CN106381305A

CN106381305A - Method for converting exogenous ssRNA (single-stranded Ribonucleic Acid) to rhizopus oryzae hypnospores and expressing protein

Info

Publication number: CN106381305A
Application number: CN201610812886.9A
Authority: CN
Inventors: 林峻
Original assignee: Fuzhou University
Current assignee: Fuzhou University
Priority date: 2016-09-09
Filing date: 2016-09-09
Publication date: 2017-02-08

Abstract

The invention discloses a method for converting an exogenous ssRNA (single-stranded Ribonucleic Acid) to rhizopus oryzae hypnospores and expressing protein. The method comprises three steps: culturing rhizopus oryzae and collecting spores, pre-processing rhizopus oryzae spores, and carrying out electric shock on the rhizopus oryzae spores by using an HDEN method. According to the method disclosed by the invention, a step of fungal spore germination is omitted, in-vitro ssRNA protein is transferred to pass through cytoderm and cytomembrane by adopting an HDEN electroporation technology, and the protein is expressed in the rhizopus oryzae hypnospores. According to the method disclosed by the invention, the steps are simple and fast, the effects are extremely good, and the conversion rate is up to 90 percent or above.

Description

Conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method

Technical field

The invention belongs to biological technical field is and in particular to conversion external source ssRNA and is expressed in Rhizopus oryzae resting spore Method of protein.

Background technology

The central dogma of molecular biology refers to that hereditary information passes to RNA from DNA, then passes to protein from RNA, that is, Complete the process of the transcription and translation of hereditary information.In modern genetic engineering, it is frequently used host to express foreign protein, commonly use Way be exactly to build plasmid vector, the DNA sequences encoding of foreign protein is placed on after a strong promoter, import host thin After born of the same parents, DNA sequences encoding is transcribed into mRNA sequence (single stranded RNA), and mRNA sequence is expressed as by intracellular machine translator again Protein molecule, completes the overall process of exogenous protein expression.

DNA, either as the plasmid being free on outside host genome, is also inserted among host genome, may be used Stably to replicate itself, and pass to filial generation.That is, the information of DNA can heredity.Meanwhile, DNA can be continually Transcribe out nascent RNA, and translate into protein.

RNA forms long chain molecule by ribonucleotide through phosphodiester bond condensation.One ribonucleic acid molecule is by phosphorus Acid, ribose and base are constituted.The base of RNA mainly has 4 kinds, and that is, (urine is phonetic for A (adenine), G (guanine), C (cytosine), U Pyridine)., as single chain molecule, compared with the DNA of duplex structure, RNA is very unstable, and the half-life is very short for RNA, and in nature, RNase is widely present, and RNA is very easy to be degraded.RNA has following well-known feature：It is free in cytoplasmic RNA not Can heredity；The RNA half-life very short it is impossible to long-term existence；RNA will not be inserted in the genomic DNA of host.

Due to half-life short, therefore, a RNA molecule is present in intracellular duration, also very of short duration, and this RNA can only be In this of short duration time, interact with ribosome, marking protein molecule.And the protein molecule being expressed, There is the life-span, a protein molecule exists in the cell how long it is also possible to be weighed with half-life index.

In traditional technique for gene engineering, if will commonly use in the protein of a host cell internal representations external source Way be that the encoding gene of protein is built on DNA vector, DNA vector is proceeded to inside host cell, DNA vector source The RNA of coded protein is constantly transcribed out in source, and RNA constantly translates destination protein it is achieved that protein expression in the cell.

If not by DNA vector, preparing the single strand RNA molecule of encoding proteins in vitro, only coded protein External source single stranded RNA imports to inside host cell, as long as intracellular do not have corresponding DNA continuously to transcribe out new being somebody's turn to do RNA, then, this RNA and the protein molecule that goes out expressed by it, can only exist in specific time window.In other words, this RNA and the protein molecule going out expressed by it, can only exist some time period in cell life cycle.

Therefore, this characteristic play the role of critically important, can be in specific time cycle window, certain egg of transient expression White or RNA, it is possible to achieve marking protein and do not affect or the normal physiological cycle of impact cell and heredity less as far as possible Information.Such as：Exogenous RNA can be proceeded in certain timing node of cell activities, express certain cytokine, regulation and control The life cycle of cell；The instrument pheron of the Genome Editing such as TALENs, ZFNs and CRISPR/Cas9 can be divided Son, is expressed in host cell with external source single stranded RNA, it is to avoid using plasmid or other DNA form carrier when, by DNA sequence Row introduce cell interior, and cause potential foreign DNA to interact (such as homologous recombination) with host chromosome, affect cell Heredity, etc..This characteristic, in genetic engineering field, has important value.

In mammalian cell experiment, there is precedent, external source single stranded RNA directly can have been proceeded to mammalian cell In.Main method includes：1, using the chemical method of the reagent such as Lipo, the chemical reagent such as Lipo can be with mammalian cell Cell membrane interact, exogenous RNA is imported cell interior.2, traditional electrotransformation, such as square wave electric shock, this is A kind of with electric pulse of short duration act on contact exogenous RNA mammalian cell, make exogenous RNA enter cell.

Rhizopus oryzae is one of important mycete in middle traditional Chinese medicines and distillers yeast.Also common on soil, air and other materials.It Energy starch saccharification, conversion sucrose, produce lactic acid, fumaric acid and micro ethanol.Produce L (+) lactic acid ability is strong, reaches 70% left Right.In order to it is carried out with genetic engineering exploitation, need in its cell inner expression foreign protein, but do not sprout spore in this funguses In son, marking protein is extremely difficult.

Fungal spore is the main organ of multiplication of funguses, and spore is in resting state and can survive for a long time.Spore exists Under suitable external condition, can revive and sprout, form mycelia and carry out schizogamy.Most importantly, a lot of types The spore of funguses, is natural monoploid, and spore is the good starting biomaterial of genetic engineering field.

