CN106148388A

CN106148388A - A kind of method that geotrichum candidum resting spore is converted foreign DNA

Info

Publication number: CN106148388A
Application number: CN201610812882.0A
Authority: CN
Inventors: 林峻
Original assignee: Fuzhou University
Current assignee: Fuzhou University
Priority date: 2016-09-09
Filing date: 2016-09-09
Publication date: 2016-11-23

Abstract

The invention discloses a kind of method that geotrichum candidum resting spore is converted foreign DNA, cultivate including geotrichum candidum and spore collection, geotrichum candidum spore pretreatment and use HDEN method electric shock three steps of geotrichum candidum spore, obtain importing the geotrichum candidum spore of plasmid to be transformed.The present invention is used as importing the parent material of exogenous molecules with the spore do not sprouted, and apply HDEN electricity transformation technology by Exogenous DNA transfered geotrichum candidum resting spore, the step doing this complexity of spore germination can be saved, save the step etc. preparing protoplast or Agrobacterium-mediated Transformation in traditional method, and conversion ratio is high, each conversion reaction system, at least can reach the effect no less than 6000 positive transformants.

Description

A kind of method that geotrichum candidum resting spore is converted foreign DNA

Technical field

The invention belongs to biological technical field, be specifically related to a kind of method that geotrichum candidum resting spore is converted foreign DNA.

Background technology

Geotrichum candidum is a kind of common mycete, can glucose fermentation, mannose, fructose；The weak ferment galactose of some energy；Also Have can assimilate alcohols: glycerol, ethanol, sorbitol, mannitol；And decompose pectin, oils and fats, produce feed yeast and nucleotide Etc. a series of, there is the product that Important Economic is worth, be a kind of important industrial fermentation strain.But at present geotrichum candidum is converted Foreign DNA is extremely difficult, constrains it genetic engineering modified.

Genetic engineering is with molecular genetics as theoretical basis, with the modernism of molecular biology as means, by difference Source gene by the blueprint being pre-designed, constructed dna molecule in vitro, be then introduced into cell, to change biological original something lost Pass characteristic, it is thus achieved that new varieties, produce new product and (such as certain is had the enzyme gene that Important Economic is worth, imports to geotrichum candidum Intracellular, do pheron high expressed, produce this enzyme).In this field, it is important that a link, it is simply that external DNA, Import to cell interior.For different plant species and the cell of different conditions, need different introduction methods, just can allow external DNA strides across cell wall and cell membrane, is transported to cell interior.

The main DNA method for transformation being currently used for filamentous fungi field (including geotrichum candidum) includes:

1. protoplast mediated transformation (protoplast-mediated transformation): the method uses various enzyme water Solving the cell wall of fungal mycelium, expose cell membrane, under certain electrochemical conditions, cell membrane can absorb foreign DNA.But It is the structure due to fungal cell wall and complicated component, and the cell wall of the different subspecies of different plant species, the most same species Structure and composition are the most different, therefore, it is impossible to method prepared by unified protoplast, and, a lot of funguses, the most in vain Mould, protoplast is prepared extremely difficult, and step is the most loaded down with trivial details, and needs special, expensive cytohydrolist.

2. agrobacterium tumefaciens mediated transformation method (Agrobacterium tumefaciens-mediated Transformation): agrobacterium tumefaciens (Agrobacterium tumefaciens) is a kind of gram negative bacteria, it is possible to Infect plant callus and filamentous fungi, in cell, will can be inserted into the base of host by the cyclic plasmid Ti-DNA of stable heredity Because of in group.But the method step is troublesome, the longest, and Agrobacterium is selective to host, and not all fungus is the suitableeest Close in this way.Additionally, the position that foreign DNA inserts host genome is random, it is impossible to anticipation.Foreign DNA can only be inserted Enter host genome, it is impossible to enough survive in the Cytoplasm of host freely.

3. DNA is adsorbed at specialty metal by Gene Knock-out Mice (Biolistic Transformation): the method The surface of grain, accelerates with gunpowder explosion or gases at high pressure, the metallic particles having adsorbed DNA is sent directly into complete tissue or Person's cell.This method needs much more expensive special experimental facilities, and metallic particles consumptive material used usually needs to use Gold material.Additionally, the method transformation efficiency is the highest, and host cell mortality rate under metallic particles bombards is high, regeneration More difficult, therefore its range is restricted.

4, electroporated (Electroporation): this is that of short duration the acting on of a kind of electric pulse contacts foreign DNA Cell, makes foreign DNA enter cell, so that the method that cell trait changes.Agrobacterium is needed with agrobacterium co-cultivation Needing metallic particles different as medium as medium, particle bombardment, this method need not medium to carry foreign DNA.Pass The electric shocking method of system, shocks by electricity including Exponential Decay Wave electric shock and square wave.The energy of Exponential Decay Wave electric shock is big especially, the damage to cell Wound is the biggest, and microbial cell is due to simple in construction, has cell wall, cell strong stress resistance, and vitality is strong, and a lot of micro-life The shell of thing cell is hard, it is possible to tolerating big energy shocks, therefore Exponential Decay Wave electric shock is typically only used for microbial cell.And Mammalian cell (such as Human cell line), for relative microbes, the most fragile, easily dead, therefore, square wave electric shock is often For mammalian cell.Additionally, the live body electricity that square wave electric shock is also widely used for toy (such as mice) converts.

HDEN electricity transformation technology (the high-density distributed electrode that 2013 emerge Network), be a kind of characteristic being specifically designed for mammalian cell, and open electricity transformation technology, its exploitation purpose be in order to Improve in mammalian cell, transmit foreign DNA and the efficiency of medicine.This technology comprises 3 most contents, and one is applied to The electric wave form of cell sample, two is the cell sample solution environmental when electric shock, and three is cultural method and the electricity of cell sample Hit front preprocess method.Owing to this technology is specific to mammalian cell exploitation, therefore, above-mentioned 3 most contents, all It is to design for the characteristic of mammalian cell.

In this field it is known that the characteristic of microbial cell and cultural method, compared with mammalian cell, thousand is poor Ten thousand is other.Mammalian cell is different with the structure of microbial cell, and mammalian cell does not has cell wall, microbial cell (ratio Such as majority of fungal, include geotrichum candidum) there is cell wall.The cell membrane of mammalian cell and the cell membrane of microorganism also differ Sample.

Therefore, any technology being applied to mammalian cell, all it is difficult to directly apply to microbial cell.Existing document Report HDEN technology at HEK-293A, Hela, Neuro-2A, MCF-7, C2C12,3T3-L1, CHO, MDCK, HL-60, Application in the mammalian cells such as HUVEC, A375, U251.Not yet there is this technology thing beyond mammalian cell at present The Case Report of application in kind.Therefore, HDEN electricity transformation technology can be applied to the species beyond mammalian cell, is also One unknown number.

