattatcc tcaccactgt tcagctgcgc 4800
aaacggagtg attgcaaggt gttcagagac tagttattga ctagtcagtg actagcaata 4860
actaacaagg tattaaccta ccatgtctgc catcaccctg cacttcctcg ggctcagcag 4920
ccttttcctc ctcattttca tgctcatttt ccttgtttaa gactgtgact agtcaaagac 4980
tagtccagaa ccacaaagga gaaatgtctt accactttct tcattgcttg tctcttttgc 5040
attatccatg tctgcaacta gttagagtct agttagtgac tagtccgacg aggacttgct 5100
tgtctccgga ttgttggagg aactctccag ggcctcaaga tccacaacag agccttctag 5160
aagactggtc aataactagt tggtctttgt ctgagtctga cttacgaggt tgcatactcg 5220
ctccctttgc ctcgtcaatc gatgagaaaa agcgccaaaa ctcgcaatat ggctttgaac 5280
cacacggtgc tgagactagt tagaatctag tcccaaacta gcttggatag cttacctttg 5340
ccctttgcgt tgcgacaggt cttgcagggt atggttcctt tctcaccagc tgatttagct 5400
gccttgctac cctcacggcg gatctgcata aagagtggct agaggttata aattagcact 5460
gatcctaggt acggggctga atgtaacttg cctttccttt ctcatcgcgc ggcaagacag 5520
gcttgctcaa attcctacca gtcacagggg tatgcacggc gtacggacca cttgaactag 5580
tcacagatta gttagcaact agtctgcatt gaatggctgt acttacgggc cctcgccatt 5640
gtcctgatca tttccagctt caccctcgtt gctgcaaagt agttagtgac tagtcaagga 5700
ctagttgaaa tgggagaaga aactcacgaa ttctcgacac ccttagtatt gtggtccttg 5760
gacttggtgc tgctatatat tagctaatac actagttaga ctcacagaaa cttacgcagc 5820
tcgcttgcgc ttcttggtag gagtcggggt tgggagaaca gtgccttcaa acaagccttc 5880
ataccatgct acttgactag tcagggacta gtcaccaagt aatctagata ggacttgcct 5940
ttggcctcca tcagttcctt catagtggga ggtccattgt gcaatgtaaa ctccatgccg 6000
tgggagttct tgtccttcaa gtgcttgacc aatatgtttc tgttggcaga gggaacctgt 6060
caactagtta ataactagtc agaaactagt atagcagtag actcactgta cgcttgaggc 6120
atcccttcac tcggcagtag acttcatatg gatggatatc aggcacgcca ttgtcgtcct 6180
gtggactagt cagtaactag gcttaaagct agtcgggtcg gcttactatc ttgaaatccg 6240
gcagcgtaag ctccccgtcc ttaactgcct cgagatagtg acagtactct ggggactttc 6300
ggagatcgtt atcgcgaatg ctcggcatac taatcgttga ctagtcttgg actagtcccg 6360
agcaaaaagg attggaggag gaggaggaag gtgagagtga gacaaagagc gaaataagag 6420
cttcaaaggc tatctctaag cagtatgaag gttaagtatc tagttcttga ctagatttaa 6480
aagagatttc gactagttat gtacctggag tttggatata ggaatgtgtt gtggtaacga 6540
aatgtaaggg ggaggaaaga aaaagtcggt caagaggtaa ctctaagtcg gccattcctt 6600
tttgggaggc gctaaccata aacggcatgg cggcatgg 6638
Claims (10)
1. the method that geotrichum candidum resting spore is converted foreign DNA, it is characterised in that: said method comprising the steps of:
1) geotrichum candidum is cultivated and spore is collected
At solid agar medium surface seeding geotrichum candidum, cultivate and cover with geotrichum candidum spore to media surface, wash lower culture medium
The geotrichum candidum spore on surface, sucking-off spore suspension also filters removal mycelia, collects the filtrate containing spore, filtrate be centrifuged, receive
The resting spore of collection precipitation;
2) geotrichum candidum spore pretreatment
With the resuspended spore of electroporation buffer, centrifugal and collect spore precipitation, after repeating above-mentioned resuspended and centrifugation step 3-4 time, general
The spore precipitation finally collected is resuspended in electroporation buffer, and obtaining spore concentration is 104-1011The geotrichum candidum spore of individual/ml hangs