But, because spore is typically in resting state, its cell wall is very abundant, the cell wall of resting spore, cell The state of film, is different from sprouting spore and mycelium.And the intracellular vital movement of resting spore be also at least vigorous State, therefore, it is known in the art that the cell permeability of resting spore is not so good as to sprout spore and mycelia, resting spore is hardly Exchange material with the external world, of seclusion, it is typically in sleep state.And sprout spore or mycelium, need to absorb respectively from extraneous Plant nutrient molecule supply vital movement, therefore cell wall and membrane passage is more than resting spore.So it is very difficult to will Exogenous RNA molecule is importing directly into the inside of sleep spore.Also any method is not yet had can to accomplish directly exogenous RNA at present Molecule, in the case of the mediation of no medium, imports inside (sprouting) fungal spore of dormancy.This is also that one's own profession does not have in the industry always There is the technical barrier captured.

Not yet there is report external source single stranded RNA being imported Rhizopus oryzae cell interior at present, more exogenous RNA is not imported rice The report of rhizopus spore (either sprouting spore, still do not sprout spore).Use technique for gene engineering at present in Rhizopus oryzae cell The method of interior express express target protein matter is it is still desirable to by DNA vector, and generally requires ripe mycelial former using Rhizopus oryzae Raw plastid is as host cell, or by Agrobacterium as medium, enters host cell with DNA vector passenger gene information.

Additionally, the exogenous RNA of coded protein is imported after not sprouting spore inside in addition it is also necessary to be turned over the albumen within spore The various cytokine such as translation factor, enzyme system interact, and just can translate protein molecule.It is well known that, spore of sleeping Vital movement be in least vigorous state, the vigor of the intracellular various protein translation factors and enzyme system is very low, various The quantity of the factor and enzyme system molecule is also little, even if exogenous RNA enter do not sprout spore internal it is also desirable to long Interaction time, just can translate destination protein.And time length it is meant that exogenous RNA in the cell, by endogenous cellular The probability of RNase degraded increases, and therefore it is desirable to the exogenous RNA of enough quantity will be had, can enter and not sprout in spore Portion.

How to allow the spore germination of funguses, there has been ready-made technical scheme this area, but no matter which kind of germination method, It is required for elapsed time, energy, artificial operation and chemical reagent.The fungal spore of useful sprouting in the industry, imports external source The case of DNA, therefore, according to this area rationale it is considered that, imported outer with the higher sprouting spore of cell permeability The success rate of source molecule (RNA of such as external source) is bigger, because the spore sprouted has been revived, the intracellular various factors and enzyme system Given full play to active, cell will absorb nutrient, intraor extracellular material exchange enliven.Unfortunately, it is at present Only, not yet useful spore (either sprout and still do not sprout) imports the precedent of external source coding RNA.It is, however, obvious that with not The spore sprouted is used as importing the parent material of exogenous molecules, very easy, does spore germination this is multiple because can save Miscellaneous step it is often more important that, the spore of sprouting, polyploid may have been created, and the spore do not sprouted is it is ensured that be Monoploid, much engineered applications, it is desirable to host cell must be monoploid, can be only achieved result or the effect of anticipation Rate.Therefore the present invention attempts the step for bypass fungus spore germination, directly uses the spore of dormancy, to import exogenous RNA.

Additionally, it is well known that funguses can produce substantial amounts of RNase, and can these RNase of external secretion in a large number, funguses are One of main source of nature RNase.From thalline, when gathering fungal spore, spore can carry thalline for fungal spore collection The substantial amounts of exogenous rna enzyme of secretion, and be difficult in the case of not killing spore, RNase thoroughly cleaning totally (if Do thoroughly cleaning using compounds such as DEPC, fungal spore will certainly be killed).And spore itself also can produce and external secretion Some RNase.Therefore, convert fungal cell using external source single stranded RNA, extremely difficult, it is tantamount to suicidally attack, single-stranded RNA also will be degraded by RNase not in contact with to fungal cell.

In sum, by the RNA molecule of coded protein, be introduced directly into funguses (either mycelium or spore, no matter It is the spore or the spore do not sprouted sprouted) internal, it is the technical barrier that one's own profession is never captured in the industry.

Electroporated (Electroporation) is that a kind of of short duration the acting on of electric pulse contacts the thin of exogenous nucleic acid Born of the same parents, make the method that exogenous nucleic acid enters cell.Electroporated method, again according to features, has many subdivisions.There is document report Road electric shocking method, DNA delivery enters the cell of some fungal species.But, DNA compared with the single stranded RNA of encoding proteins, In structure, on biochemistry and molecular biology attribute, all entirely different, they are with cell wall, the interaction of cell membrane Mode is also different, therefore allows them by the cell wall of funguses, cell membrane and enters the mechanism of cell interior, is also different 's., compared with single stranded RNA, DNA long half time is it is not easy to be degraded, highly stable for DNA molecular.For the method for DNA delivery, Cannot be directly used to deliver single stranded RNA, also there is no relevant report at present.

The electroporated technology of HDEN emerging for 2013, is a kind of characteristic being specifically designed for mammalian cell, and develops Electric transformation technology, its exploitation purpose is the efficiency in order to improve into mammalian cell transmission foreign DNA and medicine.This skill Art comprises 3 most contents, and one is applied to the electric wave form of cell sample, and two is the solution ring in electric shock for the cell sample Border, three be cell sample cultural method and electric shock before preprocess method.Because this technology is specific to mammalian cell Exploitation, therefore, above-mentioned 3 most contents, it is both for the characteristic of mammalian cell and design.

