CN106191122A

CN106191122A - A kind of method of marking protein in fusarium moniliforme resting spore

Info

Publication number: CN106191122A
Application number: CN201610813626.3A
Authority: CN
Inventors: 林峻
Original assignee: Fuzhou University
Current assignee: Fuzhou University
Priority date: 2016-09-09
Filing date: 2016-09-09
Publication date: 2016-12-07

Abstract

The invention discloses a kind of method of marking protein in fusarium moniliforme resting spore, cultivate including fusarium moniliforme and spore collection, fusarium moniliforme spore pretreatment and use HDEN method electric shock three steps of fusarium moniliforme spore, the step for that the method walking around fungus spore germination, use HDEN electricity transformation technology, by external strand encoding proteins RNA delivery through cell wall and cell membrane, marking protein in fusarium moniliforme resting spore.The inventive method step is easy quickly, and excellent, conversion ratio reaches more than 90%.

Description

A kind of method of marking protein in fusarium moniliforme resting spore

Technical field

The invention belongs to biological technical field, be specifically related to a kind of marking protein in the fusarium moniliforme resting spore Method

Background technology

The central dogma of molecular biology refers to that hereditary information passes to RNA from DNA, then passes to protein from RNA, i.e. Complete the process of the transcription and translation of hereditary information.In modern genetic engineering, it is frequently used host to express foreign protein, conventional Way build plasmid vector exactly, the DNA sequences encoding of foreign protein is placed on after a strong promoter, import host thin After born of the same parents, DNA sequences encoding is transcribed into mRNA sequence (single stranded RNA), and mRNA sequence is expressed as by intracellular machine translator again Protein molecule, completes the overall process of exogenous protein expression.

DNA, either as the plasmid being free on outside host genome, is also inserted among host genome, may be used Stably to replicate self, and pass to filial generation.It is to say, the information of DNA can heredity.Meanwhile, DNA can be continually Transcribe out nascent RNA, and translate into protein.

RNA is formed long chain molecule by ribonucleotide through phosphodiester bond condensation.One ribonucleic acid molecule is by phosphorus Acid, ribose and base are constituted.The base of RNA mainly has 4 kinds, i.e. A (adenine), G (guanine), C (cytosine), U (urinate phonetic Pyridine).RNA is as single chain molecule, and compared with the DNA of duplex structure, RNA is the most unstable, and the half-life is the shortest, and at nature, RNase is widely present, and RNA is very easy to be degraded.RNA has following well-known feature: be free in cytoplasmic RNA not Can heredity；The RNA half-life is the shortest, it is impossible to long-term existence；RNA will not be inserted in the genomic DNA of host.

Owing to the half-life is short, therefore, a RNA molecule is present in intracellular duration, the ofest short duration, and this RNA can only be In this of short duration time, interact with ribosome, marking protein molecule.And the protein molecule being expressed, also Having the life-span, in intracellular existence how long protein molecule, it is also possible to weighs by half-life index.

In traditional technique for gene engineering, if conventional at the protein of a host cell internal representations external source Way be that the encoding gene of protein is built on DNA vector, DNA vector is proceeded to inside host cell, DNA vector source The RNA of coded protein is constantly transcribed out in source, and RNA constantly translates destination protein, it is achieved that at intracellular protein expression.

If not by DNA vector, prepare the single strand RNA molecule of encoding proteins in vitro, only coded protein External source single stranded RNA imports to inside host cell, if intracellular do not have correspondence DNA transcribe continuously make new advances should RNA, then, this RNA and the protein molecule gone out expressed by it, can only exist at specific time window.In other words, this RNA and the protein molecule gone out expressed by it, can only exist some time period in cell life cycle.

Therefore, this characteristic has a critically important effect, can be at specific time cycle window, certain egg of transient expression White or RNA, it is possible to achieve marking protein and do not affect or affect less normal physiological cycle and the heredity of cell Information.Such as: exogenous RNA can be proceeded at certain timing node of cell activities, express certain cytokine, regulation and control The life cycle of cell；The toolenzyme albumen of the Genome Editing such as TALENs, ZFNs and CRISPR/Cas9 can be divided Son, expresses in host cell with external source single stranded RNA, it is to avoid when using the carrier of plasmid or other DNA form, by DNA sequence Row introduce cell interior, and cause potential foreign DNA to interact (such as homologous recombination) with host chromosome, affect cell Heredity, etc..This characteristic, in genetic engineering field, has important value.

