CN106244631A - Use external source single stranded RNA method of marking protein in monascus resting spore - Google Patents
Use external source single stranded RNA method of marking protein in monascus resting spore Download PDFInfo
- Publication number
- CN106244631A CN106244631A CN201610813613.6A CN201610813613A CN106244631A CN 106244631 A CN106244631 A CN 106244631A CN 201610813613 A CN201610813613 A CN 201610813613A CN 106244631 A CN106244631 A CN 106244631A
- Authority
- CN
- China
- Prior art keywords
- spore
- monascus
- rna
- protein
- external source
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses and a kind of use external source single stranded RNA method of marking protein in monascus resting spore, cultivate including monascus and spore collection, Monascus spore pretreatment and use HDEN method electric shock three steps of Monascus spore, the step for that the method walking around fungus spore germination, use HDEN electricity transformation technology, by external strand encoding proteins RNA delivery through cell wall and cell membrane, marking protein in monascus resting spore.The inventive method step is easy quickly, and excellent, conversion ratio reaches more than 90%.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of use external source single stranded RNA in monascus resting spore
The method of marking protein.
Background technology
The central dogma of molecular biology refers to that hereditary information passes to RNA from DNA, then passes to protein from RNA, i.e.
Complete the process of the transcription and translation of hereditary information.In modern genetic engineering, it is frequently used host to express foreign protein, conventional
Way build plasmid vector exactly, the DNA sequences encoding of foreign protein is placed on after a strong promoter, import host thin
After born of the same parents, DNA sequences encoding is transcribed into mRNA sequence (single stranded RNA), and mRNA sequence is expressed as by intracellular machine translator again
Protein molecule, completes the overall process of exogenous protein expression.
DNA, either as the plasmid being free on outside host genome, is also inserted among host genome, may be used
Stably to replicate self, and pass to filial generation.It is to say, the information of DNA can heredity.Meanwhile, DNA can be continually
Transcribe out nascent RNA, and translate into protein.
RNA is formed long chain molecule by ribonucleotide through phosphodiester bond condensation.One ribonucleic acid molecule is by phosphorus
Acid, ribose and base are constituted.The base of RNA mainly has 4 kinds, i.e. A (adenine), G (guanine), C (cytosine), U (urinate phonetic
Pyridine).RNA is as single chain molecule, and compared with the DNA of duplex structure, RNA is the most unstable, and the half-life is the shortest, and at nature,
RNase is widely present, and RNA is very easy to be degraded.RNA has following well-known feature: be free in cytoplasmic RNA not
Can heredity;The RNA half-life is the shortest, it is impossible to long-term existence;RNA will not be inserted in the genomic DNA of host.
Owing to the half-life is short, therefore, a RNA molecule is present in intracellular duration, the ofest short duration, and this RNA can only be
In this of short duration time, interact with ribosome, marking protein molecule.And the protein molecule being expressed, also
Having the life-span, in intracellular existence how long protein molecule, it is also possible to weighs by half-life index.
In traditional technique for gene engineering, if conventional at the protein of a host cell internal representations external source
Way be that the encoding gene of protein is built on DNA vector, DNA vector is proceeded to inside host cell, DNA vector source
The RNA of coded protein is constantly transcribed out in source, and RNA constantly translates destination protein, it is achieved that at intracellular protein expression.
If not by DNA vector, prepare the single strand RNA molecule of encoding proteins in vitro, only coded protein
External source single stranded RNA imports to inside host cell, if intracellular do not have correspondence DNA transcribe continuously make new advances should
RNA, then, this RNA and the protein molecule gone out expressed by it, can only exist at specific time window.In other words, this
RNA and the protein molecule gone out expressed by it, can only exist some time period in cell life cycle.
Therefore, this characteristic has a critically important effect, can be at specific time cycle window, certain egg of transient expression
White or RNA, it is possible to achieve marking protein and do not affect or affect less normal physiological cycle and the heredity of cell
Information.Such as: exogenous RNA can be proceeded at certain timing node of cell activities, express certain cytokine, regulation and control
The life cycle of cell;The toolenzyme albumen of the Genome Editing such as TALENs, ZFNs and CRISPR/Cas9 can be divided
Son, expresses in host cell with external source single stranded RNA, it is to avoid when using the carrier of plasmid or other DNA form, by DNA sequence
Row introduce cell interior, and cause potential foreign DNA to interact (such as homologous recombination) with host chromosome, affect cell
Heredity, etc..This characteristic, in genetic engineering field, has important value.
In mammalian cell is tested, there is precedent, external source single stranded RNA directly can have been proceeded to mammalian cell
In.The chemical reagent such as main method includes: 1, uses the chemical method of the reagent such as such as Lipo, Lipo can be with mammalian cell
Cell membrane interact, exogenous RNA is imported cell interior.2, traditional electrotransformation, such as square wave electric shock, this is
The of short duration mammalian cell acting on contact exogenous RNA of a kind of electric pulse, makes exogenous RNA enter cell.
Monascus can be used for making wine, vinegar processed, the coloring agent cooking fermented bean curd and flavoring agent, it is possible to does Chinese medicine, has important
Industry and economic worth.It is carried out genetic modification, relates at its cell inner expression foreign protein, but this fungus not
Sprout marking protein in spore extremely difficult.
Fungal spore is the main organ of multiplication of fungus, and spore is resting state and can survive for a long time.Spore exists
Under suitable external condition, it is possible to revive and sprout, form mycelia and carry out schizogamy.Most importantly, a lot of types
The spore of fungus, is natural monoploid, and spore is the starting biomaterial that genetic engineering field is good.
But, owing to spore is typically in resting state, its cell wall is the most abundant, the cell wall of resting spore, cell
The state of film, is different from sprouting spore and mycelium.And the intracellular vital movement of resting spore is also at the most vigorous
State, therefore, it is known in the art that the cell permeability of resting spore not as sprouting spore and mycelia, resting spore is hardly
Material is exchanged with the external world, of seclusion, it is typically in sleep state.And sprout spore or mycelium, need to absorb respectively from the external world
Planting nutrient molecule supply vital movement, therefore cell wall and membrane passage are more than resting spore.So, it is very difficult to will
Exogenous RNA molecule is importing directly into the inside of sleep spore.The most not yet there is any method can accomplish directly exogenous RNA
Molecule, in the case of mediating without medium, imports inside (sprouting) fungal spore of dormancy.This is also not have in the industry always
There is the technical barrier captured.