Existing document reports HDEN technology in HEK-293A, Hela, Neuro-2A, MCF-7, C2C12,3T3-L1, In the mammalian cells such as CHO, MDCK, HL-60, HUVEC, A375, U251, DNA delivery enters the application case of cell.At present Not yet there is the Case Report that this technology is applied in the species beyond mammalian cell.Therefore, HDEN electricity transformation technology can not Can apply to the species beyond mammalian cell, be also a unknown number.

Content of the invention

Present invention aims to background technology present situation, provide a kind of conversion external source ssRNA to Rhizopus oryzae dormancy spore In son and marking protein method, the step for the method bypasses fungus spore germination, using HDEN electricity transformation technology, by body Outer single-stranded encoding proteins RNA delivery passes through cell wall and cell membrane, marking protein in Rhizopus oryzae resting spore.

For achieving the above object, the present invention adopts the following technical scheme that：

A kind of conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, comprise the following steps：

1) Rhizopus oryzae culture and spore are collected

In solid agar medium surface seeding Rhizopus oryzae, cultivate and cover with Rhizopus oryzae spore to media surface, wash lower training The Rhizopus oryzae spore of foster primary surface, suctions out spore suspension and simultaneously filters removal mycelia, collect the filtrate containing spore, by filtrate from The heart, collects the resting spore of precipitation；

2) Rhizopus oryzae spore pretreatment

With the resuspended spore of electroporation buffer, it is centrifuged and collects spore precipitation, repeat above-mentioned resuspended and centrifugation step 3-4 time Afterwards, the last spore collected precipitation is resuspended in electroporation buffer, obtaining spore concentration is 10⁴—10¹¹The Rhizopus oryzae of individual/ml Spore suspension；

Described electroporation buffer is by the 4- hydroxyethyl piperazine ethanesulfonic acid (HEPES) and eventually of final concentration of 0.01-100mmol/L Concentration is the Mannitol composition of 0.5-5000mmol/L, and the pH of electroporation buffer is 3.0-9.5；

3) use HDEN method electric shock Rhizopus oryzae spore

Rhizopus oryzae spore suspension and RNA to be transformed that in the hole of Tissue Culture Plate, addition above-mentioned steps obtain, mix, Obtain spore and RNA mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then adopt Etta Biotech X- Porator H1 electroporation carries out HDEN method electric shock, by the electric shock head insertion spore and RNA mixture with matrix form electrode Portion, Tissue Culture Plate, so that producing electric field inside spore and RNA mixture, is placed in ice bath 10- on ice after electric shock by energising again Then spore and RNA mixture are suctioned out by 15min, obtain importing the Rhizopus oryzae spore of the dormancy of external source ssRNA；

The ratio of described Rhizopus oryzae suspension and RNA to be transformed is：The Rhizopus oryzae spore suspension of 0.6-60000 μ l：0.1- The RNA to be transformed of 10000 μ g；

Described shock parameters are as follows：Voltage 1 6000V, pulsewidth 2-2000000ms, repeats 1-100 time, every minor tick 5- 50000ms.

Further, described step 1) culture medium be PDA culture medium, YPD culture medium or Czapek's medium, preferably PDA The effect of culture medium preferably, produces spore the most most.

Described step 1) condition of culture of Rhizopus oryzae is：Temperature 16-40 DEG C, humidity 15-85%, cultivate 3-15 day.

Preferably, described step 1), the condition of culture of Rhizopus oryzae is：30 DEG C of temperature, humidity 50-60%, cultivate 5.

Further, described step 2), electroporation buffer is by the HEPES and final concentration of 50- of final concentration of 1-10mmol/L The Mannitol composition of 100mmol/L, the pH of electroporation buffer is 5.0-7.0；

Preferably, described step 2), electroporation buffer is by the HEPES and final concentration of 50mmol/ of final concentration of 1mmol/L The Mannitol composition of L, the pH of electroporation buffer is 7.0.

Described step 2) Rhizopus oryzae spore suspension before electric shock, in basis of microscopic observation, confirm aseptic in spore suspension Filament mixes pollution and spore is not all sprouted, and is then shocked by electricity again.

Further, described step 3), RNA to be transformed is the RNA of the single-stranded coded protein of external source, can be green fluorescence egg White coding RNA of coding RNA, the coding RNA of red fluorescent protein or yellow fluorescence protein etc..

The present invention expands green fluorescence protein gene or the PCR primer of yellow fluorescent protein gene is as follows：

F：5'AGATGACGTCGCTAGCATGGTGAGCAAGGGC 3'；(SEQ ID NO.1)

R：5'ACGCGTCGACTTACTTGTACAGCTCGT3'；(SEQ ID NO.2)

Wherein, near 5 ' the GCTAGC sequences held, for promoting this DNA to be transcribed into after RNA, translation initiation factor in primers F Son is combined with RNA, and this sequence is close to the start codon ATG of expressed genes of interest.

The PCR primer that the present invention expands red fluorescent protein gene is as follows：

Forward primer：RFP-F:5'CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3'；(SEQ ID NO.3)

Downstream primer：RFP-R:5'TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'；(SEQ ID NO.4)

Wherein, near 5 ' the GCCACC sequences held in primer RFP-F, for promoting this DNA to be transcribed into after RNA, translate The beginning factor is combined with RNA, and this sequence is close to the start codon ATG of expressed genes of interest.

Preferably, described step 3), the ratio of Rhizopus oryzae suspension and RNA to be transformed is：The Rhizopus oryzae spore suspension of 60 μ l： The RNA to be transformed of 10 μ g.

Further, described step 3), voltage 300-1000V, pulsewidth 1500-20000ms, repeats 1-50 time, every minor tick 500-5000ms；It is preferably：Voltage 450V, pulsewidth 2400ms, it is repeated 3 times, every minor tick 500ms.

Electric shock of the present invention adopts Etta Biotech X-Porator H1 electroporation, buys and reaches biology from Suzhou one Company.