In mammalian cell is tested, there is precedent, external source single stranded RNA directly can have been proceeded to mammalian cell In.The chemical reagent such as main method includes: 1, uses the chemical method of the reagent such as such as Lipo, Lipo can be with mammalian cell Cell membrane interact, exogenous RNA is imported cell interior.2, traditional electrotransformation, such as square wave electric shock, this is The of short duration mammalian cell acting on contact exogenous RNA of a kind of electric pulse, makes exogenous RNA enter cell.

Fusarium moniliforme (Fusarium moniliforme) belongs to Deuteromycotina, Hyphomycetes, tumor seat spore mesh, tumor seat spore Section, Fusarium.This bacterium agriculturally can cause disease, often parasitizes the crops such as Semen Maydis, Herba bromi japonici, Semen Tritici aestivi, Oryza sativa L., except energy Cause beyond plant root-rot and brown foot rot, also cause the symptoms such as top rot, fringe corruption.The metabolite of this bacterium be moniliformin and 6-(10-hydroxy-6-oxo-trans-1-undecenyl)-.beta.-resorcylic acid lactone, has toxicity, and occurs with the gastric cancer of the mankind, the esophageal carcinoma, have substantial connection.Fusarium moniliforme and being produced Toxin, it is easy to pollute the food of the mankind.Therefore, the toxigenic molecular mechanism of fusarium moniliforme, and the life of cell are studied Reason biochemistry, is ensuring food safety, and protects people's health, ensures that the aspects such as agricultural foison are significant, has important society And economic worth.

Fungal spore is the main organ of multiplication of fungus, and spore is resting state and can survive for a long time.Spore exists Under suitable external condition, it is possible to revive and sprout, form mycelia and carry out schizogamy.Most importantly, a lot of types The spore of fungus, is natural monoploid, and spore is the starting biomaterial that genetic engineering field is good.

But, owing to spore is typically in resting state, its cell wall is the most abundant, the cell wall of resting spore, cell The state of film, is different from sprouting spore and mycelium.And the intracellular vital movement of resting spore is also at the most vigorous State, therefore, it is known in the art that the cell permeability of resting spore not as sprouting spore and mycelia, resting spore is hardly Material is exchanged with the external world, of seclusion, it is typically in sleep state.And sprout spore or mycelium, need to absorb respectively from the external world Planting nutrient molecule supply vital movement, therefore cell wall and membrane passage are more than resting spore.So, it is very difficult to will Exogenous RNA molecule is importing directly into the inside of sleep spore.The most not yet there is any method can accomplish directly exogenous RNA Molecule, in the case of mediating without medium, imports inside (sprouting) fungal spore of dormancy.This is also not have in the industry always There is the technical barrier captured.

Not yet there is report external source single stranded RNA being imported fusarium moniliforme cell interior at present, more exogenous RNA is not led Enter the report of fusarium moniliforme spore (either sprouting spore, still do not sprout spore).Current technique for gene engineering is at string The method expressing destination protein matter in pearl dimorphic fungal cell, it is still desirable to by DNA vector, and it is generally required to use beading reaping hook The ripe mycelial protoplast of bacterium is as host cell, or by Agrobacterium as medium, believes with DNA vector passenger gene Breath enters host cell.

Additionally, the exogenous RNA of coded protein imports after not sprouting spore inside, in addition it is also necessary to turn over the albumen within spore The various cytokine such as translation factor, enzyme system interact, and just can translate protein molecule.It is well known that, spore of sleeping Vital movement be in the most vigorous state, the vigor of the intracellular various protein translation factors and enzyme system is the lowest, various The quantity of the factor and enzyme system molecule is also little, does not sprouts inside spore even if exogenous RNA enters, it is also desirable to long Interaction time, just can translate destination protein.And the time is long, it is meant that exogenous RNA is intracellular, by endogenous cellular The probability of RNase degraded strengthens, and therefore, it is desirable to will have the exogenous RNA of abundant quantity, can enter and not sprout in spore Portion.