Filamentous fungi (including geotrichum candidum) is a class eukaryotic microorganisms, and the genome of the most eurypalynous fungus is polyploid. When doing genetic engineering modified to living individual, the most difficult is exactly in the face of polyploid phenomenon.Since the transformation to polyploid, usually Inefficiency (such as gene targeting may only hit item chromosome, and additionally one or several homologous chromosome that misses the target), and And polyploid is when schizogamy, homologous chromosome separates, it is also difficult to transformation site is entailed all filial generations.This is in this area Interior well-known.

Fungal spore is the main organ of multiplication of fungus, and spore is resting state and can survive for a long time.Spore exists Under suitable external condition, it is possible to revive and sprout, form mycelia and carry out schizogamy.Most importantly, a lot of types The spore of fungus, is natural monoploid, directly carries out genetic engineering modified to haplospore, and efficiency far is many higher than operation Times body.

But, owing to spore is typically in resting state, its cell wall is the most abundant, the cell wall of resting spore, cell The state of film, is different from sprouting spore and mycelium.And the intracellular vital movement of resting spore is also at the most vigorous State, therefore, it is known in the art that the cell permeability of resting spore not as sprouting spore and mycelia, resting spore is hardly Material is exchanged with the external world, of seclusion, it is typically in sleep state.And sprout spore or mycelium, need to absorb respectively from the external world Planting nutrient molecule supply vital movement, therefore cell wall and membrane passage are more than resting spore.So, it is very difficult to will Exogenous DNA molecule is importing directly into the inside of sleep spore.

In existing several big mature technology: protoplast transformation, as the source of the protoplast of host cell, typically It it is the mycelium (polyploid) of fungus.Agrobacterium_mediated method, under agriculture bacillus mediated, is consolidating Agrobacterium and fungal spore Body media surface co-cultures a couple of days, can be Exogenous DNA transfered fungal cell.But this way is not directly to spore Converting, because during co-culturing, fungal spore can be sprouted, and then Agrobacterium invasion and attack sprout spore, outside could importing Source DNA.And agrobacterium co-cultivation, need Agrobacterium as the medium of mediation, need first to do an Agrobacterium-mediated Transformation, just can do follow-up Fungal transformation, therefore operate extremely complex and loaded down with trivial details, and the cycle be long.

Traditional electroporated method (using Exponential Decay Wave to shock by electricity), host cell uses the allergenic of sprouting Son.The electric-shocking method for fungal spore that such as Ozeki etc. found, it is necessary to allow after spore germination, could electroporated (be somebody's turn to do Method discloses and allows the specific experiment step of spore germination and details).The method is classical technology pioneering in industry, is at present Only without significantly improving, used till today by those skilled in the art always.Present inventor also attempted converting by the method not sprouting Spore, success, at present, does not has any successful document to report yet.The method that Ozeki etc. found is shown in document 1:OZEKI K, KYOYA F, HIZUME K, KANDA A, HAMACHI M, NUNOKAWA Y. Transformation of intact Aspergillus niger by electroporation [J]. Biosci Biotechnol Biochem, 1994, 58 (12): 2224-2227.

At present, not yet have any method, any report, can accomplish directly exogenous DNA molecule in situation about mediating without medium Under, import inside (sprouting) fungal spore of dormancy.This is also the technical barrier never captured in the industry.

Summary of the invention

It is an object of the invention to overcome the deficiencies in the prior art, it is provided that a kind of to geotrichum candidum resting spore conversion external source The method of DNA, the step for that the method walking around fungus spore germination, uses HDEN electricity transformation technology, directly with the spore of dormancy, Import foreign DNA.

For achieving the above object, the present invention adopts the following technical scheme that

A kind of method that geotrichum candidum resting spore is converted foreign DNA, comprises the following steps:

1) geotrichum candidum is cultivated and spore is collected

At solid agar medium surface seeding geotrichum candidum, cultivate and cover with geotrichum candidum spore to media surface, wash lower culture medium The geotrichum candidum spore on surface, sucking-off spore suspension also filters removal mycelia, collects the filtrate containing spore, filtrate be centrifuged, receive The resting spore of collection precipitation；

2) geotrichum candidum spore pretreatment

With the resuspended spore of electroporation buffer, centrifugal and collect spore precipitation, after repeating above-mentioned resuspended and centrifugation step 3-4 time, general The spore precipitation finally collected is resuspended in electroporation buffer, and obtaining spore concentration is 10⁴—10¹¹The geotrichum candidum spore of individual/ml Suspension；

Described electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid (HEPES) of final concentration of 0.01-100mmol/L and final concentration Mannitol for 0.5-5000mmol/L forms, and the pH of electroporation buffer is 3.0-9.5；

3) HDEN method electric shock geotrichum candidum spore is used

In the hole of Tissue Culture Plate, add geotrichum candidum spore suspension and plasmid to be transformed that above-mentioned steps obtains, mixing, obtain To spore and plasmid mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then uses Etta Biotech X- Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and plasmid mixture by the electric shock head with matrix form electrode Portion, energising so that spore is internal with plasmid mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath more on ice 10-15min, then by spore and plasmid mixture sucking-off, obtains importing the geotrichum candidum spore of the dormancy of foreign DNA；

Described geotrichum candidum suspension with the ratio of plasmid to be transformed is: the geotrichum candidum spore suspension of 6-600000 μ l: 0.1-10000 μ g Plasmid to be transformed；

Described shock parameters is as follows: voltage 1 6000V, pulsewidth 2-2000000ms, repeats 1-100 time, every minor tick 5- 50000ms。

Further, the culture medium of described step 1) is PDA culture medium, YPD culture medium or Czapek's medium, preferably PDA The effect of culture medium is best, produces spore the fastest at most.

Described step 1) condition of culture of geotrichum candidum is: temperature 16-40 DEG C, humidity 15-85%, cultivates 3-15 day.

Preferably, described step 1), the condition of culture of geotrichum candidum is: temperature 28 DEG C, humidity 50-60%, cultivates 7.

Further, described step 2), electroporation buffer is by the HEPES and final concentration of 50-of final concentration of 1-10mmol/L The mannitol composition of 100mmol/L, the pH of electroporation buffer is 5.0-7.0；

Preferably, described step 2), electroporation buffer is by the HEPES and final concentration of 50mmol/L of final concentration of 1mmol/L Mannitol forms, and the pH of electroporation buffer is 7.0.

Described step 2) geotrichum candidum spore suspension before electric shock, in basis of microscopic observation, confirm in spore suspension aseptic Filament mixes pollution and spore is not all sprouted, and shocks by electricity the most again.

Further, described step 3), plasmid to be transformed is recombiant plasmid AnEp8-hygro, described recombiant plasmid AnEp8- Hygro is formed by hygromycin B resistant gene and AnEp8 plasmid construction, and described electric shock uses Etta Biotech X-Porator H1 electroporation.

Preferably, geotrichum candidum suspension with the ratio of recombiant plasmid AnEp8-hygro is: the geotrichum candidum spore suspension of 60 μ l: 1 The recombiant plasmid AnEp8-hygro of μ g.