The present invention collects the spore do not sprouted, and follow-up electricity turns experimentation, if no specified otherwise, experimental implementation is equal Not higher than 23 degrees Celsius of constant temperature laboratory operates, centrifugation step is 4 DEG C of frozen centrifugations, each of spore is not sprouted in contact Plant liquid all in advance in pre-cooling on ice.Do not sprout spore forbid to touch any containing the factor that it can be promoted to sprout and material (germination medium such as with YEPD etc. as representative), to ensure the resting state of spore.

Rhizopus oryzae incubation of the present invention, after Rhizopus oryzae surface covers with spore, pours sterilized water into media surface, washes The Rhizopus oryzae spore of lower media surface, suctions out spore suspension with pipettor, using sterilized lens paper (or core leakage Bucket, filter paper etc.) filter, remove mycelia, retain spore, without filtration step, then mycelia can be contaminated with spore suspension, Actually the transformant that subsequent step obtains is it is impossible to judge to convert, by spore, the positive colony being formed after DNA, or mycelia conversion The false positive being formed after DNA.The spore obtaining also uses chromosome dyeing method to its chromosome dyeing, and observes and confirm spore Interior chromosome is haploid state.

The water that the present invention prepares solid agar medium should be the molecular biology high purity water of MillQ rank or double steaming Water, resistivity of water is not less than 18.2M Ω-cm.

During using HDEN method electric shock Rhizopus oryzae spore, the hole of Tissue Culture Plate adds the Rhizopus oryzae spore of proper proportion Suspension and RNA to be transformed, mixing is even, container is placed in and carries out ice bath on ice.For example in the hole of 96 porocyte culture plates (Nunclon Surface 96 porocyte culture plates of NUNC company, article No. Cat.No.167008), adds the Rhizopus oryzae of 60 μ l Spore suspension, and the RNA no less than 10 μ g.Described Tissue Culture Plate can also be 384 orifice plates, 24 orifice plates, 6 orifice plates or Other bigger, less containers, then according to container volume size, zoom in or out spore and RNA mixture system.

The present invention adopts above technical scheme, is used as importing the parent material of exogenous molecules with the spore do not sprouted, non- Often easy because can save do this complicated step of spore germination it is often more important that, the spore of sprouting, may produce Give birth to polyploid, and the spore do not sprouted has been it is ensured that be monoploid, much engineered application is it is desirable to host cell must Must be monoploid, can be only achieved result or the efficiency of anticipation.Meanwhile, present invention application HDEN electricity transformation technology is by exogenous RNA Import Rhizopus oryzae resting spore.HDEN electricity transformation technology employs high-density matrix formula electrode, and it can produce high uniformity and strong The condition spending each cell acceptance electric shock in enough electric fields, electric field is almost completely the same, during operation, as long as cell is placed on logical With in container, such as Tissue Culture Plate, then in the electric shock head insertion container with matrix form electrode, be energized.And it is traditional Electricity to turn technology be usually to use special electric shock cup, place cell between two pieces of metallic plates being placed in parallel, and to metallic plate Power up, form electric field electric shock.Therefore, the discharge mode of the two is entirely different, inside the former electrode insertion cell suspension, including Portion produces electric field, and the latter is in the overall outside generation electric field of cell suspension；The former electrode tip is made up of many metal needles, Produce voltage between pin and pin, and the latter only has two pieces of metallic plates, one piece of positive pole, one piece of negative pole, produces electricity between Pressure.HDEN technology also essentially eliminates the cathode effect of traditional electric shock technology, it is to avoid produce a large amount of hydroxide ions, it is to avoid kill Cell, improves the cell survival rate after electric shock.And traditional electric shock technology very difficult elimination cathode effect.The HDEN method of the present invention, electricity Hit repeatedly, the effect of multiple electric shock can be superimposed, and cell mortality will not be significantly increased, and traditional electric-shocking method is general Only electric shock 1 time, if because traditional electric-shocking method electric shock repeatedly, can lead to cell mortality to increase considerably.

HDEN electricity transformation technology is a kind of characteristic being specifically designed for mammalian cell and opens electricity transformation technology, it is opened Send out the efficiency that purpose is to improve transmission foreign DNA and medicine into mammalian cell.And in the art it is known that The characteristic of microbial cell and cultural method, compared with mammalian cell, vary.Mammalian cell and microorganism are thin The structure of born of the same parents is different, and mammalian cell does not have cell wall, and microbial cell (such as majority of fungal, inclusion Rhizopus oryzae) has Cell wall.The cell membrane of the cell membrane of mammalian cell and microorganism is also different.Even same biology, its difference Tissue, Different Organs or different cell types, respective cell membrane, the structure of cell wall, state, chemical composition, also not Equally.Even same biological same tissue, same organ, same cell type, in different growth promoter Stage, or in different external environments, respective cell membrane, the structure of cell wall, state, chemical composition, also all differ Sample.And cell wall and cell membrane, it is to stop that exogenous molecules enter the barrier of cell, barrier is different, and (structure is different, and chemical composition is not With), the method determining breakthrough barrier is also different.Additionally, different exogenous molecules, because there are different structures, dividing Son amount, volume and chemical composition, in the face of identical barrier when, the method that different exogenous molecules break through barriers is also different. If in the face of different barriers, then different exogenous molecules break through method and the mechanism of different barriers, even more vary.

Therefore, any technology being applied to mammalian cell, is all difficult to directly apply to microbial cell.At present not yet There is the Case Report that HDEN technology is applied in the species beyond mammalian cell.The present invention is directed to the spy of Rhizopus oryzae cell Property, external single-stranded encoding proteins RNA is imported by Rhizopus oryzae resting spore using HDEN technology, the method determines cell sample Cultural method and electric shock before preprocess method, the solution environmental in electric shock for the cell sample, and put on cell sample Electric wave form.