The spore germination of fungus, this area how is allowed to have had a ready-made technical scheme, but no matter which kind of germination method, It is required for elapsed time, energy, manual operation and chemical reagent.The fungal spore of the most useful sprouting, imports external source The case of DNA, therefore, according to the rationale of this area, it is considered that, outside importing with the sprouting spore that cell permeability is higher The success rate of source molecule (RNA of such as external source) is bigger, because the spore sprouted has been revived, and the intracellular various factors and enzyme system Having given full play to active, cell nutrient to be absorbed, intraor extracellular material exchange enlivens.It's a pity, be at present Only, the most useful spore (either sprout and still do not sprout) imports the precedent of external source coding RNA.It is, however, obvious that with not The spore sprouted is used as importing the parent material of exogenous molecules, the easiest, does spore germination because can save this is multiple Miscellaneous step, it is often more important that, the spore of sprouting, may create polyploid, and the spore do not sprouted, it is ensured that it is Monoploid, a lot of engineered application, it is desirable to host cell must be monoploid, can be only achieved result or the effect of anticipation Rate.Therefore the present invention attempts the step for of walking around fungus spore germination, directly with the spore of dormancy, imports exogenous RNA.

Additionally, it is well known that fungus can produce substantial amounts of RNase, and can these RNase of external secretion in a large number, fungus is One of main source of nature RNase.Fungal spore gathers from thalline, and when gathering fungal spore, spore can carry thalline The substantial amounts of exogenous rna enzyme of secretion, and is difficult in the case of not killing spore, RNase thoroughly clean up (if Use the compounds such as DEPC to do thoroughly cleaning, fungal spore will certainly be killed).And spore self also can produce and external secretion Some RNase.Therefore, use external source single stranded RNA to convert fungal cell, extremely difficult, it is tantamount to suicidally attack, strand RNA also will be degraded by RNase not in contact with to fungal cell.

In sum, by the RNA molecule of coded protein, be introduced directly into fungus (either mycelium or spore, no matter It is the spore or the spore do not sprouted sprouted) internal, it is the technical barrier never captured in the industry.

Electroporated (Electroporation) is that of short duration the acting on of a kind of electric pulse contacts the thin of exogenous nucleic acid Born of the same parents, make the method that exogenous nucleic acid enters cell.Electroporated method, again according to features, has many segmentations.There is document report Road electric shocking method, DNA delivery enters the cell of some fungal species.But, DNA compared with the single stranded RNA of encoding proteins, In structure, on biochemistry and molecular biology attribute, the most entirely different, they and cell wall, the interaction of cell membrane Mode is also different, therefore allows them by the cell wall of fungus, cell membrane the mechanism entering cell interior, is also different 's.DNA molecular compared with single stranded RNA, DNA long half time, it is not easy to be degraded, highly stable.For the method for DNA delivery, Cannot be directly used to deliver single stranded RNA, currently also there is no relevant report.

The electroporated technology of HDEN emerged for 2013, is a kind of characteristic being specifically designed for mammalian cell, and develops Electric transformation technology, its exploitation purpose is to transmit foreign DNA and the efficiency of medicine in mammalian cell to improve.This skill Art comprises 3 most contents, and one is applied to the electric wave form of cell sample, and two is the cell sample solution ring when electric shock Border, three is cultural method and the front preprocess method of electric shock of cell sample.Owing to this technology is specific to mammalian cell Exploitation, therefore, above-mentioned 3 most contents, it is both for the characteristic of mammalian cell and designs.

Existing document reports HDEN technology at HEK-293A, Hela, Neuro-2A, MCF-7, C2C12,3T3-L1, In the mammalian cells such as CHO, MDCK, HL-60, HUVEC, A375, U251, DNA delivery enters the application case of cell.At present Not yet there is the Case Report of application in this technology species beyond mammalian cell.Therefore, HDEN electricity transformation technology can not Can apply to the species beyond mammalian cell, be also a unknown number.

Summary of the invention

Present invention aims to background technology present situation, it is provided that a kind of expression egg in fusarium moniliforme resting spore The method of white matter, the step for that the method walking around fungus spore germination, uses HDEN electricity transformation technology, by external strand coding Protein rna is delivered through cell wall and cell membrane, marking protein in fusarium moniliforme resting spore.