Further, described step 3), voltage 300-3000V, pulsewidth 200-1000000ms, repeats 1-50 time, every minor tick 500-5000ms；It is preferably: voltage 520V, pulsewidth 2000ms, is repeated 4 times, every minor tick 300ms.

Further, in order to verify that foreign DNA has imported geotrichum candidum resting spore, described step 3), after electric shock, again ice bath Also comprise the steps: spore and plasmid mixture sucking-off, be coated on HYG containing final concentration of 700 μ g/ml On YPD solid agar medium flat board, at temperature 16-40 DEG C, humidity 15-85%, cultivate (preferably temperature 28 DEG C, humidity 50- Cultivate for 60% time), until forming single bacterium colony, and carry out colony counting.

(hygromycin B, CAS number described HYG: 31282-04-9) dissolve with sterilizing high purity water, prepare highly concentrated Degree mother solution, before using, adds in culture medium according to concentration ratio.

While carrying out above-mentioned experimental procedure, need to prepare matched group: by that do not shock by electricity, identical " spore and plasmid Mixture ", it is coated on the YPD solid agar medium flat board of other one piece of HYG containing 700 μ g/ml, the same terms Lower cultivation.When this matched group is formed without single bacterium colony, can determine whether that single bacterium colony of experimental group is positive colony.

After experimental group forms single bacterium colony, extract the DNA of experimental group list bacterium colony, use pcr amplified DNA may contain External source hygromycin B resistant gene, amplified production uses agarose gel electrophoresis to judge stripe size, when stripe size meets expection After, use Sanger DNA sequencing method, determine whether its DNA sequence coincide with external source hygromycin B resistant gene.If coincide, Then can accurately judge that positive colony is successful transformant.

Geotrichum candidum of the present invention is geotrichum candidum CICC 32222, and described electric shock uses Etta Biotech X-Porator H1 electroporation, buys and reaches biotech firm from Suzhou one.

The present invention collects the spore do not sprouted, and follow-up electricity turns experimentation, if without specified otherwise, experimental implementation is equal Operating in the constant temperature laboratory of not higher than 23 degrees Celsius, centrifugation step is 4 DEG C of frozen centrifugations, and each of spore is not sprouted in contact Plant liquid all in advance in pre-cooling on ice.Do not sprout spore and forbid to touch any containing promoting its factor sprouted and material (the such as germination medium with YEPD etc. as representative), to ensure the resting state of spore.

Geotrichum candidum incubation of the present invention, after geotrichum candidum surface covers with spore (can be judged) by color and form, Pouring sterilized water into media surface, wash the geotrichum candidum spore of lower media surface, with pipettor sucking-off spore suspension, use is gone out The lens paper (or sand core funnel, filter paper etc.) that bacterium crosses filters, and removes mycelia, retains spore, without filtration step, then Spore suspension can be contaminated with mycelia, the transformant that subsequent step obtains, it is impossible to judge it is to be formed by after spore transforming DNA actually Positive colony, or after mycelia transforming DNA formed false positive.It is dyeed by spore chromosome dyeing the to be used method obtained Body dyes, and observation and the chromosome confirmed in spore are haploid states.

The present invention prepares the molecular biology high purity water or double steaming that the water of solid agar medium should be MillQ rank Water, resistivity of water is not less than 18.2M Ω-cm.

When using HDEN method electric shock geotrichum candidum spore, the hole of Tissue Culture Plate adds the geotrichum candidum spore of proper proportion Suspension and plasmid to be transformed, mix even, is placed in by container and carries out ice bath on ice.Such as in the hole of 96 porocyte culture plates (the Nunclon Surface 96 porocyte culture plate of NUNC company, article No. Cat.No.167008), adds the geotrichum candidum of 60 μ l Spore suspension, and 1 μ g recombiant plasmid AnEp8-hygro.Described Tissue Culture Plate can also be 384 orifice plates, 24 orifice plates, 6 orifice plates, Or other more greatly, less container, then according to container volume size, zoom in or out spore and plasmid mixture body System.

The present invention uses above technical scheme, is used as importing the parent material of exogenous molecules with the spore do not sprouted, non- It is often easy, because the step doing this complexity of spore germination can be saved, it is often more important that, the spore of sprouting, may multiparity Give birth to polyploid, and the spore do not sprouted, it is ensured that it is monoploid, a lot of engineered application, it is desirable to host cell must Must be monoploid, can be only achieved result or the efficiency of anticipation.Meanwhile, present invention application HDEN electricity transformation technology is by foreign DNA Import geotrichum candidum resting spore.HDEN electricity transformation technology have employed high-density matrix formula electrode, and it can produce high uniformity and strong Spending enough electric fields, the condition that in electric field, each cell accepts to shock by electricity is the most completely the same, during operation, as long as cell being placed on logical With in container, such as Tissue Culture Plate, then the electric shock head with matrix form electrode is inserted in container, it is energized.And it is traditional Electricity turn technology and usually use special electric shock cup, between two pieces of metallic plates being placed in parallel, place cell, and to metallic plate Power up, form electric field electric shock.Therefore, the discharge mode of the two is entirely different, and the former electrode inserts inside cell suspension, including Portion produces electric field, and the latter is to produce electric field in the outside that cell suspension is overall；The former electrode tip is made up of many metal needles, Between pin and pin, produce voltage, and the latter only has two pieces of metallic plates, one piece of positive pole, one piece of negative pole, produces electricity between Pressure.HDEN technology also essentially eliminates the cathode effect of tradition electric shock technology, it is to avoid produce a large amount of hydroxide ion, it is to avoid kill Cell, improves the cell survival rate after electric shock.And tradition electric shock technology is difficult to eliminate cathode effect.It addition, traditional electric shock side Method the most only shocks by electricity 1 time, if because tradition electric-shocking method shocks by electricity repeatedly, then cell mortality can be greatly increased, and this Bright HDEN method can shock by electricity repeatedly, the effect that repeatedly can shock by electricity with superposition, and cell mortality will not be dramatically increased.

HDEN electricity transformation technology is a kind of characteristic being specifically designed for mammalian cell and opens electricity transformation technology, and it is opened Sending out purpose is to transmit foreign DNA and the efficiency of medicine in mammalian cell to improve.And in this field it is known that The characteristic of microbial cell and cultural method, compared with mammalian cell, vary.Mammalian cell and microorganism are thin The structure of born of the same parents is different, and mammalian cell does not has a cell wall, and microbial cell (such as majority of fungal, include geotrichum candidum) has Cell wall.The cell membrane of mammalian cell and the cell membrane of microorganism are the most different.Even if same is biological, its difference Tissue, Different Organs or different cell types, respective cell membrane, the structure of cell wall, state, chemical composition, the most not Equally.Even the same tissue of same biology, same organ, same cell type, at different growth promoter Stage, or in different external environments, respective cell membrane, the structure of cell wall, state, chemical composition, the most all differ Sample.And cell wall and cell membrane, it is to stop the barrier that exogenous molecules enters cell, barrier is different, and (structure is different, and chemical composition is not With), the method determining breakthrough barrier is also different.Additionally, different exogenous molecules because have different structure, point Son amount, volume and chemical composition, when identical barrier, the method that different exogenous molecules break through barrier is also different. If in the face of different barriers, then different exogenous molecules break through method and the mechanism of different barrier, vary especially.