Liquid;
Described electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid of final concentration of 0.01-100mmol/L and final concentration of 0.5-
The mannitol composition of 5000mmol/L, the pH of electroporation buffer is 3.0-9.5;
3) HDEN method electric shock geotrichum candidum spore is used
In the hole of Tissue Culture Plate, add geotrichum candidum spore suspension and plasmid to be transformed that above-mentioned steps obtains, mixing, obtain
To spore and plasmid mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then uses Etta Biotech X-
Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and plasmid mixture by the electric shock head with matrix form electrode
Portion, energising so that spore is internal with plasmid mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath more on ice
10-15min, then by spore and plasmid mixture sucking-off, obtains importing the geotrichum candidum spore of the dormancy of foreign DNA;
Described geotrichum candidum suspension with the ratio of plasmid to be transformed is: the geotrichum candidum spore suspension of 6-600000 μ l: 0.1-10000 μ g
Plasmid to be transformed;
Described shock parameters is as follows: voltage 1-6000V, and pulsewidth 2-2000000ms repeats 1-100 time, every minor tick 5-
50000ms。
A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute
The culture medium stating step 1) is PDA culture medium, YPD culture medium or Czapek's medium.
A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute
State step 1) condition of culture of geotrichum candidum is: temperature 16-40 DEG C, humidity 15-85%, cultivates 3-15 day.
A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 3, it is characterised in that: institute
Stating step 1), the condition of culture of geotrichum candidum is: temperature 28 DEG C, humidity 50-60%, cultivates 7.
A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute
State step 2), electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid of final concentration of 1mmol/L and final concentration of 50mmol/L
Mannitol forms, and the pH of electroporation buffer is 7.0.
A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute
State step 2) geotrichum candidum spore suspension before electric shock, in basis of microscopic observation, confirm spore suspension mixes dirt without mycelium
Dye and spore are not all sprouted, and shock by electricity the most again.
A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute
Stating step 3), plasmid to be transformed is recombiant plasmid AnEp8-hygro, and described recombiant plasmid AnEp8-hygro is by Hygromycin B resistant
Gene and AnEp8 plasmid construction form.
A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 7, it is characterised in that: institute
Stating step 3), geotrichum candidum suspension with the ratio of recombiant plasmid AnEp8-hygro is: the geotrichum candidum spore suspension of 60 μ l: the weight of 1 μ g
Group plasmid AnEp8-hygro.
A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute
Stating step 3), shock parameters is as follows: voltage 520V, pulsewidth 2000ms, is repeated 4 times, every minor tick 300ms.