Not yet there is report external source single stranded RNA being imported monascus cell interior at present, more exogenous RNA is not imported red
The report of aspergillus spore (either sprouting spore, still do not sprout spore).Current technique for gene engineering is at monascus cell
The method of interior expression destination protein matter, it is still desirable to by DNA vector, and it is generally required to use monascus ripe mycelial former
Raw plastid is as host cell, or by Agrobacterium as medium, enters host cell by DNA vector passenger gene information.
Additionally, the exogenous RNA of coded protein imports after not sprouting spore inside, in addition it is also necessary to turn over the albumen within spore
The various cytokine such as translation factor, enzyme system interact, and just can translate protein molecule.It is well known that, spore of sleeping
Vital movement be in the most vigorous state, the vigor of the intracellular various protein translation factors and enzyme system is the lowest, various
The quantity of the factor and enzyme system molecule is also little, does not sprouts inside spore even if exogenous RNA enters, it is also desirable to long
Interaction time, just can translate destination protein.And the time is long, it is meant that exogenous RNA is intracellular, by endogenous cellular
The probability of RNase degraded strengthens, and therefore, it is desirable to will have the exogenous RNA of abundant quantity, can enter and not sprout in spore
Portion.
The spore germination of fungus, this area how is allowed to have had a ready-made technical scheme, but no matter which kind of germination method,
It is required for elapsed time, energy, manual operation and chemical reagent.The fungal spore of the most useful sprouting, imports external source
The case of DNA, therefore, according to the rationale of this area, it is considered that, outside importing with the sprouting spore that cell permeability is higher
The success rate of source molecule (RNA of such as external source) is bigger, because the spore sprouted has been revived, and the intracellular various factors and enzyme system
Having given full play to active, cell nutrient to be absorbed, intraor extracellular material exchange enlivens.It's a pity, be at present
Only, the most useful spore (either sprout and still do not sprout) imports the precedent of external source coding RNA.It is, however, obvious that with not
The spore sprouted is used as importing the parent material of exogenous molecules, the easiest, does spore germination because can save this is multiple
Miscellaneous step, it is often more important that, the spore of sprouting, may create polyploid, and the spore do not sprouted, it is ensured that it is
Monoploid, a lot of engineered application, it is desirable to host cell must be monoploid, can be only achieved result or the effect of anticipation
Rate.Therefore the present invention attempts the step for of walking around fungus spore germination, directly with the spore of dormancy, imports exogenous RNA.
Additionally, it is well known that fungus can produce substantial amounts of RNase, and can these RNase of external secretion in a large number, fungus is
One of main source of nature RNase.Fungal spore gathers from thalline, and when gathering fungal spore, spore can carry thalline
The substantial amounts of exogenous rna enzyme of secretion, and is difficult in the case of not killing spore, RNase thoroughly clean up (if
Use the compounds such as DEPC to do thoroughly cleaning, fungal spore will certainly be killed).And spore self also can produce and external secretion
Some RNase.Therefore, use external source single stranded RNA to convert fungal cell, extremely difficult, it is tantamount to suicidally attack, strand
RNA also will be degraded by RNase not in contact with to fungal cell.
In sum, by the RNA molecule of coded protein, be introduced directly into fungus (either mycelium or spore, no matter
It is the spore or the spore do not sprouted sprouted) internal, it is the technical barrier never captured in the industry.
Electroporated (Electroporation) is that of short duration the acting on of a kind of electric pulse contacts the thin of exogenous nucleic acid
Born of the same parents, make the method that exogenous nucleic acid enters cell.Electroporated method, again according to features, has many segmentations.There is document report
Road electric shocking method, DNA delivery enters the cell of some fungal species.But, DNA compared with the single stranded RNA of encoding proteins,
In structure, on biochemistry and molecular biology attribute, the most entirely different, they and cell wall, the interaction of cell membrane
Mode is also different, therefore allows them by the cell wall of fungus, cell membrane the mechanism entering cell interior, is also different
's.DNA molecular compared with single stranded RNA, DNA long half time, it is not easy to be degraded, highly stable.For the method for DNA delivery,
Cannot be directly used to deliver single stranded RNA, currently also there is no relevant report.
The electroporated technology of HDEN emerged for 2013, is a kind of characteristic being specifically designed for mammalian cell, and develops
Electric transformation technology, its exploitation purpose is to transmit foreign DNA and the efficiency of medicine in mammalian cell to improve.This skill
Art comprises 3 most contents, and one is applied to the electric wave form of cell sample, and two is the cell sample solution ring when electric shock
Border, three is cultural method and the front preprocess method of electric shock of cell sample.Owing to this technology is specific to mammalian cell
Exploitation, therefore, above-mentioned 3 most contents, it is both for the characteristic of mammalian cell and designs.
Existing document reports HDEN technology at HEK-293A, Hela, Neuro-2A, MCF-7, C2C12,3T3-L1,
In the mammalian cells such as CHO, MDCK, HL-60, HUVEC, A375, U251, DNA delivery enters the application case of cell.At present
Not yet there is the Case Report of application in this technology species beyond mammalian cell.Therefore, HDEN electricity transformation technology can not
Can apply to the species beyond mammalian cell, be also a unknown number.
Summary of the invention
Present invention aims to background technology present situation, it is provided that a kind of use external source single stranded RNA is in monascus dormancy
The method of marking protein in spore, the step for that the method walking around fungus spore germination, uses HDEN electricity transformation technology, by body
Outer strand encoding proteins RNA delivery passes cell wall and cell membrane, marking protein in monascus resting spore.