Additionally, RNA translates into protein, it is desirable to have regulating and controlling sequence is combined with translation initiation factor and mediating proteins translation Initial.Which type of regulating and controlling sequence can be a unknown number in funguses (Rhizopus oryzae of the such as present invention) intracellular use, There is no any document report mistake.Invention further discloses the present invention can be seen in 2 kinds of regulating and controlling sequences of Rhizopus oryzae intracellular use Embodiment part.

Using the inventive method it is achieved that first the RNA of coded protein is introduced directly into Rhizopus oryzae dormancy spore in history Son marking protein, and step is very easy to be quick, in addition, excellent, can obtain at least 90% conversion ratio.

Brief description

Below in conjunction with the drawings and specific embodiments, the present invention is further detailed explanation：

The electrophoresis detection result of the RNA product that Fig. 1 transcribes out for embodiment 1.

Specific embodiment

Below example is easy to be better understood from the present invention, but does not limit the present invention.

The all operations of experimentation are intended to follow sterile working's principle of Experiment on Microbiology, and vessel, consumptive material, reagent are intended to Sterilization treatment.

All restriction endonucleases used by the present invention are Fermentas company fastdigest series of restriction restriction endonuclease and produce Product, the T4DNA ligase that following examples are used is Fermentas Products, and enzyme action and connection and glue reclaim and DNA are pure Change operation, all operate according to product description.

Embodiment 1

Expressing green fluorescent protein (GFP) in Rhizopus oryzae cell：

First, plasmid construction

Using GFP gene coded sequence, GFP gene as shown in SEQ ID NO.5,

The protein sequence of above-mentioned GFP gene as shown in SEQ ID NO.6,

The PCR primer of amplification GFP gene：

F：AGAT GCTAGC GTGAGCAAGGGC wave is Aat II restriction enzyme site

R：ACGCTTACTTGTACAGCTCGT wave is Sal I restriction enzyme site

GCTAGC sequence with underscore in primers F, for promoting this DNA to be transcribed into after RNA, translation initiation factor with RNA combines, and this sequence is close to the start codon ATG of expressed genes of interest.With above-mentioned this, primer is after PCR, can To allow GCTAGC on GFP upstream region of gene band, upstream and downstream all brings restriction enzyme site.

After agarose gel electrophoresiies detection PCR primer is errorless, using Thermo GeneJET Gel Extraction and DNA Cleanup Micro Kit recovery purifying PCR primer.

By above-mentioned PCR primer Aat II and Sal I double digestion, with T4DNA ligase, it is connected to and also passes through Aat On the Promega company pGEM-T easy plasmid of II and Sal I double digestion, convert escherichia coli, select positive colony, use matter After universal sequencing primer thing sequence verification insertion sequence on grain is errorless, extract recombiant plasmid in a large number.Above-mentioned steps just can allow This GFP gene is located at the downstream of this plasmid vector T7promoter.

In vitro transcription

With the Fastdigest Nde1 restriction endonuclease of Fermentas company, single endonuclease digestion line is done to the recombiant plasmid of said extracted Property.Using Thermo Scientific TranscriptAid T7High Yield Transcription Kit, to upper State recombiant plasmid and do in vitro transcription, all operate to specifications.

The RNA product purification transcribed out

1) add the DEPC-H of 115 μ l in 20 μ l responsive transcription systems₂The 3M NaAc solution (pH 5.2) of O and 15 μ l, Mix；

2) add isopyknic phenol chloroform isoamyl alcohol mixture (phenol：Chloroform：Isoamyl alcohol=25:24:1), mix；

3) high speed centrifugation, makes lower leaf on liquid, takes upper strata aqueous phase to another 1.5ml centrifuge tube.

4) add 2 times of volume dehydrated alcohol in aqueous phase, be placed in -20 DEG C of at least 30min, high speed centrifugation, precipitate RNA, go Supernatant.

5) 70% ethanol of 1ml pre-cooling, high speed centrifugation 1min after gently overturning are added；

6) precipitation is resuspended in the DEPC-H of suitable volumes₂In O, RNA concentration is made to be not less than 10 μ g/ μ L；

Electrophoresis detection result is as shown in Figure 1：

Swimming lane 1：RiboRuler RNA Ladder, high range, ready-to-use；

Swimming lane 2：Positive control, 2222nt；

Swimming lane 3：The RNA of the GFP that in vitro transcription goes out ,～750nt

2nd, use above-mentioned green fluorescent protein coding RNA in Rhizopus oryzae resting spore expressing green fluorescent protein, step Suddenly as follows：

1) Rhizopus oryzae culture and spore are collected

In 15cm culture dish, prepare solid agar medium (PDA culture medium), in solid agar medium surface seeding Rhizopus oryzae CICC 3084,30 DEG C of temperature, humidity 50-60%, cultivate 5, allow media surface cover with Rhizopus oryzae spore.

Pour sterilized water to media surface into, wash down (concussion, or gently scratched with smooth sterile glass spreading rod) The Rhizopus oryzae spore of media surface, suctions out spore suspension with pipettor, using sterilized lens paper (or sand core funnel, Filter paper etc.) filter, remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after centrifugation, collects the resting spore of precipitation, Remove supernatant fluid.The spore obtaining also uses chromosome dyeing method to its chromosome dyeing, and observes and confirm in spore Chromosome is haploid state.

2) Rhizopus oryzae spore pretreatment

Precipitated (adding the volume of electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then from The heart, collects spore precipitation, removes supernatant fluid.Repeat the above steps twice after, again spore is resuspended in electroporation buffer, Micro- sem observation, confirms that in spore suspension, no mycelium mixes pollution, and confirms that spore is not all sprouted.For the last time by spore The volume of electroporation buffer when being resuspended in electroporation buffer, should be controlled, keep Rhizopus oryzae spore suspension miospore concentration to be 10⁸ Individual/ml.