Therefore, any technology being applied to mammalian cell, all it is difficult to directly apply to microbial cell.The most not yet There is the Case Report of application in HDEN technology species beyond mammalian cell.The present invention is directed to the spy of geotrichum candidum cell Property, use HDEN technology by Exogenous DNA transfered geotrichum candidum resting spore, the method determines cultural method and the electricity of cell sample Hit front preprocess method, the cell sample solution environmental when electric shock, and put on the electric wave form of cell sample.Use this Inventive method is the easiest quickly, directly uses wild spore as raw material, it is not necessary to spore carries out competence preparation process, Without removing archespore wall by various loaded down with trivial details methods (such as enzyme hydrolysis method), if wild spore wash clean more resuspended In electroporation buffer, step is the easiest.Protoplasm body in traditional method, needs special cytohydrolist, needs Want complicated preparation and the step of regeneration protoplast；Traditional electric shocking method, needs first spore germination to be processed, after it is sprouted Just can be electroporated, and conversion ratio is low;Traditional agrobacterium co-cultivation, needs first to do Agrobacterium-mediated Transformation, just can do follow-up white The mould conversion in ground；Traditional particle bombardment, needs expensive consumptive material, and conversion ratio is low.

The inventive method conversion ratio is high, and each conversion reaction system at least can reach no less than 6000 positive transformants The effect of son, the AnEp8-hygro plasmid volume of such as embodiment 1 is 12.4 kb, with 1 μ g plasmid (about 124.26 fmol Individual plasmid molecule), electric shock 6 × 10⁶The resting spore that individual geotrichum candidum is not sprouted, can produce no less than 8000 positive transformants.

It is known that the volume of plasmid and conversion ratio are inversely proportional to, the plasmid that volume is the biggest, be less susceptible to through cell wall and Cell membrane, the plasmid of the 12.4kb used by the present invention belongs to ultra-large type plasmid, and the geotrichum candidum of existing document report converts (protoplasm Body convert, electricity convert) plasmid volume major part all at below 8kb.

There is the multiple description method about conversion ratio height this area at present, including: how many μ g plasmids can produce how many Positive transformant；How many plasmids (molal quantity, DNA molecular number) can produce how many positive transformants；How many hosts are thin Born of the same parents can produce how many positive transformants, etc..This patent discloses host cell number, the quality of plasmid, the molecule of plasmid Number, the various index of molecular weight of plasmid etc., in any case evaluate, evaluate the conversion ratio of a transformation system by what mode Just, these indexs that this patent can be used to disclose calculate and convert.

Accompanying drawing explanation

Fig. 1 is that embodiment 1 uses the agarose gel electricity whether containing hygromycin gene in PCR amplification verification sample Swimming figure.

Detailed description of the invention

Below example is easy to be better understood from the present invention, but does not limit the present invention.

The all operations of experimentation is intended to follow sterile working's principle of Experiment on Microbiology, and vessel, consumptive material, reagent are intended to sterilizing Process.

Embodiment 1

1) geotrichum candidum is cultivated and spore is collected

In 15cm culture dish, prepare solid agar medium (PDA culture medium), at solid agar medium surface seeding in vain Mould CICC 32222, temperature 28 DEG C, humidity 50-60%, cultivate 7, allow media surface cover with geotrichum candidum spore.

Sterilized water is poured into media surface, wash down (concussion, or scratch gently with smooth sterile glass spreading rod) The geotrichum candidum spore of media surface, with pipettor sucking-off spore suspension, use sterilizing lens paper (or sand core funnel, Filter paper etc.) filter, to remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after being centrifuged, collects the resting spore of precipitation, Remove supernatant fluid.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and observes and in confirmation spore Chromosome is haploid state.

2) geotrichum candidum spore pretreatment

Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then be centrifuged, receive Collection spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer, micro- Sem observation, confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last that spore is resuspended When electroporation buffer, should control the volume of electroporation buffer well, keeping geotrichum candidum spore suspension miospore concentration is 10⁸Individual/ ml。

Described electroporation buffer is made up of the mannitol of the HEPES and final concentration of 50mmol/L of final concentration of 1mmol/L, The pH of electroporation buffer is 7.0.

3) HDEN method electric shock geotrichum candidum spore is used

The geotrichum candidum spore suspension of 60 μ l, and 1 μ g recombiant plasmid AnEp8-hygro is added in the hole of 96 porocyte culture plates, Mixing, obtains spore and plasmid mixture, container is placed in ice bath 10min on ice, then uses Etta Biotech X- Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and plasmid mixture by the electric shock head with matrix form electrode Portion, energising so that spore is internal with plasmid mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath more on ice 10min, then by spore and plasmid mixture sucking-off, obtains importing the geotrichum candidum spore of the dormancy of foreign DNA；

The present embodiment shock parameters is as follows: voltage 520V, pulsewidth 2000ms, is repeated 4 times, every minor tick 300ms.

4) confirmatory experiment

By spore and the plasmid mixture of above-mentioned sucking-off, it is coated on the YPD solid of HYG containing final concentration of 700 μ g/ml On agar culture medium flat board, in temperature 28 DEG C, cultivating under humidity 50-60%, until forming single bacterium colony, and carrying out colony counting, meter Calculate conversion ratio.

While carrying out above-mentioned experimental procedure, need to prepare matched group: by that do not shock by electricity, identical " spore and plasmid Mixture ", it is coated on the YPD solid agar medium flat board of other one piece of HYG containing 700 μ g/ml, the same terms Lower cultivation.When matched group is formed without single bacterium colony, therefore single bacterium colony of judgment experiment group is positive colony.

After experimental group forms single bacterium colony, extract the DNA of experimental group list bacterium colony, use pcr amplified DNA may contain External source hygromycin B resistant gene, amplified production use agarose gel electrophoresis judge stripe size, electrophoresis result as it is shown in figure 1, Electrophoresis swimming direction is from bottom to top, and Marker is takara 250bp DNA ladder marker, and swimming lane 1 is negative right According to, swimming lane 2 at band clearly seen from about 1kb, this band is consistent with hygromycin B resistant gene band, illustrates to convert successfully, I.e. swimming lane 2 is the hygromycin B resistant gene band being amplified.Then using Sanger DNA sequencing method, result shows its DNA sequence Row coincide with external source hygromycin B resistant gene, therefore can accurately judge that the positive colony of the present embodiment is successful transformant.