For achieving the above object, the present invention adopts the following technical scheme that
A kind of use external source single stranded RNA method of marking protein in monascus resting spore, comprise the following steps:
1) monascus is cultivated and spore is collected
At solid agar medium surface seeding monascus, cultivate and cover with Monascus spore to media surface, wash lower training
Supporting the Monascus spore of primary surface, sucking-off spore suspension also filters removal mycelia, collects the filtrate containing spore, by filtrate from
The heart, collects the resting spore of precipitation;
2) Monascus spore pretreatment
With the resuspended spore of electroporation buffer, centrifugal and collect spore precipitation, repeat above-mentioned resuspended and centrifugation step 3-4 time
After, the spore finally collected precipitation is resuspended in electroporation buffer, obtaining spore concentration is 104—1011The monascus of individual/ml
Spore suspension;
Described electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid (HEPES) and eventually of final concentration of 0.01-100mmol/L
Concentration is the mannitol composition of 0.5-5000mmol/L, and the pH of electroporation buffer is 3.0-9.5;
3) HDEN method electric shock Monascus spore is used
In the hole of Tissue Culture Plate, add Monascus spore suspension and RNA to be transformed that above-mentioned steps obtains, mix,
Obtain spore and RNA mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then uses EttaBiotech X-
Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and RNA mixture by the electric shock head with matrix form electrode
Portion, energising so that spore is internal with RNA mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath 10-more on ice
15min, then by spore and RNA mixture sucking-off, obtains importing the Monascus spore of the dormancy of exogenous RNA;
Described monascus suspension with the ratio of RNA to be transformed is: the Monascus spore suspension of 0.6-60000 μ l: 0.1-
The RNA to be transformed of 10000 μ g;
Described shock parameters is as follows: voltage 1 6000V, pulsewidth 2-2000000ms, repeats 1-100 time, every minor tick 5-
50000ms。
Further, described step 1) culture medium be PDA culture medium, YPD culture medium or Czapek's medium, preferably PDA
The effect of culture medium is best, produces spore the fastest at most.
Described step 1) condition of culture of monascus is: temperature 16-40 DEG C, humidity 15-85%, cultivates 3-15 day.
Preferably, described step 1), the condition of culture of monascus is: temperature 30 DEG C, humidity 50-60%, cultivates 5.
Further, described step 2), electroporation buffer is by the HEPES and final concentration of 50-of final concentration of 1-10mmol/L
The mannitol composition of 100mmol/L, the pH of electroporation buffer is 5.0-7.0;
Preferably, described step 2), electroporation buffer is by the HEPES and final concentration of 50mmol/ of final concentration of 1mmol/L
The mannitol composition of L, the pH of electroporation buffer is 7.0.
Described step 2) Monascus spore suspension before electric shock, in basis of microscopic observation, confirm in spore suspension aseptic
Filament mixes pollution and spore is not all sprouted, and shocks by electricity the most again.
Further, described step 3), RNA to be transformed is the RNA of external source strand coded protein, can be green fluorescence egg
White coding RNA of coding RNA, the coding RNA of red fluorescent protein or yellow fluorescence protein etc..
The PCR primer that the present invention expands green fluorescence protein gene or yellow fluorescent protein gene is as follows:
F:5'AGATGACGTCGCTAGCATGGTGAGCAAGGGC 3';(SEQ ID NO.1)
R:5'ACGCGTCGACTTACTTGTACAGCTCGT3';(SEQ ID NO.2)
Wherein, near 5 ' the GCTAGC sequences held in primers F, after being used for promoting that this DNA is transcribed into RNA, translation initiation factor
Son is combined with RNA, and this sequence is close to the start codon ATG of expressed genes of interest.
The PCR primer that the present invention expands red fluorescent protein gene is as follows:
Forward primer: RFP-F:5'CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3';(SEQ ID NO.3)
Downstream primer: RFP-R:5'TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3';(SEQ ID NO.4)
Wherein, near 5 ' the GCCACC sequences held in primer RFP-F, after being used for promoting that this DNA is transcribed into RNA, translate
The beginning factor is combined with RNA, and this sequence is close to the start codon ATG of expressed genes of interest.
Preferably, described step 3), monascus suspension with the ratio of RNA to be transformed is: the Monascus spore suspension of 60 μ l:
The RNA to be transformed of 10 μ g.
Further, described step 3), voltage 300-1000V, pulsewidth 1500-20000ms, repeats 1-50 time, every minor tick
500-5000ms;It is preferably: voltage 550V, pulsewidth 2000ms, is repeated 3 times, every minor tick 500ms.
Electric shock of the present invention uses Etta Biotech X-Porator H1 electroporation, buys and reaches biology from Suzhou one
Company.
The present invention collects the spore do not sprouted, and follow-up electricity turns experimentation, if without specified otherwise, experimental implementation is equal
Operating in the constant temperature laboratory of not higher than 23 degrees Celsius, centrifugation step is 4 DEG C of frozen centrifugations, and each of spore is not sprouted in contact
Plant liquid all in advance in pre-cooling on ice.Do not sprout spore and forbid to touch any containing promoting its factor sprouted and material
(the such as germination medium with YEPD etc. as representative), to ensure the resting state of spore.
Monascus incubation of the present invention, after monascus surface covers with spore, pours sterilized water into media surface, washes
The Monascus spore of lower media surface, with pipettor sucking-off spore suspension, uses lens paper (or the core leakage of sterilizing
Bucket, filter paper etc.) filter, remove mycelia, retain spore, without filtration step, then spore suspension can be contaminated with mycelia,
The transformant that subsequent step obtains, it is impossible to actually judge by the positive colony formed after spore transforming DNA, or mycelia converts
The false positive formed after DNA.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and observes and confirm spore
Interior chromosome is haploid state.
The present invention prepares the molecular biology high purity water or double steaming that the water of solid agar medium should be MillQ rank
Water, resistivity of water is not less than 18.2M Ω-cm.
When using HDEN method electric shock Monascus spore, the hole of Tissue Culture Plate adds the Monascus spore of proper proportion
Suspension and RNA to be transformed, mix even, is placed in by container and carries out ice bath on ice.Such as in the hole of 96 porocyte culture plates
(the Nunclon Surface 96 porocyte culture plate of NUNC company, article No. Cat.No.167008), adds the monascus of 60 μ l
Spore suspension, and the RNA no less than 10 μ g.Described Tissue Culture Plate can also be 384 orifice plates, 24 orifice plates, 6 orifice plates or
Other more greatly, less container, then according to container volume size, zoom in or out spore and RNA mixture system.