Described electroporation buffer is made up of the Mannitol of the HEPES and final concentration of 50mmol/L of final concentration of 1mmol/L, The pH of electroporation buffer is 7.0.

3) use HDEN method electric shock Rhizopus oryzae spore

The Rhizopus oryzae spore suspension of 60 μ l, and the volume of 10 μ g green fluorescent proteins is added in the hole of 96 porocyte culture plates Code RNA, mixes, and obtains spore and RNA mixture, container is placed in ice bath 10min on ice, then adopts Etta Biotech X-Porator H1 electroporation carries out HDEN method electric shock, by the electric shock head insertion spore with matrix form electrode and RNA mixture Inside, Tissue Culture Plate, so that producing electric field inside spore and RNA mixture, is placed in ice bath on ice after electric shock by energising again Then spore and RNA mixture are suctioned out by 10min, obtain importing the Rhizopus oryzae spore of the dormancy of external source ssRNA；

The present embodiment shock parameters are as follows：Voltage 450V, pulsewidth 2400ms, it is repeated 3 times, every minor tick 500ms.

4) confirmatory experiment

It is added to the spore of above-mentioned sucking-off and RNA mixture in the YPD culture medium of 100 times of volumes, 30 DEG C of cultures 20 are little Shi Hou, uses confocal laser scanning microscope.

While carrying out above-mentioned experimental procedure, need to prepare matched group：By not shocking by electricity, identical, " spore and RNA mix Compound ", is added in another YPD culture medium, cultivates, then observed with laser confocal microscope under the same terms.

Result shows：The cell unstressed configuration of matched group, the cell of sample sets at least 95% has green fluorescence, shows have successfully RNA conversion.

Embodiment 2

Expression red fluorescent protein (RFP) in Rhizopus oryzae cell：

First, plasmid construction

The nucleotide sequence of RFP as shown in SEQ ID NO.7,

The protein sequence of RFP as shown in SEQ ID NO.8,

The primer of amplification RFP gene is as follows：

Forward primer：RFP-F:5'CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3'

Downstream primer：RFP-R:5'TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'

Forward primer 5 end carries EcoR I restriction enzyme site, with the GCCACC sequence of underscore, for promoting this DNA to transcribe After becoming RNA, translation initiation factor is combined with RNA, and this sequence is close to the start codon ATG of expressed genes of interest.

Downstream primer 5 end carries Sal I restriction enzyme site.

According to the way of embodiment 1, RFP gene is expanded by PCR, does molecular cloning, be connected to pGEM-T easy and carry On body, then do in vitro transcription, and gained RNA is converted host's spore.

2nd, the coding RNA of red fluorescent protein is used to express red fluorescent protein in Rhizopus oryzae resting spore, step is such as Under：

1) Rhizopus oryzae culture and spore are collected

In 15cm culture dish, prepare solid agar medium (YPD culture medium), in solid agar medium surface seeding Rhizopus oryzae CICC 3084, in 16 DEG C of temperature, under humidity 15-50%, cultivates 15, allows media surface cover with Rhizopus oryzae spore.

2) Rhizopus oryzae spore pretreatment

Precipitated (adding the volume of electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then from The heart, collects spore precipitation, removes supernatant fluid.Repeat the above steps twice after, again spore is resuspended in electroporation buffer, Micro- sem observation, confirms that in spore suspension, no mycelium mixes pollution, and confirms that spore is not all sprouted.For the last time by spore The volume of electroporation buffer when being resuspended in electroporation buffer, should be controlled, keep Rhizopus oryzae spore suspension miospore concentration to be 10¹¹ Individual/ml.

Described electroporation buffer by final concentration of 0.01mmol/L HEPES and final concentration of 0.5mmol/L Mannitol Composition, the pH of electroporation buffer is 3.0.

3) use HDEN method electric shock Rhizopus oryzae spore

The Rhizopus oryzae spore suspension of 0.6 μ l is added in the hole of 96 porocyte culture plates, and 0.1 μ g red fluorescent protein Coding RNA, mixes, and obtains spore and RNA mixture, container is placed in ice bath 15min on ice, then adopts Etta Biotech X-Porator H1 electroporation carries out HDEN method electric shock, by the electric shock head insertion spore with matrix form electrode and RNA mixture Inside, Tissue Culture Plate, so that producing electric field inside spore and RNA mixture, is placed in ice bath on ice after electric shock by energising again Then spore and RNA mixture are suctioned out by 15min, obtain importing the Rhizopus oryzae spore of the dormancy of external source ssRNA；

The present embodiment shock parameters are as follows：Voltage 1V, pulsewidth 2000000ms, repeats 100 times, every minor tick 5ms.

4) confirmatory experiment

It is added to the spore of above-mentioned sucking-off and RNA mixture in the YPD culture medium of 10 times of volumes, 10 DEG C of cultures 25 are little Shi Hou, uses confocal laser scanning microscope.

Result shows：The cell unstressed configuration of matched group, the cell of sample sets at least more than 90% has red fluorescence, shows have Successfully RNA conversion.

Embodiment 3

Expression yellow fluorescence protein (YFP) in Rhizopus oryzae cell：

First, plasmid construction

The nucleotide sequence of YFP as shown in SEQ ID NO.9,

The protein sequence of YFP as shown in SEQ ID NO.10,

Using with GFP identical primer in embodiment 1, and according to same experimental procedure and method, GFP gene is passed through PCR expands, and does molecular cloning, is connected on pGEM-T easy carrier, then does in vitro transcription, and gained RNA is converted host's spore Son.