The present embodiment AnEp8-hygro plasmid volume is 12.4 kb, with 1 μ g plasmid (about 124.26 fmol plasmids Molecule), electric shock 6 × 10⁶The resting spore that individual geotrichum candidum is not sprouted, creates no less than 8000 positive transformants.

The recombiant plasmid AnEp8-hygro of the present embodiment is formed by hygromycin B resistant gene and AnEp8 plasmid construction.Weight The construction method of group plasmid AnEp8-hygro is as follows:

Hygromycin B resistant gene is as shown in SEQ ID NO.1.

Coded protein sequence is as shown in SEQ ID NO.2.

Using following primer, PCR expands above-mentioned hygromycin B resistant gene:

F:CATTAGCTAGCATGAAAAAGCCTGAACTCACCG

R:TCTGGCGCGCCCTATTCCTTTGCCCTCGG

PCR system (50 μ L): template 3 μ L, primers F (10 μMs) 2 μ L, primer R(10 μM) 2 μ L, 2X Taq PCR mix 25 μ L, ddH₂O mends to 50 μ L.

PCR program: 94 DEG C of 10min, (94 DEG C of 30s, 61.8 DEG C of 30s, 72 DEG C of 90s) X 35 circulation, 72 DEG C of 10min

PCR primer is carried out agarose gel electrophoresis detection, detect errorless after, use Thermo GeneJET Gel Extraction and DNA Cleanup Micro Kit reclaims PCR primer.

AnEp8 plasmid is given by U.S.'s FGSC Culture Collection, and the disclosure of AnEp8 plasmid is shown in document 2:STORMS R, ZHENG Y, LI H, SILLAOTS S, MARTINEZ-PEREZ A, TSANG A. Plasmid vectors for protein production, gene expression and molecular manipulations in Aspergillus niger [J]. Plasmid, 2005, 53(3): 191-204.

Use the AnEp8 plasmid in document 2.AnEp8 plasmid sequence is as shown in SEQ ID NO.3.AnEp8 plasmid uses Shanghai raw Work plasmid extraction kit extracts, and AnEp8 plasmid and hygromycin B resistant gene PCR primer after purification are all used Fermentas Company Fastdigest series of restriction restriction endonuclease Nhe 1 and Asc 1 enzymes double zyme cutting, after agarose gel electrophoresis reclaims (using Thermo GeneJET Gel Extraction and DNA Cleanup Micro Kit to reclaim), with T4 DNA even Connecing enzyme (Fermentas Products), hygromycin B gene and AnEp8 plasmid are connected, above-mentioned enzyme action and attended operation are the strictest Carry out according to shop instruction.Convert escherichia coli, construction recombination plasmid Anep8-hygro the most again.Recombiant plasmid Anep8- Hygro Sanger sequencing sequence verification and double digestion checking errorless after, mass propgation escherichia coli, public with Qiagen The plasmid extraction kit (EndoFree Plasmid Maxi Kit) of department extracts recombiant plasmid and (grasps according to shop instruction Make).

Embodiment 2

1) geotrichum candidum is cultivated and spore is collected

In 15cm culture dish, prepare solid agar medium (YPD culture medium), at solid agar medium surface seeding in vain Mould CICC 32222, temperature 16 DEG C, under humidity 15-50%, cultivates 15, allows media surface cover with geotrichum candidum spore.

2) geotrichum candidum spore pretreatment

Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then be centrifuged, receive Collection spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer, micro- Sem observation, confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last that spore is resuspended When electroporation buffer, should control the volume of electroporation buffer well, keeping geotrichum candidum spore suspension miospore concentration is 10¹¹Individual/ ml。

Described electroporation buffer is by the HEPES of final concentration of 0.01mmol/L and the mannitol of final concentration of 0.5mmol/L Composition, the pH of electroporation buffer is 3.0.

3) HDEN method electric shock geotrichum candidum spore is used

The geotrichum candidum spore suspension of 6 μ l, and 0.1 μ g recombiant plasmid AnEp8-hygro is added in the hole of 96 porocyte culture plates, Mixing, obtains spore and plasmid mixture, container is placed in ice bath 15min on ice, then uses Etta Biotech X- Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and plasmid mixture by the electric shock head with matrix form electrode Portion, energising so that spore is internal with plasmid mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath more on ice 15min, then by spore and plasmid mixture sucking-off, obtains importing the geotrichum candidum spore of the dormancy of foreign DNA；

The present embodiment shock parameters is as follows: voltage 1V, pulsewidth 2000000ms, repeats 100 times, every minor tick 5ms.

4) confirmatory experiment

By spore and the plasmid mixture of above-mentioned sucking-off, it is coated on the YPD solid of HYG containing final concentration of 700 μ g/ml On agar culture medium flat board, in temperature 16 DEG C, cultivating under humidity 15-50%, until forming single bacterium colony, and carrying out colony counting, meter Calculate conversion ratio.

Same, while carrying out above-mentioned experimental procedure, need to prepare matched group (with embodiment 1).

After experimental group forms single bacterium colony, extract the DNA of experimental group list bacterium colony, according to this reality of method validation of embodiment 1 The positive colony executing example is successful transformant.

The present embodiment AnEp8-hygro plasmid volume is 12.4 kb, by 0.1 μ g plasmid (about 12.426 fmol matter Grain molecule), electric shock 6 × 10⁸The resting spore that individual geotrichum candidum is not sprouted, creates no less than 6000 positive transformants.

The construction method of the recombiant plasmid AnEp8-hygro of the present embodiment is with embodiment 1.

Embodiment 3

1) geotrichum candidum is cultivated and spore is collected

In 15cm culture dish, prepare solid agar medium (PDA culture medium), at solid agar medium surface seeding in vain Mould CICC 32222, temperature 40 DEG C, under humidity 60-85%, cultivates 3, allows media surface cover with geotrichum candidum spore.

2) geotrichum candidum spore pretreatment

Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then be centrifuged, receive Collection spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer, micro- Sem observation, confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last that spore is resuspended When electroporation buffer, should control the volume of electroporation buffer well, keeping geotrichum candidum spore suspension miospore concentration is 10⁴Individual/ ml。

Described electroporation buffer is by the HEPES of final concentration of 100mmol/L and the mannitol of final concentration of 5000mmol/L Composition, the pH of electroporation buffer is 7.0.

3) HDEN method electric shock geotrichum candidum spore is used

The geotrichum candidum spore suspension of 600000 μ l, and 10000 μ g recombiant plasmid are added in the hole of 96 porocyte culture plates AnEp8-hygro, mixing, obtain spore and plasmid mixture, container is placed in ice bath 10min on ice, then uses Etta Biotech X-Porator H1 electroporation carries out HDEN method electric shock, and the electric shock head with matrix form electrode is inserted spore and matter Inside grain mixture, energising so that spore is internal with plasmid mixture produces electric field, is placed in by Tissue Culture Plate after electric shock again Ice bath 10min on ice, then by spore and plasmid mixture sucking-off, obtains importing the geotrichum candidum spore of the dormancy of foreign DNA；

The present embodiment shock parameters is as follows: voltage 6000V, pulsewidth 2ms, is repeated 1 times, and is spaced 50000ms.