The present invention uses above technical scheme, is used as importing the parent material of exogenous molecules with the spore do not sprouted, non-
It is often easy, because the step doing this complexity of spore germination can be saved, it is often more important that, the spore of sprouting, may multiparity
Give birth to polyploid, and the spore do not sprouted, it is ensured that it is monoploid, a lot of engineered application, it is desirable to host cell must
Must be monoploid, can be only achieved result or the efficiency of anticipation.Meanwhile, present invention application HDEN electricity transformation technology is by exogenous RNA
Import monascus resting spore.HDEN electricity transformation technology have employed high-density matrix formula electrode, and it can produce high uniformity and strong
Spending enough electric fields, the condition that in electric field, each cell accepts to shock by electricity is the most completely the same, during operation, as long as cell being placed on logical
With in container, such as Tissue Culture Plate, then the electric shock head with matrix form electrode is inserted in container, it is energized.And it is traditional
Electricity turn technology and usually use special electric shock cup, between two pieces of metallic plates being placed in parallel, place cell, and to metallic plate
Power up, form electric field electric shock.Therefore, the discharge mode of the two is entirely different, and the former electrode inserts inside cell suspension, including
Portion produces electric field, and the latter is to produce electric field in the outside that cell suspension is overall;The former electrode tip is made up of many metal needles,
Between pin and pin, produce voltage, and the latter only has two pieces of metallic plates, one piece of positive pole, one piece of negative pole, produces electricity between
Pressure.HDEN technology also essentially eliminates the cathode effect of tradition electric shock technology, it is to avoid produce a large amount of hydroxide ion, it is to avoid kill
Cell, improves the cell survival rate after electric shock.And tradition electric shock technology is difficult to eliminate cathode effect.The HDEN method of the present invention, electricity
Hit repeatedly, the effect that repeatedly can shock by electricity with superposition, and cell mortality will not be significantly increased, and traditional electric-shocking method is general
Only electric shock 1 time, if because tradition electric-shocking method shocks by electricity repeatedly, can cause cell mortality to increase considerably.
HDEN electricity transformation technology is a kind of characteristic being specifically designed for mammalian cell and opens electricity transformation technology, and it is opened
Sending out purpose is to transmit foreign DNA and the efficiency of medicine in mammalian cell to improve.And in this field it is known that
The characteristic of microbial cell and cultural method, compared with mammalian cell, vary.Mammalian cell and microorganism are thin
The structure of born of the same parents is different, and mammalian cell does not has a cell wall, and microbial cell (such as majority of fungal, include monascus) has
Cell wall.The cell membrane of mammalian cell and the cell membrane of microorganism are the most different.Even if same is biological, its difference
Tissue, Different Organs or different cell types, respective cell membrane, the structure of cell wall, state, chemical composition, the most not
Equally.Even the same tissue of same biology, same organ, same cell type, at different growth promoter
Stage, or in different external environments, respective cell membrane, the structure of cell wall, state, chemical composition, the most all differ
Sample.And cell wall and cell membrane, it is to stop the barrier that exogenous molecules enters cell, barrier is different, and (structure is different, and chemical composition is not
With), the method determining breakthrough barrier is also different.Additionally, different exogenous molecules because have different structure, point
Son amount, volume and chemical composition, when identical barrier, the method that different exogenous molecules break through barrier is also different.
If in the face of different barriers, then different exogenous molecules break through method and the mechanism of different barrier, vary especially.
Therefore, any technology being applied to mammalian cell, all it is difficult to directly apply to microbial cell.The most not yet
There is the Case Report of application in HDEN technology species beyond mammalian cell.The present invention is directed to the spy of monascus cell
Property, use HDEN technology that external strand encoding proteins RNA is imported monascus resting spore, the method determines cell sample
Cultural method and electric shock before preprocess method, the cell sample solution environmental when electric shock, and put on cell sample
Electric wave form.
Additionally, RNA translates into protein, it is desirable to have regulating and controlling sequence is combined with translation initiation factor and mediating proteins translation
Initial.Which type of regulating and controlling sequence can be a unknown number in fungus (monascus of the such as present invention) intracellular use,
Any document is not had to report.Invention further discloses and can see the present invention at 2 kinds of regulating and controlling sequences of the intracellular use of monascus
Embodiment part.
Use the inventive method, it is achieved that first the RNA of coded protein is introduced directly into monascus dormancy spore
Son marking protein, and step is the easiest quickly, it addition, excellent, can obtain the conversion ratio of at least 90%.
Accompanying drawing explanation
Below in conjunction with the drawings and specific embodiments, the present invention is further detailed explanation:
Fig. 1 is the electrophoresis detection result of the RNA product that embodiment 1 is transcribed out.
Detailed description of the invention
Below example is easy to be better understood from the present invention, but does not limit the present invention.
The all operations of experimentation is intended to follow sterile working's principle of Experiment on Microbiology, and vessel, consumptive material, reagent are intended to
Sterilization treatment.
All restriction endonucleases used by the present invention are Fermentas company fastdigest series of restriction restriction endonuclease and produce
Product, the T4DNA ligase that following example are used is that Fermentas Products, enzyme action and connection and glue reclaim and DNA is pure
Change operation, all operate according to product description.
Embodiment 1
Expressing green fluorescent protein (GFP) in monascus cell:
One, plasmid construction
Use GFP gene coded sequence, GFP gene as shown in SEQ ID NO.5,
The protein sequence of above-mentioned GFP gene as shown in SEQ ID NO.6,
The PCR primer of amplification GFP gene:
F:AGAT GCTAGC GTGAGCAAGGGC wave is Aat II restriction enzyme site
R:ACGCTTACTTGTACAGCTCGT wave is Sal I restriction enzyme site
The GCTAGC sequence of band underscore in primers F, after being used for promoting that this DNA is transcribed into RNA, translation initiation factor with
RNA combines, and this sequence is close to the start codon ATG of expressed genes of interest.After primer being PCR with above-mentioned this, can
To allow GCTAGC on GFP upstream region of gene band, upstream and downstream all brings restriction enzyme site.
After agarose gel electrophoresis detection PCR primer is errorless, use Thermo GeneJET Gel Extraction and
DNA Cleanup Micro Kit reclaims purified pcr product.
By above-mentioned PCR primer Aat II and Sal I double digestion, it is connected to also pass through Aat by it with T4DNA ligase
On the Promega company pGEM-T easy plasmid of II and Sal I double digestion, convert escherichia coli, select positive colony, use matter
After universal sequencing primer thing sequence verification insertion sequence on grain is errorless, extract recombiant plasmid in a large number.Above-mentioned steps just can allow
This GFP gene is positioned at the downstream of this plasmid vector T7promoter.
In vitro transcription
With the Fastdigest Nde1 restriction endonuclease of Fermentas company, the recombiant plasmid of said extracted is made single endonuclease digestion line
Property.Use Thermo Scientific TranscriptAid T7High Yield Transcription Kit, to upper
State recombiant plasmid and do in vitro transcription, operate the most to specifications.