2nd, the coding RNA of yellow fluorescence protein is used to express yellow fluorescence protein in Rhizopus oryzae resting spore, step is such as Under：

1) Rhizopus oryzae culture and spore are collected

In 15cm culture dish, prepare solid agar medium (PDA culture medium), in solid agar medium surface seeding Rhizopus oryzae CICC 3084, in 40 DEG C of temperature, under humidity 60-85%, cultivates 3, allows media surface cover with Rhizopus oryzae spore.

2) Rhizopus oryzae spore pretreatment

Precipitated (adding the volume of electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then from The heart, collects spore precipitation, removes supernatant fluid.Repeat the above steps twice after, again spore is resuspended in electroporation buffer, Micro- sem observation, confirms that in spore suspension, no mycelium mixes pollution, and confirms that spore is not all sprouted.For the last time by spore The volume of electroporation buffer when being resuspended in electroporation buffer, should be controlled, keep Rhizopus oryzae spore suspension miospore concentration to be 10⁴ Individual/ml.

Described electroporation buffer by final concentration of 100mmol/L HEPES and final concentration of 5000mmol/L Mannitol Composition, the pH of electroporation buffer is 7.0.

3) use HDEN method electric shock Rhizopus oryzae spore

The Rhizopus oryzae spore suspension of 60000 μ l is added in the hole of 96 porocyte culture plates, and 10000 μ g red fluorescence eggs White coding RNA, mixes, and obtains spore and RNA mixture, container is placed in ice bath 10min on ice, then adopts Etta Biotech X-Porator H1 electroporation carries out HDEN method electric shock, by with matrix form electrode electric shock head insertion spore with Inside RNA mixture, Tissue Culture Plate, so that producing electric field inside spore and RNA mixture, is placed in after electric shock by energising again Then spore and plasmid mixture are suctioned out by ice bath 10min on ice, obtain importing the Rhizopus oryzae spore of the dormancy of external source ssRNA；

The present embodiment shock parameters are as follows：Voltage 6000V, pulsewidth 2ms, it is repeated 1 times, be spaced 50000ms.

4) confirmatory experiment

It is added to the spore of above-mentioned sucking-off and RNA mixture in the YPD culture medium of 10 times of volumes, 40 DEG C of cultures 24 are little Shi Hou, uses confocal laser scanning microscope.

Result shows：The cell unstressed configuration of matched group, the cell of sample sets at least more than 90% has yellow fluorescence, shows have Successfully RNA conversion.

Embodiment 4

The present embodiment shock parameters are：Voltage 30V, pulsewidth 1000000ms, shock by electricity 50 times, be spaced 5000ms, other same real Apply example 1.

Embodiment 5

The present embodiment shock parameters are：Voltage 3000V, pulsewidth 100ms, shock by electricity 5 times, be spaced 25000ms, other same enforcements Example 1.

The protein that linear rna by coded protein of the present invention imports cell, expresses in the cell, Ke Yishi This cell, this species itself just can encode the protein that can express or the protein in other living species source, or It is the protein of engineer.

The RNA of the single-stranded coded protein of all of external source, can be converted with the method for the present invention, be not limited only to implement The coding RNA of the described green of example, redness or yellow fluorescence protein.

SEQUENCE LISTING

<110>University of Fuzhou

<120>Conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method

<130> 1

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 31

<212> DNA

<213>Artificial sequence

<400> 1

agatgacgtc gctagcatgg tgagcaaggg c 31

<210> 2

<211> 27

<212> DNA

<213>Artificial sequence

<400> 2

acgcgtcgac ttacttgtac agctcgt 27

<210> 3

<211> 34

<212> DNA

<213>Artificial sequence

<400> 3

cggaattcgc caccatggcc tcctccgagg acgt 34

<210> 4

<211> 28

<212> DNA

<213>Artificial sequence

<400> 4

tcgagctcgt taggcgccgg tggagtgg 28

<210> 5

<211> 720

<212> DNA

<213>Artificial sequence

<400> 5

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

<210> 6

<211> 239

<212> PRT

<213>Artificial sequence

<400> 6

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210> 7

<211> 678

<212> DNA

<213>Artificial sequence

<400> 7

atggcctcct ccgaggacgt catcaaggag ttcatgcgct tcaaggtgcg catggagggc 60

tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

acccagaccg ccaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180

ctgtcccctc agttccagta cggctccaag gcctacgtga agcaccccgc cgacatcccc 240

gactacttga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac 360

aaggtgaagc tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc 420

atgggctggg aggcctccac cgagcggatg taccccgagg acggcgccct gaagggcgag 480

atcaagatga ggctgaagct gaaggacggc ggccactacg acgccgaggt caagaccacc 540

tacatggcca agaagcccgt gcagctgccc ggcgcctaca agaccgacat caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggaacagt acgagcgcgc cgagggccgc 660