4) confirmatory experiment

By spore and the plasmid mixture of above-mentioned sucking-off, it is coated on the YPD solid of HYG containing final concentration of 700 μ g/ml On agar culture medium flat board, in temperature 40 DEG C, cultivating under humidity 60-85%, until forming single bacterium colony, and carrying out colony counting, meter Calculate conversion ratio.

The present embodiment AnEp8-hygro plasmid volume is 12.4 kb, with 10000 μ g plasmids (about 1242600 fmol Plasmid molecule), electric shock 6 × 10⁶The resting spore that individual geotrichum candidum is not sprouted, produces no less than 7000 positive transformants.

Embodiment 4

The present embodiment shock parameters is: voltage 30V, pulsewidth 1000000ms, shocks by electricity 50 times, is spaced 5000ms, other same embodiment 1, create no less than 6500 positive transformants.

Embodiment 5

The present embodiment shock parameters is: voltage 3000V, pulsewidth 100ms, shocks by electricity 5 times, interval 25000ms, the other the same as in Example 1, Create no less than 7200 positive transformants.

The mode by Exogenous DNA transfered geotrichum candidum resting spore that the present invention provides, can be at geotrichum candidum spore dormancy shape Import arbitrary plasmid under state, be not limited only to recombiant plasmid AnEp8-hygro.

SEQUENCE LISTING

<110>University of Fuzhou

<120>a kind of method that geotrichum candidum resting spore is converted foreign DNA