For achieving the above object, the present invention adopts the following technical scheme that

A kind of method of marking protein in fusarium moniliforme resting spore, comprises the following steps:

1) fusarium moniliforme is cultivated and spore is collected

At solid agar medium surface seeding fusarium moniliforme, fusarium moniliforme spore is covered with in cultivation to media surface Son, washes the fusarium moniliforme spore of lower media surface, and sucking-off spore suspension also filters removal mycelia, collects the filter containing spore Liquid, is centrifuged filtrate, collects the resting spore of precipitation；

2) fusarium moniliforme spore pretreatment

With the resuspended spore of electroporation buffer, centrifugal and collect spore precipitation, repeat above-mentioned resuspended and centrifugation step 3-4 time After, the spore finally collected precipitation is resuspended in electroporation buffer, obtaining spore concentration is 10⁴—10¹¹The beading sickle of individual/ml Cutter bacterium spore suspension；

Described electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid (HEPES) and eventually of final concentration of 0.01-100mmol/L Concentration is the mannitol composition of 0.5-5000mmol/L, and the pH of electroporation buffer is 3.0-9.5；

3) HDEN method electric shock fusarium moniliforme spore is used

Fusarium moniliforme spore suspension and RNA to be transformed that above-mentioned steps obtains is added in the hole of Tissue Culture Plate, Mixing, obtains spore and RNA mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then uses Etta Biotech X-Porator H1 electroporation carries out HDEN method electric shock, by with matrix form electrode electric shock head insert spore with Inside RNA mixture, energising so that spore is internal with RNA mixture produces electric field, is placed in by Tissue Culture Plate after electric shock again Ice bath 10-15min on ice, then by spore and RNA mixture sucking-off, obtains importing the fusarium moniliforme of the dormancy of exogenous RNA Spore；

Described fusarium moniliforme suspension with the ratio of RNA to be transformed is: the fusarium moniliforme spore of 0.6-60000 μ l hangs Liquid: the RNA to be transformed of 0.1-10000 μ g；

Described shock parameters is as follows: voltage 1 6000V, pulsewidth 2-2000000ms, repeats 1-100 time, every minor tick 5- 50000ms。

Further, described step 1) culture medium be PDA culture medium, YPD culture medium or Czapek's medium, preferably PDA The effect of culture medium is best, produces spore the fastest at most.

Described step 1) condition of culture of fusarium moniliforme is: temperature 16-40 DEG C, humidity 15-85%, cultivates 3-15 day.

Preferably, described step 1), the condition of culture of fusarium moniliforme is: temperature 24 DEG C, humidity 50-60%, cultivates 5 Day.

Further, described step 2), electroporation buffer is by the HEPES and final concentration of 50-of final concentration of 1-10mmol/L The mannitol composition of 100mmol/L, the pH of electroporation buffer is 5.0-7.0；

Preferably, described step 2), electroporation buffer is by the HEPES and final concentration of 50mmol/ of final concentration of 1mmol/L The mannitol composition of L, the pH of electroporation buffer is 7.0.

Described step 2) fusarium moniliforme spore suspension before electric shock, in basis of microscopic observation, confirm in spore suspension Mix pollution without mycelium and spore is not all sprouted, shock by electricity the most again.

Further, described step 3), RNA to be transformed is the RNA of external source strand coded protein, can be green fluorescence egg White coding RNA of coding RNA, the coding RNA of red fluorescent protein or yellow fluorescence protein etc..

The PCR primer that the present invention expands green fluorescence protein gene or yellow fluorescent protein gene is as follows:

F:5'AGATGACGTCGCTAGCATGGTGAGCAAGGGC 3'；(SEQ ID NO.1)

R:5'ACGCGTCGACTTACTTGTACAGCTCGT3'；(SEQ ID NO.2)

Wherein, near 5 ' the GCTAGC sequences held in primers F, after being used for promoting that this DNA is transcribed into RNA, translation initiation factor Son is combined with RNA, and this sequence is close to the start codon ATG of expressed genes of interest.