A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute
State step 3), also include processing as follows: by spore and plasmid mixture sucking-off, be coated on the tide containing final concentration of 700 μ g/ml
On the YPD solid agar medium flat board of mycin B, cultivate at temperature 16-40 DEG C, humidity 15-85%, until forming single bacterium colony,
And carry out colony counting.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610812882.0A CN106148388A (en) | 2016-09-09 | 2016-09-09 | A kind of method that geotrichum candidum resting spore is converted foreign DNA |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610812882.0A CN106148388A (en) | 2016-09-09 | 2016-09-09 | A kind of method that geotrichum candidum resting spore is converted foreign DNA |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106148388A true CN106148388A (en) | 2016-11-23 |
Family
ID=57341005
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610812882.0A Pending CN106148388A (en) | 2016-09-09 | 2016-09-09 | A kind of method that geotrichum candidum resting spore is converted foreign DNA |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106148388A (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20100304468A1 (en) * | 2007-05-21 | 2010-12-02 | Danisco Us, Inc., Genencor Division | Method for introducing nucleic acids into fungal cells |
-
2016
- 2016-09-09 CN CN201610812882.0A patent/CN106148388A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20100304468A1 (en) * | 2007-05-21 | 2010-12-02 | Danisco Us, Inc., Genencor Division | Method for introducing nucleic acids into fungal cells |
Non-Patent Citations (3)
Title |
---|
G. H. GOLDMAN: "Transformation of Trichoderma harzianum by high-voltage electric pulse", 《CURRENT GENETICS》 * |
KENJI OZEKI: "Transformation of Intact Aspergillus niger by Electroporation", 《BIOSCIENCE, BIOTECHNOLOGY, AND BIOCHEMISTRY》 * |
WU,M.X.等.: "High-density distributed electrode network, a multi-functional electroporation method for delivery of molecules of different sizes", 《SCIENTIFIC REPORTS》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Granado et al. | Restriction enzyme-mediated DNA integration in Coprinus cinereus | |
CN110268063A (en) | The method for establishing fungi production bacterial strain using automation genetic manipulation and bacterial strain purification step | |
CN106086058A (en) | A kind of method reducing Cordyceps militaris (L.) Link. fruiting time and raising fruiting yield | |
CN106148389A (en) | A kind of direct conversion foreign DNA enters the method that Buddhist nun's fine jade penicillium sp does not sprouts spore | |
CN106244616A (en) | A kind of method making foreign DNA penetration cell barrier inlet point penicillium sp resting spore | |
CN106244620A (en) | It is independent of medium and directly converts the method that foreign DNA enters aspergillus niger resting spore | |
CN106148387A (en) | The method directly penicillium expansum resting spore being converted external source DNA (deoxyribonucleic acid) | |
CN106191098A (en) | Foreign DNA is allowed to pass through the method that volume branch Mucor does not sprouts spore cell wall and cell membrane | |
CN106148386A (en) | A kind of non-Medium Dependent directly method to aspergillus oryzae resting spore conversion foreign DNA | |
CN106148388A (en) | A kind of method that geotrichum candidum resting spore is converted foreign DNA | |
CN106244619A (en) | It is independent of medium and directly converts the method that foreign DNA enters Rhizopus oryzae resting spore | |
Lu | Chromosomes, mitosis, and meiosis | |
CN106191097A (en) | Directly deliver external source DNA (deoxyribonucleic acid) to the method within monascus resting spore | |
CN106244618A (en) | A kind of method converting external source DNA (deoxyribonucleic acid) entrance Rhizopus stolonifer resting spore | |
CN106148382A (en) | The method being introduced directly into external source DNA (deoxyribonucleic acid) in Magnaporthe grisea resting spore | |
CN106244617A (en) | A kind of foreign DNA that delivers enters the method that Mucor racemosus Fres does not sprouts spore | |
CN106148385A (en) | A kind of method to aspergillus flavus resting spore conversion foreign DNA | |
CN106148384A (en) | Non-Medium Dependent directly converts the method that foreign DNA enters aspergillus nidulans resting spore | |
CN106381306A (en) | Method for delivering exogenous DNA (deoxyribonucleic acid) into Aspergillus fumigatus ungerminated spores | |
CN106148383A (en) | It is independent of medium and directly converts the method that foreign DNA enters trichoderma reesei resting spore | |
CN106381307A (en) | Method for directly importing foreign DNA into fusarium moniliforme resting spores | |
CN106381304A (en) | Method for expressing proteins in aspergillus oryzae resting spores by using exogenous single chain RNA (Ribose Nucleic Acid) | |
CN106148414A (en) | Singlestranded RNA is utilized to convert Buddhist nun's fine jade penicillium sp spore and manufacture method of protein | |
CN106191123A (en) | Use external source single stranded RNA method of marking protein in trichoderma reesei resting spore | |
Xiao et al. | Generation of yeast protoplasts by lytic actions of iron oxide magnetic nanoparticles |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161123 |
|
RJ01 | Rejection of invention patent application after publication |