The RNA product purification transcribed out
1) in 20 μ l responsive transcription systems, add the DEPC-H of 115 μ l23M NaAc solution (pH5.2) of O and 15 μ l,
Mixing;
2) isopyknic phenol chloroform isoamyl alcohol mixture (phenol: chloroform: isoamyl alcohol=25:24:1) is added, mixing;
3) high speed centrifugation, makes lower leaf on liquid, takes upper strata aqueous phase to another 1.5ml centrifuge tube.
4) in aqueous phase, add 2 times of volume dehydrated alcohol, be placed in-20 DEG C of at least 30min, high speed centrifugation, precipitate RNA, go
Supernatant.
5) 70% ethanol of 1ml pre-cooling, gently reverse rear high speed centrifugation 1min are added;
6) precipitation is resuspended in the DEPC-H of suitable volumes2In O, RNA concentration is made to be not less than 10 μ g/ μ L;
Electrophoresis detection result is as shown in Figure 1:
Swimming lane 1:RiboRuler RNA Ladder, high range, ready-to-use;
Swimming lane 2:positive control, 2222nt;
Swimming lane 3: the RNA of the GFP that in vitro transcription goes out ,~750nt
Two, coding RNA expressing green fluorescent protein in monascus resting spore of above-mentioned green fluorescent protein is used, step
Rapid as follows:
1) monascus is cultivated and spore is collected
In 15cm culture dish, prepare solid agar medium (PDA culture medium), at solid agar medium surface seeding
Monascus CICC 41234, temperature 30 DEG C, humidity 50-60%, cultivate 5, allow media surface cover with Monascus spore.
Sterilized water is poured into media surface, wash down (concussion, or scratch gently with smooth sterile glass spreading rod)
The Monascus spore of media surface, with pipettor sucking-off spore suspension, use sterilizing lens paper (or sand core funnel,
Filter paper etc.) filter, to remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after being centrifuged, collects the resting spore of precipitation,
Remove supernatant fluid.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and observes and in confirmation spore
Chromosome is haploid state.
2) Monascus spore pretreatment
Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then from
The heart, collects spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer,
Microscope is observed, and confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last by spore
When being resuspended in electroporation buffer, should control the volume of electroporation buffer well, keeping Monascus spore suspension miospore concentration is 108
Individual/ml.
Described electroporation buffer is made up of the mannitol of the HEPES and final concentration of 50mmol/L of final concentration of 1mmol/L,
The pH of electroporation buffer is 7.0.
3) HDEN method electric shock Monascus spore is used
The Monascus spore suspension of 60 μ l, and the volume of 10 μ g green fluorescent proteins is added in the hole of 96 porocyte culture plates
Code RNA, mixing, obtain spore and RNA mixture, container is placed in ice bath 10min on ice, then uses Etta Biotech
X-Porator H1 electroporation carries out HDEN method electric shock, and the electric shock head with matrix form electrode is inserted spore and RNA mixture
Inside, energising so that spore is internal with RNA mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath more on ice
10min, then by spore and RNA mixture sucking-off, obtains importing the Monascus spore of the dormancy of exogenous RNA;
The present embodiment shock parameters is as follows: voltage 550V, pulsewidth 2000ms, is repeated 3 times, every minor tick 500ms.
4) confirmatory experiment
By spore and the RNA mixture of above-mentioned sucking-off, joining in the YPD culture medium of 100 times of volumes, 30 DEG C of cultivations 20 are little
Shi Hou, uses confocal laser scanning microscope.
While carrying out above-mentioned experimental procedure, need to prepare matched group: " spore and RNA mix by that do not shock by electricity, identical
Compound ", join in another YPD culture medium, cultivate under the same terms, then observe with laser confocal microscope.
Result shows: the cell unstressed configuration of matched group, and the cell of sample sets at least 95% has green fluorescence, shows have successfully
RNA convert.
Embodiment 2
Expression red fluorescent protein (RFP) in monascus cell:
One, plasmid construction
The nucleotide sequence of RFP as shown in SEQ ID NO.7,
The protein sequence of RFP as shown in SEQ ID NO.8,
The primer of amplification RFP gene is as follows:
Forward primer: RFP-F:5'CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3'
Downstream primer: RFP-R:5'TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'
Forward primer 5 end, with EcoR I restriction enzyme site, the GCCACC sequence of band underscore, is used for promoting that this DNA transcribes
After becoming RNA, translation initiation factor is combined with RNA, and this sequence is close to the start codon ATG of expressed genes of interest.
Downstream primer 5 end is with Sal I restriction enzyme site.
According to the way of embodiment 1, RFP gene is expanded by PCR, does molecular cloning, be connected to pGEM-Teasy and carry
On body, then do in vitro transcription, and gained RNA is converted host's spore.
Two, using the coding RNA of red fluorescent protein to express red fluorescent protein in monascus resting spore, step is such as
Under:
1) monascus is cultivated and spore is collected
In 15cm culture dish, prepare solid agar medium (YPD culture medium), at solid agar medium surface seeding
Monascus CICC 41234, temperature 16 DEG C, under humidity 15-50%, cultivates 15, allows media surface cover with monascus spore
Son.
Sterilized water is poured into media surface, wash down (concussion, or scratch gently with smooth sterile glass spreading rod)
The Monascus spore of media surface, with pipettor sucking-off spore suspension, use sterilizing lens paper (or sand core funnel,
Filter paper etc.) filter, to remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after being centrifuged, collects the resting spore of precipitation,
Remove supernatant fluid.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and observes and in confirmation spore
Chromosome is haploid state.
2) Monascus spore pretreatment
Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then from
The heart, collects spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer,
Microscope is observed, and confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last by spore
When being resuspended in electroporation buffer, should control the volume of electroporation buffer well, keeping Monascus spore suspension miospore concentration is 1011
Individual/ml.
Described electroporation buffer is by the HEPES of final concentration of 0.01mmol/L and the mannitol of final concentration of 0.5mmol/L
Composition, the pH of electroporation buffer is 3.0.
3) HDEN method electric shock Monascus spore is used
The Monascus spore suspension of 0.6 μ l is added in the hole of 96 porocyte culture plates, and 0.1 μ g red fluorescent protein
Coding RNA, mixing, obtain spore and RNA mixture, container is placed in ice bath 15min on ice, then uses Etta Biotech
X-Porator H1 electroporation carries out HDEN method electric shock, and the electric shock head with matrix form electrode is inserted spore and RNA mixture
Inside, energising so that spore is internal with RNA mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath more on ice
15min, then by spore and RNA mixture sucking-off, obtains importing the Monascus spore of the dormancy of exogenous RNA;
The present embodiment shock parameters is as follows: voltage 1V, pulsewidth 2000000ms, repeats 100 times, every minor tick 5ms.