The PCR primer that the present invention expands red fluorescent protein gene is as follows:

Forward primer: RFP-F:5'CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3'；(SEQ ID NO.3)

Downstream primer: RFP-R:5'TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'；(SEQ ID NO.4)

Wherein, near 5 ' the GCCACC sequences held in primer RFP-F, after being used for promoting that this DNA is transcribed into RNA, translate The beginning factor is combined with RNA, and this sequence is close to the start codon ATG of expressed genes of interest.

Preferably, described step 3), fusarium moniliforme suspension with the ratio of RNA to be transformed is: the fusarium moniliforme of 60 μ l Spore suspension: the RNA to be transformed of 10 μ g.

Further, described step 3), voltage 300-1000V, pulsewidth 1500-20000ms, repeat 50-100 time, every time between Every 500-5000ms；It is preferably: voltage 350V, pulsewidth 2000ms, is repeated 3 times, every minor tick 500ms.

Electric shock of the present invention uses Etta Biotech X-Porator H1 electroporation, buys and reaches biology from Suzhou one Company.

The present invention collects the spore do not sprouted, and follow-up electricity turns experimentation, if without specified otherwise, experimental implementation is equal Operating in the constant temperature laboratory of not higher than 23 degrees Celsius, centrifugation step is 4 DEG C of frozen centrifugations, and each of spore is not sprouted in contact Plant liquid all in advance in pre-cooling on ice.Do not sprout spore and forbid to touch any containing promoting its factor sprouted and material (the such as germination medium with YEPD etc. as representative), to ensure the resting state of spore.

Fusarium moniliforme incubation of the present invention, after fusarium moniliforme surface covers with spore, pours into media surface Sterilized water, washes the fusarium moniliforme spore of lower media surface, with pipettor sucking-off spore suspension, uses the lens paper of sterilizing (or sand core funnel, filter paper etc.) filters, and removes mycelia, retains spore, without filtration step, then meeting in spore suspension It is contaminated with mycelia, the transformant that subsequent step obtains, it is impossible to judge it is by the positive colony formed after spore transforming DNA actually, Or the false positive formed after mycelia transforming DNA.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and sees The chromosome examined and confirm in spore is haploid state.

The present invention prepares the molecular biology high purity water or double steaming that the water of solid agar medium should be MillQ rank Water, resistivity of water is not less than 18.2M Ω-cm.

When using HDEN method electric shock fusarium moniliforme spore, the hole of Tissue Culture Plate adds the beading sickle of proper proportion Cutter bacterium spore suspension and RNA to be transformed, mix even, is placed in by container and carries out ice bath on ice.Such as cultivate at 96 porocytes In the hole of plate (the Nunclon Surface 96 porocyte culture plate of NUNC company, article No. Cat.No.167008), add 60 μ l Fusarium moniliforme spore suspension, and no less than the RNA of 10 μ g.Described Tissue Culture Plate can also be 384 orifice plates, 24 holes Plate, 6 orifice plates or other more greatly, less container, then according to container volume size, zoom in or out spore and RNA Mixture system.

The present invention uses above technical scheme, is used as importing the parent material of exogenous molecules with the spore do not sprouted, non- It is often easy, because the step doing this complexity of spore germination can be saved, it is often more important that, the spore of sprouting, may multiparity Give birth to polyploid, and the spore do not sprouted, it is ensured that it is monoploid, a lot of engineered application, it is desirable to host cell must Must be monoploid, can be only achieved result or the efficiency of anticipation.Meanwhile, present invention application HDEN electricity transformation technology is by exogenous RNA Import fusarium moniliforme resting spore.HDEN electricity transformation technology have employed high-density matrix formula electrode, and it can produce high uniformity And the electric field that intensity is enough, the condition that in electric field, each cell accepts to shock by electricity is the most completely the same, during operation, as long as cell is put In universal container, such as Tissue Culture Plate, then the electric shock head with matrix form electrode is inserted in container, it is energized.And Traditional electricity turns technology and usually uses special electric shock cup, places cell between two pieces of metallic plates being placed in parallel, and to gold Belong to plate to power up, form electric field electric shock.Therefore, the discharge mode of the two is entirely different, and the former electrode inserts inside cell suspension, Produce electric field in inside, and the latter is to produce electric field in the outside that cell suspension is overall；The former electrode tip is by many metal needles Composition, produces voltage between pin and pin, and the latter only has two pieces of metallic plates, one piece of positive pole, one piece of negative pole, produces between Raw voltage.HDEN technology also essentially eliminates the cathode effect of tradition electric shock technology, it is to avoid produce a large amount of hydroxide ion, it is to avoid Kill cell, improve the cell survival rate after electric shock.And tradition electric shock technology is difficult to eliminate cathode effect.The HDEN of the present invention Method, shocks by electricity repeatedly, the effect that repeatedly can shock by electricity with superposition, and cell mortality will not be significantly increased, and traditional electric shock side Method the most only shocks by electricity 1 time, if because tradition electric-shocking method shocks by electricity repeatedly, cell mortality can be caused to increase considerably.