<130> 1

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 1026

<212> DNA

<213>artificial sequence

<400> 1

atgaaaaagc ctgaactcac cgcgacgtct gtcgagaagt ttctgatcga aaagttcgac 60

agcgtctccg acctgatgca gctctcggag ggcgaagaat ctcgtgcttt cagcttcgat 120

gtaggagggc gtggatatgt cctgcgggta aatagctgcg ccgatggttt ctacaaagat 180

cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt gcttgacatt 240

ggggaattca gcgagagcct gacctattgc atctcccgcc gtgcacaggg tgtcacgttg 300

caagacctgc ctgaaaccga actgcccgct gttctgcagc cggtcgcgga ggccatggat 360

gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg accgcaagga 420

atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat 480

cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag 540

ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc 600

tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg gagcgaggcg 660

atgttcgggg attcccaata cgaggtcgcc aacatcttct tctggaggcc gtggttggct 720

tgtatggagc agcagacgcg ctacttcgag cggaggcatc cggagcttgc aggatcgccg 780

cggctccggg cgtatatgct ccgcattggt cttgaccaac tctatcagag cttggttgac 840

ggcaatttcg atgatgcagc ttgggcgcag ggtcgatgcg acgcaatcgt ccgatccgga 900

gccgggactg tcgggcgtac acaaatcgcc cgcagaagcg cggccgtctg gaccgatggc 960

tgtgtagaag tactcgccga tagtggaaac cgacgcccca gcactcgtcc gagggcaaag 1020

gaatag 1026

<210> 2

<211> 341

<212> PRT

<213>artificial sequence

<400> 2

Met Lys Lys Pro Glu Leu Thr Ala Thr Ser Val Glu Lys Phe Leu Ile

1 5 10 15

Glu Lys Phe Asp Ser Val Ser Asp Leu Met Gln Leu Ser Glu Gly Glu

20 25 30

Glu Ser Arg Ala Phe Ser Phe Asp Val Gly Gly Arg Gly Tyr Val Leu

35 40 45

Arg Val Asn Ser Cys Ala Asp Gly Phe Tyr Lys Asp Arg Tyr Val Tyr

50 55 60

Arg His Phe Ala Ser Ala Ala Leu Pro Ile Pro Glu Val Leu Asp Ile

65 70 75 80

Gly Glu Phe Ser Glu Ser Leu Thr Tyr Cys Ile Ser Arg Arg Ala Gln

85 90 95

Gly Val Thr Leu Gln Asp Leu Pro Glu Thr Glu Leu Pro Ala Val Leu

100 105 110

Gln Pro Val Ala Glu Ala Met Asp Ala Ile Ala Ala Ala Asp Leu Ser

115 120 125

Gln Thr Ser Gly Phe Gly Pro Phe Gly Pro Gln Gly Ile Gly Gln Tyr

130 135 140

Thr Thr Trp Arg Asp Phe Ile Cys Ala Ile Ala Asp Pro His Val Tyr

145 150 155 160

His Trp Gln Thr Val Met Asp Asp Thr Val Ser Ala Ser Val Ala Gln

165 170 175

Ala Leu Asp Glu Leu Met Leu Trp Ala Glu Asp Cys Pro Glu Val Arg

180 185 190

His Leu Val His Ala Asp Phe Gly Ser Asn Asn Val Leu Thr Asp Asn

195 200 205

Gly Arg Ile Thr Ala Val Ile Asp Trp Ser Glu Ala Met Phe Gly Asp

210 215 220

Ser Gln Tyr Glu Val Ala Asn Ile Phe Phe Trp Arg Pro Trp Leu Ala

225 230 235 240

Cys Met Glu Gln Gln Thr Arg Tyr Phe Glu Arg Arg His Pro Glu Leu

245 250 255

Ala Gly Ser Pro Arg Leu Arg Ala Tyr Met Leu Arg Ile Gly Leu Asp

260 265 270

Gln Leu Tyr Gln Ser Leu Val Asp Gly Asn Phe Asp Asp Ala Ala Trp

275 280 285

Ala Gln Gly Arg Cys Asp Ala Ile Val Arg Ser Gly Ala Gly Thr Val

290 295 300

Gly Arg Thr Gln Ile Ala Arg Arg Ser Ala Ala Val Trp Thr Asp Gly

305 310 315 320

Cys Val Glu Val Leu Ala Asp Ser Gly Asn Arg Arg Pro Ser Thr Arg

325 330 335

Pro Arg Ala Lys Glu

340

<210> 3

<211> 6638

<212> DNA

<213>artificial sequence

<400> 3

atgtcttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 60

gctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct 120

ttcgtctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga 180

cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag 240

cgggtgttgg cgggtgtcgg ggctggctta actatgcggc atcagagcag attgtactga 300

gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca 360

ggcgccattc gccattcagg ctgcgcaact gttgggaagg gcgatcggtg cgggcctctt 420

cgctattacg ccagctggcg aaagggggat gtgctgcaag gcgattaagt tgggtaacgc 480

cagggttttc ccagtcacga cgttgtaaaa cgacggccag tgccaagctt gcatgcctgc 540

aggtccgcga atattccgga gatcctgatc atccgtgaga atgaagagga agttgggttt 600

gcgtgcagag accgatggct cctcatccag cagtacctgc tgctgcacag cgagggcatc 660

gcatcccacg aatagggcca acaaagccgg caagaacatc atgatgggag cgacaattcc 720

gtatcaatct cccttgcacg atgttggttg tcactcaccg acactccgtc accaagatca 780

ctattaaaac aagagtgagt tcaaggttgc gatcaagata gcgattgcgc agcaacggca 840

cgggataacg ccatagctct gatggagccg atcagaccag taggtaaact agtcagtcag 900

cgttggactg gagctgcaga gagagttgaa cctggacgcc gcgcaaaaag caaagacgcg 960

cctcgtgggc ggtggatcaa tgatcggatt tagtggcaga tggcatcaca ggcggccaat 1020

gaccaccggg ccaactggcc ccgacattcc agcaatactg cctaattgac tccaccatgc 1080

atctcggcta ttattgaact gggtttgatg gatggggacc ctcttggaat tgtcaaagat 1140

tttgaagcga agacgatcta ttggacggta gagatatact cttgatttag tcgttgggag 1200

gcccctgggg aaagcaatga tggggaatgt tgctgctcca ctgtggacct cggctatgga 1260

attacgtgct tggatctaag atgagctcat ggctatgcat tgaatgacag tgatatcagc 1320

agagcaagca gagaaggatg gaatgctaat tttctagtgc tttgtgcaag ggtaaatcag 1380

ggactgtctg tctggtcttc tacacgaagg gaagaccatg gctttcacgg tgtctgtatt 1440

tccggatatc ctcaattccg tcggtcgatt acaatcacat gacttggctt ccatttcact 1500

actattatgc acacccacta catacatgat catataacca attgccctca tccccatcct 1560

ttaactatag cgaaatggat tgattgtcta ccgccaggtg tcagtcaccg tcgcggtcgg 1620

gccggccggc gcgccgttta aacttaatta agctagctga ttgatctcta ctgaaccggg 1680

ggggaagaca gaagagaagg gattgatgaa gatgggagaa agaatggagg gagagaaggg 1740

aggagaagag ggagagataa tagggaagga aaagacgggg ccggtgagcg agagaagaga 1800

gagatggtgg actagaggag gggtgcccgg gaaggaaaaa tgttggcggc ggtgattggc 1860

tggatcggcc ctttttggtg ggattcctgc tttgggacgc ttttttctgt cggtcggttc 1920

cccgcgggtt gagagctggc ttgttagttg tgcctccagc tacggagtag ttacaatcac 1980

acttcccatc gcctacataa ttcccattat taatgacttt ttctcccccc cggcactatc 2040

gctgggtatc aaaactcaat tatttgctgg gtgatccacc tttcactgct ttgctactat 2100

tctttgatcg tagatacacc tgctgcctcc gtccgctctt ttcactggtc agccaagggt 2160

ttccgcccag cgatcagcag catttgtcca ctacatcctc aggcaccttc cctccgcgca 2220

tctcaggcat tcatacgccg catgcaataa taattggttg ggaagaccaa aagcaattca 2280

cgcccaagcc acaatcagac acccacacaa cattctgcga agtatctggc aggaccacat 2340

gataccctct cactctgtcc agttgacccc acatcgtcgc ggatccattc tctcctagcg 2400

aggtggattt ggatgctttg tcggtgctga attttctcct cgcaaaaaag cccaatgccc 2460

ttcgcaagaa ctatttccct gactccatcg gaacccataa ggctgaattt tgctctgctc 2520

ggacggaccc agttgccagt tatggagaag ctgtctccct ttttattttt attttatttt 2580

atttttttgt ccagtgggta attaatcata gtaatgagga cgagactctg gccagtagac 2640

agggacccta agtaagtact cggaggtttt ctcttccatt tacgcgtggt atatgccctt 2700

cattaatatg gctagtacta ttatgatccc catatatcct tttccgaggc cagacacgtc 2760

catcattcat ctcataaggc taagttcctg accgtccgga cccctccgcc aatggcatca 2820

gatgtgggac gtcccctttt agtcaatacc gttacacatt tccactcaca ctcaaagtcc 2880

aactcttttc tcgtaagctt tccagccttc ctcccggtac ctctgaaccg cctcgactgg 2940

atcgtccgcc ttatagatgc ccctacccgc aatgataaag tccgcacctc gcccaaccgc 3000

cgacccaggt gtctgatact gctgccccag cttatccccc ttatccgaca gattcacccc 3060

agtcgtaaag acgacaaaat cctcgctctc ctctttctgt tcgggcagca cctcactcaa 3120

cgcccttgta ctcacgaatc ccatcacaaa ccccttatac ttccgcgcgt actcaaccga 3180

gcgtgccgtg tactcccctg tcgcaagaga tcccttactc gtcatctcgg caagaatcag 3240

gagacctcgt tgattcgcgt ctttaaagtc aggagacttg gttgtctgtg cgagggcctc 3300

gacgatccct tcgcccggca ggatggcgca gttgatgatg tgtgcccatt cggagatgcg 3360

gagagcgcca ccgtggtact gcttttgcac ggtgttgccg atgtcgatga acttgcggtc 3420

ctcaaagatg aggaagttgt gctttgtcgc gagggattgg agcgaggaaa gggtcgacgg 3480