4) confirmatory experiment
By spore and the RNA mixture of above-mentioned sucking-off, joining in the YPD culture medium of 10 times of volumes, 10 DEG C of cultivations 25 are little
Shi Hou, uses confocal laser scanning microscope.
While carrying out above-mentioned experimental procedure, need to prepare matched group: " spore and RNA mix by that do not shock by electricity, identical
Compound ", join in another YPD culture medium, cultivate under the same terms, then observe with laser confocal microscope.
Result shows: the cell unstressed configuration of matched group, and more than at least 90% cell of sample sets has red fluorescence, shows have
Successfully RNA converts.
Embodiment 3
Expression yellow fluorescence protein (YFP) in monascus cell:
One, plasmid construction
The nucleotide sequence of YFP as shown in SEQ ID NO.9,
The protein sequence of YFP as shown in SEQ ID NO.10,
Use the primer identical for GFP with embodiment 1, and according to same experimental procedure and method, GFP gene is passed through
PCR expands, and does molecular cloning, is connected on pGEM-T easy carrier, then does in vitro transcription, and gained RNA is converted host's spore
Son.
Two, using the coding RNA of yellow fluorescence protein to express yellow fluorescence protein in monascus resting spore, step is such as
Under:
1) monascus is cultivated and spore is collected
In 15cm culture dish, prepare solid agar medium (PDA culture medium), at solid agar medium surface seeding
Monascus CICC 41234, temperature 40 DEG C, under humidity 60-85%, cultivates 3, allows media surface cover with Monascus spore.
Sterilized water is poured into media surface, wash down (concussion, or scratch gently with smooth sterile glass spreading rod)
The Monascus spore of media surface, with pipettor sucking-off spore suspension, use sterilizing lens paper (or sand core funnel,
Filter paper etc.) filter, to remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after being centrifuged, collects the resting spore of precipitation,
Remove supernatant fluid.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and observes and in confirmation spore
Chromosome is haploid state.
2) Monascus spore pretreatment
Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then from
The heart, collects spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer,
Microscope is observed, and confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last by spore
When being resuspended in electroporation buffer, should control the volume of electroporation buffer well, keeping Monascus spore suspension miospore concentration is 104
Individual/ml.
Described electroporation buffer is by the HEPES of final concentration of 100mmol/L and the mannitol of final concentration of 5000mmol/L
Composition, the pH of electroporation buffer is 7.0.
3) HDEN method electric shock Monascus spore is used
The Monascus spore suspension of 60000 μ l, and 10000 μ g red fluorescence eggs are added in the hole of 96 porocyte culture plates
White coding RNA, mixing, obtain spore and RNA mixture, container is placed in ice bath 10min on ice, then uses Etta
Biotech X-Porator H1 electroporation carries out HDEN method electric shock, by with matrix form electrode electric shock head insert spore with
Inside RNA mixture, energising so that spore is internal with RNA mixture produces electric field, is placed in by Tissue Culture Plate after electric shock again
Ice bath 10min on ice, then by spore and plasmid mixture sucking-off, obtains importing the Monascus spore of the dormancy of exogenous RNA;
The present embodiment shock parameters is as follows: voltage 6000V, pulsewidth 2ms, is repeated 1 times, and is spaced 50000ms.
4) confirmatory experiment
By spore and the RNA mixture of above-mentioned sucking-off, joining in the YPD culture medium of 10 times of volumes, 40 DEG C of cultivations 24 are little
Shi Hou, uses confocal laser scanning microscope.
While carrying out above-mentioned experimental procedure, need to prepare matched group: " spore and RNA mix by that do not shock by electricity, identical
Compound ", join in another YPD culture medium, cultivate under the same terms, then observe with laser confocal microscope.
Result shows: the cell unstressed configuration of matched group, and more than at least 90% cell of sample sets has yellow fluorescence, shows have
Successfully RNA converts.
Embodiment 4
The present embodiment shock parameters is: voltage 30V, pulsewidth 1000000ms, shocks by electricity 50 times, is spaced 5000ms, and other is with real
Execute example 1.
Embodiment 5
The present embodiment shock parameters is: voltage 3000V, pulsewidth 100ms, shocks by electricity 5 times, is spaced 25000ms, and other is with implementing
Example 1.
Linear rna by coded protein of the present invention imports cell, protein at cell inner expression, Ke Yishi
This cell, these species self just can encode the protein that can express, it is also possible to is the protein in other living species source, or
It is the protein of engineer.
The RNA of all of external source strand coded protein, can convert by the method for the present invention, is not limited only to implement
Green, the red or coding RNA of yellow fluorescence protein described in example.