HDEN electricity transformation technology is a kind of characteristic being specifically designed for mammalian cell and opens electricity transformation technology, and it is opened Sending out purpose is to transmit foreign DNA and the efficiency of medicine in mammalian cell to improve.And in this field it is known that The characteristic of microbial cell and cultural method, compared with mammalian cell, vary.Mammalian cell and microorganism are thin The structure of born of the same parents is different, and mammalian cell does not has a cell wall, and microbial cell (such as majority of fungal, includes beading reaping hook Bacterium) there is cell wall.The cell membrane of mammalian cell and the cell membrane of microorganism are the most different.Even if same is biological, it Different tissues, Different Organs or different cell types, respective cell membrane, the structure of cell wall, state, chemical composition, The most different.Even the same tissue of same biology, same organ, same cell type, in different lifes The long stage of development, or in different external environments, respective cell membrane, the structure of cell wall, state, chemical composition, also The most different.And cell wall and cell membrane, it is to stop the barrier that exogenous molecules enters cell, barrier is different, and (structure is different, chemistry Composition is different), the method determining breakthrough barrier is also different.Additionally, different exogenous molecules, because having different knots Structure, molecular weight, volume and chemical composition, when identical barrier, the method that different exogenous molecules break through barrier also differs Sample.If in the face of different barriers, then different exogenous molecules break through method and the mechanism of different barrier, vary especially ?.

Therefore, any technology being applied to mammalian cell, all it is difficult to directly apply to microbial cell.The most not yet There is the Case Report of application in HDEN technology species beyond mammalian cell.The present invention is directed to fusarium moniliforme cell Characteristic, uses HDEN technology that external strand encoding proteins RNA is imported fusarium moniliforme resting spore, and the method determines carefully Preprocess method before the cultural method of born of the same parents' sample and electric shock, the cell sample solution environmental when electric shock, and put on cell The electric wave form of sample.

Additionally, RNA translates into protein, it is desirable to have regulating and controlling sequence is combined with translation initiation factor and mediating proteins translation Initial.Which type of regulating and controlling sequence can in fungus (fusarium moniliforme of the such as present invention) intracellular use, be one not Know number, do not have any document to report.Invention further discloses can be in 2 kinds of regulation and control sequences of the intracellular use of fusarium moniliforme Row, are shown in embodiment of the present invention part.

Use the inventive method, it is achieved that first the RNA of coded protein is introduced directly into fusarium moniliforme and stops Dormancy spore marking protein, and step is the easiest quickly, it addition, excellent, can obtain the conversion ratio of at least 90%.

Accompanying drawing explanation

Below in conjunction with the drawings and specific embodiments, the present invention is further detailed explanation:

Fig. 1 is the electrophoresis detection result of the RNA product that embodiment 1 is transcribed out.

Detailed description of the invention

Below example is easy to be better understood from the present invention, but does not limit the present invention.

The all operations of experimentation is intended to follow sterile working's principle of Experiment on Microbiology, and vessel, consumptive material, reagent are intended to Sterilization treatment.

All restriction endonucleases used by the present invention are Fermentas company fastdigest series of restriction restriction endonuclease and produce Product, the T4DNA ligase that following example are used is that Fermentas Products, enzyme action and connection and glue reclaim and DNA is pure Change operation, all operate according to product description.