ggtgagatcg gtgaggatgt cgatgtgggt tttcagaact gcgatatagg ggcctaggcc 3540

tgtactcact acgcatcagc tatttgttat cctggagggg cattggtgca ggatgtacgg 3600

tcagcaagat cgaggagctc ggcggaagta gtaacgtctg cggagacggt gacgttggtt 3660

ttcttctcct cggcgatgga gaagagttta gatgttaaag ggttgggatg gttggttgcg 3720

cgaattgcgt aggggaggtg ggacttcgaa gacatgatgg cggttctcca atgattgaat 3780

tgggctggat taaactgaca atttgaagct ggaagtggga tggctgtata acgaaaactc 3840

accccgctgc ggtggaattt ttgctccggc ccgataagat aggcgcagac ctatctccac 3900

tatcacgaat ataggtcacg aacccgacta tcattcaaac agaccacatt ttatcaactc 3960

tcccctctgt gctaagatgt cgactacatt tacatcaaat cctttgcaac accaaatgcg 4020

ctcaatcccc aaagacccgc ttgcgcaagc aagtacagcg aaccattgta cctgccggtg 4080

ccgttcggct tgtcgctata aatatagccc agcatgtaga gggtgcggag aacaacccag 4140

gccgctccta agcccgctgc tgcctctggg tacttgacgc ctgccaccag gatagagagc 4200

attgtctgcg gcgcgttctc gaggaagttg cgcggccgca agcttatttt ttgtatactg 4260

ttttgtgata gcacgaagtt tttccacggt atcttgttaa aaatatatat ttgtggcggg 4320

cttacctaca tcaaattaat aagagactaa ttataaacta aacacacaag caagctactt 4380

tagggtaaaa gtttataaat gcttttgacg tataaacgtt gcttgtattt attattacaa 4440

ttaaaggtgg atagaaaacc tagagactag ttagaaacta atctcaggtt tgcgttaaac 4500

taaatcagag cccgagaggt taacagaacc tagaagggga ctagatatcc gggtagggaa 4560

acaaaaaaaa aaaacaagac agccacatat tagggagact agttagaagc tagttccagg 4620

actaggaaaa taaaagacaa tgataccaca gtctagttga caactagata gattctagat 4680

tgaggccaaa gtctctgaga tccaggttag ttgcaactaa tactagttag tatctagtct 4740

cctataactc tgaagctaga ataacttact actattatcc tcaccactgt tcagctgcgc 4800

aaacggagtg attgcaaggt gttcagagac tagttattga ctagtcagtg actagcaata 4860

actaacaagg tattaaccta ccatgtctgc catcaccctg cacttcctcg ggctcagcag 4920

ccttttcctc ctcattttca tgctcatttt ccttgtttaa gactgtgact agtcaaagac 4980

tagtccagaa ccacaaagga gaaatgtctt accactttct tcattgcttg tctcttttgc 5040

attatccatg tctgcaacta gttagagtct agttagtgac tagtccgacg aggacttgct 5100

tgtctccgga ttgttggagg aactctccag ggcctcaaga tccacaacag agccttctag 5160

aagactggtc aataactagt tggtctttgt ctgagtctga cttacgaggt tgcatactcg 5220

ctccctttgc ctcgtcaatc gatgagaaaa agcgccaaaa ctcgcaatat ggctttgaac 5280

cacacggtgc tgagactagt tagaatctag tcccaaacta gcttggatag cttacctttg 5340

ccctttgcgt tgcgacaggt cttgcagggt atggttcctt tctcaccagc tgatttagct 5400

gccttgctac cctcacggcg gatctgcata aagagtggct agaggttata aattagcact 5460

gatcctaggt acggggctga atgtaacttg cctttccttt ctcatcgcgc ggcaagacag 5520

gcttgctcaa attcctacca gtcacagggg tatgcacggc gtacggacca cttgaactag 5580

tcacagatta gttagcaact agtctgcatt gaatggctgt acttacgggc cctcgccatt 5640

gtcctgatca tttccagctt caccctcgtt gctgcaaagt agttagtgac tagtcaagga 5700

ctagttgaaa tgggagaaga aactcacgaa ttctcgacac ccttagtatt gtggtccttg 5760

gacttggtgc tgctatatat tagctaatac actagttaga ctcacagaaa cttacgcagc 5820

tcgcttgcgc ttcttggtag gagtcggggt tgggagaaca gtgccttcaa acaagccttc 5880

ataccatgct acttgactag tcagggacta gtcaccaagt aatctagata ggacttgcct 5940

ttggcctcca tcagttcctt catagtggga ggtccattgt gcaatgtaaa ctccatgccg 6000

tgggagttct tgtccttcaa gtgcttgacc aatatgtttc tgttggcaga gggaacctgt 6060

caactagtta ataactagtc agaaactagt atagcagtag actcactgta cgcttgaggc 6120

atcccttcac tcggcagtag acttcatatg gatggatatc aggcacgcca ttgtcgtcct 6180

gtggactagt cagtaactag gcttaaagct agtcgggtcg gcttactatc ttgaaatccg 6240

gcagcgtaag ctccccgtcc ttaactgcct cgagatagtg acagtactct ggggactttc 6300

ggagatcgtt atcgcgaatg ctcggcatac taatcgttga ctagtcttgg actagtcccg 6360

agcaaaaagg attggaggag gaggaggaag gtgagagtga gacaaagagc gaaataagag 6420

cttcaaaggc tatctctaag cagtatgaag gttaagtatc tagttcttga ctagatttaa 6480

aagagatttc gactagttat gtacctggag tttggatata ggaatgtgtt gtggtaacga 6540

aatgtaaggg ggaggaaaga aaaagtcggt caagaggtaa ctctaagtcg gccattcctt 6600

tttgggaggc gctaaccata aacggcatgg cggcatgg 6638

Claims

1. the method that geotrichum candidum resting spore is converted foreign DNA, it is characterised in that: said method comprising the steps of:

1) geotrichum candidum is cultivated and spore is collected

2) geotrichum candidum spore pretreatment

With the resuspended spore of electroporation buffer, centrifugal and collect spore precipitation, after repeating above-mentioned resuspended and centrifugation step 3-4 time, general The spore precipitation finally collected is resuspended in electroporation buffer, and obtaining spore concentration is 10⁴-10¹¹The geotrichum candidum spore of individual/ml hangs Liquid；

Described electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid of final concentration of 0.01-100mmol/L and final concentration of 0.5- The mannitol composition of 5000mmol/L, the pH of electroporation buffer is 3.0-9.5；

3) HDEN method electric shock geotrichum candidum spore is used

Described shock parameters is as follows: voltage 1-6000V, and pulsewidth 2-2000000ms repeats 1-100 time, every minor tick 5- 50000ms。

A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute The culture medium stating step 1) is PDA culture medium, YPD culture medium or Czapek's medium.

A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute State step 1) condition of culture of geotrichum candidum is: temperature 16-40 DEG C, humidity 15-85%, cultivates 3-15 day.

A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 3, it is characterised in that: institute Stating step 1), the condition of culture of geotrichum candidum is: temperature 28 DEG C, humidity 50-60%, cultivates 7.

A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute State step 2), electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid of final concentration of 1mmol/L and final concentration of 50mmol/L Mannitol forms, and the pH of electroporation buffer is 7.0.

A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute State step 2) geotrichum candidum spore suspension before electric shock, in basis of microscopic observation, confirm spore suspension mixes dirt without mycelium Dye and spore are not all sprouted, and shock by electricity the most again.

A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute Stating step 3), plasmid to be transformed is recombiant plasmid AnEp8-hygro, and described recombiant plasmid AnEp8-hygro is by Hygromycin B resistant Gene and AnEp8 plasmid construction form.

A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 7, it is characterised in that: institute Stating step 3), geotrichum candidum suspension with the ratio of recombiant plasmid AnEp8-hygro is: the geotrichum candidum spore suspension of 60 μ l: the weight of 1 μ g Group plasmid AnEp8-hygro.

A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute Stating step 3), shock parameters is as follows: voltage 520V, pulsewidth 2000ms, is repeated 4 times, every minor tick 300ms.

A kind of method that geotrichum candidum resting spore is converted foreign DNA the most according to claim 1, it is characterised in that: institute State step 3), also include processing as follows: by spore and plasmid mixture sucking-off, be coated on the tide containing final concentration of 700 μ g/ml On the YPD solid agar medium flat board of mycin B, cultivate at temperature 16-40 DEG C, humidity 15-85%, until forming single bacterium colony, And carry out colony counting.