SEQUENCE LISTING
<110>University of Fuzhou
<120>external source single stranded RNA method of marking protein in monascus resting spore is used
<130> 1
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 31
<212> DNA
<213>artificial sequence
<400> 1
agatgacgtc gctagcatgg tgagcaaggg c 31
<210> 2
<211> 27
<212> DNA
<213>artificial sequence
<400> 2
acgcgtcgac ttacttgtac agctcgt 27
<210> 3
<211> 34
<212> DNA
<213>artificial sequence
<400> 3
cggaattcgc caccatggcc tcctccgagg acgt 34
<210> 4
<211> 28
<212> DNA
<213>artificial sequence
<400> 4
tcgagctcgt taggcgccgg tggagtgg 28
<210> 5
<211> 720
<212> DNA
<213>artificial sequence
<400> 5
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480
ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720
<210> 6
<211> 239
<212> PRT
<213>artificial sequence
<400> 6
Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu
1 5 10 15
Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly
20 25 30
Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile
35 40 45
Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr
50 55 60
Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys
65 70 75 80
Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu
85 90 95
Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu
100 105 110
Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly
115 120 125
Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr
130 135 140
Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn
145 150 155 160
Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser
165 170 175
Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly
180 185 190
Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu
195 200 205
Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe
210 215 220
Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys
225 230 235
<210> 7
<211> 678
<212> DNA
<213>artificial sequence
<400> 7
atggcctcct ccgaggacgt catcaaggag ttcatgcgct tcaaggtgcg catggagggc 60
tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120
acccagaccg ccaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180
ctgtcccctc agttccagta cggctccaag gcctacgtga agcaccccgc cgacatcccc 240
gactacttga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300
gacggcggcg tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac 360
aaggtgaagc tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc 420
atgggctggg aggcctccac cgagcggatg taccccgagg acggcgccct gaagggcgag 480
atcaagatga ggctgaagct gaaggacggc ggccactacg acgccgaggt caagaccacc 540
tacatggcca agaagcccgt gcagctgccc ggcgcctaca agaccgacat caagctggac 600
atcacctccc acaacgagga ctacaccatc gtggaacagt acgagcgcgc cgagggccgc 660
cactccaccg gcgcctaa 678
<210> 8
<211> 225
<212> PRT
<213>artificial sequence
<400> 8
Met Ala Ser Ser Glu Asp Val Ile Lys Glu Phe Met Arg Phe Lys Val
1 5 10 15
Arg Met Glu Gly Ser Val Asn Gly His Glu Phe Glu Ile Glu Gly Glu
20 25 30
Gly Glu Gly Arg Pro Tyr Glu Gly Thr Gln Thr Ala Lys Leu Lys Val
35 40 45
Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile Leu Ser Pro Gln
50 55 60
Phe Gln Tyr Gly Ser Lys Ala Tyr Val Lys His Pro Ala Asp Ile Pro
65 70 75 80
Asp Tyr Leu Lys Leu Ser Phe Pro Glu Gly Phe Lys Trp Glu Arg Val
85 90 95
Met Asn Phe Glu Asp Gly Gly Val Val Thr Val Thr Gln Asp Ser Ser
100 105 110
Leu Gln Asp Gly Glu Phe Ile Tyr Lys Val Lys Leu Arg Gly Thr Asn
115 120 125
Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr Met Gly Trp Glu
130 135 140
Ala Ser Thr Glu Arg Met Tyr Pro Glu Asp Gly Ala Leu Lys Gly Glu
145 150 155 160
Ile Lys Met Arg Leu Lys Leu Lys Asp Gly Gly His Tyr Asp Ala Glu
165 170 175
Val Lys Thr Thr Tyr Met Ala Lys Lys Pro Val Gln Leu Pro Gly Ala
180 185 190
Tyr Lys Thr Asp Ile Lys Leu Asp Ile Thr Ser His Asn Glu Asp Tyr
195 200 205
Thr Ile Val Glu Gln Tyr Glu Arg Ala Glu Gly Arg His Ser Thr Gly
210 215 220
Ala
225
<210> 9
<211> 720
<212> DNA
<213>artificial sequence
<400> 9
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccttcggcta cggcctgcag tgcttcgccc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480
ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagct accagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtga 720
<210> 10
<211> 239
<212> PRT
<213>artificial sequence
<400> 10
Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu
1 5 10 15
Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly
20 25 30
Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile
35 40 45
Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr
50 55 60
Phe Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys
65 70 75 80
Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu
85 90 95
Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu
100 105 110
Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly
115 120 125
Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr
130 135 140
Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn
145 150 155 160
Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser
165 170 175
Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly
180 185 190
Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser Ala Leu
195 200 205
Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe
210 215 220
Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys
225 230 235
Claims (10)
1. use external source single stranded RNA method of marking protein in monascus resting spore, it is characterised in that: described method bag
Include following steps:
1) monascus is cultivated and spore is collected
At solid agar medium surface seeding monascus, cultivate and cover with Monascus spore to media surface, wash lower culture medium
The Monascus spore on surface, sucking-off spore suspension also filters removal mycelia, collects the filtrate containing spore, filtrate be centrifuged, receive
The resting spore of collection precipitation;
2) Monascus spore pretreatment
With the resuspended spore of electroporation buffer, centrifugal and collect spore precipitation, after repeating above-mentioned resuspended and centrifugation step 3-4 time, general
The spore precipitation finally collected is resuspended in electroporation buffer, and obtaining spore concentration is 104-1011The Monascus spore of individual/ml hangs
Liquid;
Described electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid of final concentration of 0.01-100mmol/L and final concentration of 0.5-
The mannitol composition of 5000mmol/L, the pH of electroporation buffer is 3.0-9.5;
3) HDEN method electric shock Monascus spore is used
In the hole of Tissue Culture Plate, add Monascus spore suspension and RNA to be transformed that above-mentioned steps obtains, mixing, obtain
Spore and RNA mixture, be placed in Tissue Culture Plate ice bath 10-15min on ice, then use Etta Biotech X-
Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and RNA mixture by the electric shock head with matrix form electrode
Portion, energising so that spore is internal with RNA mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath 10-more on ice
15min, then by spore and RNA mixture sucking-off, obtains importing the Monascus spore of the dormancy of exogenous RNA;
Described monascus suspension with the ratio of RNA to be transformed is: the Monascus spore suspension of 0.6-60000 μ l: 0.1-10000 μ g
RNA to be transformed;
Described shock parameters is as follows: voltage 1-6000V, and pulsewidth 2-2000000ms repeats 1-100 time, every minor tick 5-
50000ms。
Use external source single stranded RNA method of marking protein in monascus resting spore the most according to claim 1, its
It is characterised by: the culture medium of described step 1) is PDA culture medium, YPD culture medium or Czapek's medium.
Use external source single stranded RNA method of marking protein in monascus resting spore the most according to claim 1, its
It is characterised by: described step 1) condition of culture of monascus is: temperature 16-40 DEG C, humidity 15-85%, cultivates 3-15 day.
Use external source single stranded RNA method of marking protein in monascus resting spore the most according to claim 1, its
Be characterised by: described step 2) Monascus spore suspension before electric shock, in basis of microscopic observation, confirm in spore suspension aseptic
Filament mixes pollution and spore is not all sprouted, and shocks by electricity the most again.
Use external source single stranded RNA method of marking protein in monascus resting spore the most according to claim 1, its
Being characterised by: described step 3), RNA to be transformed is the RNA of external source strand coded protein, this RNA can in host cell table
Reach coded protein.
Use external source single stranded RNA method of marking protein in monascus resting spore the most according to claim 5, its
It is characterised by: the volume that RNA is the coding RNA of green fluorescent protein, red fluorescent protein of described external source strand coded protein
Code RNA or the coding RNA of yellow fluorescence protein.
Use external source single stranded RNA method of marking protein in monascus resting spore the most according to claim 6, its
It is characterised by: utilize following PCR primer amplification green fluorescence protein gene or yellow fluorescent protein gene:
F:5'AGATGACGTCGCTAGCATGGTGAGCAAGGGC 3' ;
R:5'ACGCGTCGACTTACTTGTACAGCTCGT3';
Near 5 ' the GCTAGC sequences held in primers F, after being used for promoting that this DNA is transcribed into RNA, translation initiation factor is tied with RNA
Closing, this sequence is close to the start codon ATG of expressed genes of interest.