cactccaccg gcgcctaa 678

<210> 8

<211> 225

<212> PRT

<213>Artificial sequence

<400> 8

Met Ala Ser Ser Glu Asp Val Ile Lys Glu Phe Met Arg Phe Lys Val

1 5 10 15

Arg Met Glu Gly Ser Val Asn Gly His Glu Phe Glu Ile Glu Gly Glu

20 25 30

Gly Glu Gly Arg Pro Tyr Glu Gly Thr Gln Thr Ala Lys Leu Lys Val

35 40 45

Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile Leu Ser Pro Gln

50 55 60

Phe Gln Tyr Gly Ser Lys Ala Tyr Val Lys His Pro Ala Asp Ile Pro

65 70 75 80

Asp Tyr Leu Lys Leu Ser Phe Pro Glu Gly Phe Lys Trp Glu Arg Val

85 90 95

Met Asn Phe Glu Asp Gly Gly Val Val Thr Val Thr Gln Asp Ser Ser

100 105 110

Leu Gln Asp Gly Glu Phe Ile Tyr Lys Val Lys Leu Arg Gly Thr Asn

115 120 125

Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr Met Gly Trp Glu

130 135 140

Ala Ser Thr Glu Arg Met Tyr Pro Glu Asp Gly Ala Leu Lys Gly Glu

145 150 155 160

Ile Lys Met Arg Leu Lys Leu Lys Asp Gly Gly His Tyr Asp Ala Glu

165 170 175

Val Lys Thr Thr Tyr Met Ala Lys Lys Pro Val Gln Leu Pro Gly Ala

180 185 190

Tyr Lys Thr Asp Ile Lys Leu Asp Ile Thr Ser His Asn Glu Asp Tyr

195 200 205

Thr Ile Val Glu Gln Tyr Glu Arg Ala Glu Gly Arg His Ser Thr Gly

210 215 220

Ala

225

<210> 9

<211> 720

<212> DNA

<213>Artificial sequence

<400> 9

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccttcggcta cggcctgcag tgcttcgccc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagct accagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtga 720

<210> 10

<211> 239

<212> PRT

<213>Artificial sequence

<400> 10

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Phe Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys

225 230 235

Claims

1. conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method it is characterised in that：Methods described bag Include following steps：

1）Rhizopus oryzae culture and spore are collected

In solid agar medium surface seeding Rhizopus oryzae, cultivate and cover with Rhizopus oryzae spore to media surface, wash lower culture medium The Rhizopus oryzae spore on surface, suctions out spore suspension and filters removal mycelia, collect the filtrate containing spore, filtrate is centrifuged, receive The resting spore of collection precipitation；

2）Rhizopus oryzae spore pretreatment

With the resuspended spore of electroporation buffer, it is centrifuged and collects spore precipitation, after repeating above-mentioned resuspended and centrifugation step 3-4 time, general The spore precipitation finally collected is resuspended in electroporation buffer, and obtaining spore concentration is 10⁴-10¹¹The Rhizopus oryzae spore of individual/ml hangs Liquid；

Described electroporation buffer is by the 4- hydroxyethyl piperazine ethanesulfonic acid of final concentration of 0.01-100mmol/L and final concentration of 0.5- The Mannitol composition of 5000mmol/L, the pH of electroporation buffer is 3.0-9.5；

3）Using HDEN method electric shock Rhizopus oryzae spore

Rhizopus oryzae spore suspension and RNA to be transformed that in the hole of Tissue Culture Plate, addition above-mentioned steps obtain, mix, obtain Spore and RNA mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then adopts Etta Biotech X- Porator H1 electroporation carries out HDEN method electric shock, by the electric shock head insertion spore and RNA mixture with matrix form electrode Portion, Tissue Culture Plate, so that producing electric field inside spore and RNA mixture, is placed in ice bath 10- on ice after electric shock by energising again Then spore and RNA mixture are suctioned out by 15min, obtain importing the Rhizopus oryzae spore of the dormancy of external source ssRNA；

The ratio of described Rhizopus oryzae suspension and RNA to be transformed is：The Rhizopus oryzae spore suspension of 0.6-60000 μ l：0.1-10000μg RNA to be transformed；

Described shock parameters are as follows：Voltage 1-6000V, pulsewidth 2-2000000ms, repeats 1-100 time, every minor tick 5- 50000ms.

2. according to claim 1 conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, its It is characterised by：Described step 1）Culture medium be PDA culture medium, YPD culture medium or Czapek's medium.

3. according to claim 1 conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, its It is characterised by：Described step 1,）The condition of culture of Rhizopus oryzae is：Temperature 16-40 DEG C, humidity 15-85%, cultivate 3-15 day.

4. according to claim 1 conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, its It is characterised by：Described step 2）Rhizopus oryzae spore suspension before electric shock, in basis of microscopic observation, confirm aseptic in spore suspension Filament mixes pollution and spore is not all sprouted, and is then shocked by electricity again.

5. according to claim 1 conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, its It is characterised by：Described step 3）, RNA to be transformed be the single-stranded coded protein of external source RNA, this RNA can in host cell table Reach coded protein.

6. according to claim 5 conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, its It is characterised by：The RNA of the single-stranded coded protein of described external source is the coding RNA of green fluorescent protein, the volume of red fluorescent protein Code RNA or the coding RNA of yellow fluorescence protein.

7. according to claim 6 conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, its It is characterised by：Expand green fluorescence protein gene or yellow fluorescent protein gene using following PCR primer：

F：5' AGATGACGTCGCTAGCATGGTGAGCAAGGGC 3' ；

R：5' ACGCGTCGACTTACTTGTACAGCTCGT3'；

Near 5 ' the GCTAGC sequences held in primers F, for promoting this DNA to be transcribed into after RNA, translation initiation factor is tied with RNA Close, this sequence is close to the start codon ATG of expressed genes of interest.

8. according to claim 6 conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, its It is characterised by：Expand red fluorescent protein gene using following PCR primer：

Forward primer：RFP-F: 5' CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3' ；

Downstream primer：RFP-R: 5' TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3' ；

Near 5 ' the GCCACC sequences held in primer RFP-F, for promoting this DNA to be transcribed into after RNA, translation initiation factor with RNA combines, and this sequence is close to the start codon ATG of expressed genes of interest.

9. according to claim 6 conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, its It is characterised by：Described step 3）, the ratio of Rhizopus oryzae suspension and RNA to be transformed is：The Rhizopus oryzae spore suspension of 60 μ l：10 μ g's RNA to be transformed.

10. according to claim 1 conversion external source ssRNA in Rhizopus oryzae resting spore and marking protein method, It is characterized in that：Described step 3）, shock parameters are as follows：Voltage 450V, pulsewidth 2400ms, it is repeated 3 times, every minor tick 500ms.