Use external source single stranded RNA method of marking protein in monascus resting spore the most according to claim 6, its
Be characterised by: utilize following PCR primer expand red fluorescent protein gene:
Forward primer: RFP-F:5'CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3';
Downstream primer: RFP-R:5'TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3';
Near 5 ' the GCCACC sequences held in primer RFP-F, after being used for promoting that this DNA is transcribed into RNA, translation initiation factor with
RNA combines, and this sequence is close to the start codon ATG of expressed genes of interest.
Use external source single stranded RNA method of marking protein in monascus resting spore the most according to claim 6, its
Being characterised by: described step 3), monascus suspension with the ratio of RNA to be transformed is: the Monascus spore suspension of 60 μ l: 10 μ g
RNA to be transformed.
Use external source single stranded RNA method of marking protein in monascus resting spore the most according to claim 1,
It is characterized in that: described step 3), shock parameters is as follows: voltage 400V, pulsewidth 2000ms, is repeated 3 times, every minor tick
500ms。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610813613.6A CN106244631A (en) | 2016-09-09 | 2016-09-09 | Use external source single stranded RNA method of marking protein in monascus resting spore |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610813613.6A CN106244631A (en) | 2016-09-09 | 2016-09-09 | Use external source single stranded RNA method of marking protein in monascus resting spore |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106244631A true CN106244631A (en) | 2016-12-21 |
Family
ID=57599347
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610813613.6A Pending CN106244631A (en) | 2016-09-09 | 2016-09-09 | Use external source single stranded RNA method of marking protein in monascus resting spore |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106244631A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1687396A (en) * | 2005-04-28 | 2005-10-26 | 江南大学 | Method for constructing genetic engineering fungus of monascus with no citrinin |
CN103333909A (en) * | 2013-05-08 | 2013-10-02 | 中国计量学院 | Streptomyces diastatochromogenes electroporation transformation method |
CN104560742A (en) * | 2015-01-14 | 2015-04-29 | 浙江省林业科学研究院 | Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof |
CN105925600A (en) * | 2016-05-30 | 2016-09-07 | 上海市农业科学院 | Method for genetic transformation of volvariella volvacea by using electric shock method |
-
2016
- 2016-09-09 CN CN201610813613.6A patent/CN106244631A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1687396A (en) * | 2005-04-28 | 2005-10-26 | 江南大学 | Method for constructing genetic engineering fungus of monascus with no citrinin |
CN103333909A (en) * | 2013-05-08 | 2013-10-02 | 中国计量学院 | Streptomyces diastatochromogenes electroporation transformation method |
CN104560742A (en) * | 2015-01-14 | 2015-04-29 | 浙江省林业科学研究院 | Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof |
CN105925600A (en) * | 2016-05-30 | 2016-09-07 | 上海市农业科学院 | Method for genetic transformation of volvariella volvacea by using electric shock method |
Non-Patent Citations (4)
Title |
---|
KENJI OZEKI等: "Transformation of Intact Aspergillus niger by Electroporation", 《BIOSCIENCE, BIOTECHNOLOGY, AND BIOCHEMISTRY》 * |
WU,M.X.等: "High-density distributed electrode network, a multi-functional electroporation method for delivery of molecules of different sizes", 《SCIENTIFIC REPORTS.》 * |
周礼红等: "红曲霉不同转化方法的比较", 《遗传》 * |
李松等: "黑曲霉电转化条件的研究", 《微生物学杂志》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Nickoloff | Electroporation protocols for microorganisms | |
EP1356037B1 (en) | A library of a collection of cells | |
US11286504B2 (en) | Method to produce protein in Penicillium amagasakiense's sleeping spores by transformation of ssRNA | |
CN106191123A (en) | Use external source single stranded RNA method of marking protein in trichoderma reesei resting spore | |
CN106381304A (en) | Method for expressing proteins in aspergillus oryzae resting spores by using exogenous single chain RNA (Ribose Nucleic Acid) | |
US20190271007A1 (en) | Method for direct transformation of exogenous dna into resting spores of penicillium amagasakiense | |
CN106148410A (en) | A kind of method producing protein molecule in a penicillium sp resting spore | |
CN106148411A (en) | Use external source single stranded RNA method of marking protein in aspergillus nidulans resting spore | |
CN106148412A (en) | A kind of method not sprouting spore transfer outside the pale of civilization source ssRNA in aspergillus flavus | |
CN106191122A (en) | A kind of method of marking protein in fusarium moniliforme resting spore | |
CN106381308A (en) | Method for preparing protein in penicillium expansum hypnospores by use of exogenous RNA | |
CN106244631A (en) | Use external source single stranded RNA method of marking protein in monascus resting spore | |
CN106148413A (en) | A kind of method of marking protein in geotrichum candidum resting spore | |
CN106244630A (en) | Use external source single stranded RNA method of marking protein in aspergillus niger resting spore | |
CN106148415A (en) | A kind of method of marking protein in Rhizopus stolonifer resting spore | |
WO2018045618A1 (en) | Medium-independent method for directly transforming exogenous dna into aspergillus niger dormant spores | |
CN106381303A (en) | Method for transforming long-chain ssRNA (single-stranded ribonucleic acid) into Pyricularia oryzae ungerminated spores | |
CN106381305A (en) | Method for converting exogenous ssRNA (single-stranded Ribonucleic Acid) to rhizopus oryzae hypnospores and expressing protein | |
CN106381312A (en) | Method for transforming exogenous long chain ssRNA (single-stranded Ribonucleic Acid) into aspergillus fumigatus non-germinated spores | |
Langridge et al. | [20] Uptake of DNA and RNA into cells mediated by electroporation | |
CN106399379A (en) | Method for expressing protein in mucor racemosus hypnospore | |
CN106367440A (en) | Method of using exogenous single stranded RNA for expressing protein in mucor circinelloides hypnospore | |
CN106148387A (en) | The method directly penicillium expansum resting spore being converted external source DNA (deoxyribonucleic acid) | |
CN106244616A (en) | A kind of method making foreign DNA penetration cell barrier inlet point penicillium sp resting spore | |
CN106148386A (en) | A kind of non-Medium Dependent directly method to aspergillus oryzae resting spore conversion foreign DNA |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161221 |