Embodiment 1

Expressing green fluorescent protein (GFP) in fusarium moniliforme cell:

One, plasmid construction

Use GFP gene coded sequence, GFP gene as shown in SEQ ID NO.5,

The protein sequence of above-mentioned GFP gene as shown in SEQ ID NO.6,

The PCR primer of amplification GFP gene:

F:Wave is Aat II restriction enzyme site

R:Wave is Sal I restriction enzyme site

The GCTAGC sequence of band underscore in primers F, after being used for promoting that this DNA is transcribed into RNA, translation initiation factor with RNA combines, and this sequence is close to the start codon ATG of expressed genes of interest.After primer being PCR with above-mentioned this, can To allow GCTAGC on GFP upstream region of gene band, upstream and downstream all brings restriction enzyme site.

After agarose gel electrophoresis detection PCR primer is errorless, use Thermo GeneJET Gel Extraction and DNA Cleanup Micro Kit reclaims purified pcr product.

By above-mentioned PCR primer Aat II and Sal I double digestion, it is connected to also pass through Aat by it with T4DNA ligase On the Promega company pGEM-T easy plasmid of II and Sal I double digestion, convert escherichia coli, select positive colony, use matter After universal sequencing primer thing sequence verification insertion sequence on grain is errorless, extract recombiant plasmid in a large number.Above-mentioned steps just can allow This GFP gene is positioned at the downstream of this plasmid vector T7promoter.

In vitro transcription

With the Fastdigest Nde1 restriction endonuclease of Fermentas company, the recombiant plasmid of said extracted is made single endonuclease digestion line Property.Use Thermo Scientific TranscriptAid T7High Yield Transcription Kit, to upper State recombiant plasmid and do in vitro transcription, operate the most to specifications.

The RNA product purification transcribed out

1) in 20 μ l responsive transcription systems, add the DEPC-H of 115 μ l₂3M NaAc solution (pH5.2) of O and 15 μ l, Mixing；

2) isopyknic phenol chloroform isoamyl alcohol mixture (phenol: chloroform: isoamyl alcohol=25:24:1) is added, mixing；

3) high speed centrifugation, makes lower leaf on liquid, takes upper strata aqueous phase to another 1.5ml centrifuge tube.

4) in aqueous phase, add 2 times of volume dehydrated alcohol, be placed in-20 DEG C of at least 30min, high speed centrifugation, precipitate RNA, go Supernatant.

5) 70% ethanol of 1ml pre-cooling, gently reverse rear high speed centrifugation 1min are added；

6) precipitation is resuspended in the DEPC-H of suitable volumes₂In O, RNA concentration is made to be not less than 10 μ g/ μ L；

Electrophoresis detection result is as shown in Figure 1:

Swimming lane 1:RiboRuler RNA Ladder, high range, ready-to-use；

Swimming lane 2:positive control, 2222nt；

Swimming lane 3: the RNA of the GFP that in vitro transcription goes out ,～750nt

Two, the coding RNA using above-mentioned green fluorescent protein expresses green fluorescence egg in fusarium moniliforme resting spore In vain, step is as follows:

1) fusarium moniliforme is cultivated and spore is collected

In 15cm culture dish, prepare solid agar medium (PDA culture medium), at solid agar medium surface seeding Fusarium moniliforme ATCC 46493, temperature 24 DEG C, under humidity 50-60%, cultivates 5, allows media surface cover with beading sickle Cutter bacterium spore.

Sterilized water is poured into media surface, wash down (concussion, or scratch gently with smooth sterile glass spreading rod) The fusarium moniliforme spore of media surface, with pipettor sucking-off spore suspension, uses lens paper (or the core leakage of sterilizing Bucket, filter paper etc.) filter, to remove mycelia, retain spore, the liquid of filtration loads centrifuge tube, after being centrifuged, collects the dormancy spore of precipitation Son, removes supernatant fluid.Spore chromosome dyeing the to be used method obtained is to its chromosome dyeing, and observes and in confirmation spore Chromosome be haploid state.

2) fusarium moniliforme spore pretreatment

Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then from The heart, collects spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer, Microscope is observed, and confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last by spore When being resuspended in electroporation buffer, the volume of electroporation buffer should be controlled well, keep fusarium moniliforme spore suspension miospore concentration It is 10⁸Individual/ml.

Described electroporation buffer is made up of the mannitol of the HEPES and final concentration of 50mmol/L of final concentration of 1mmol/L, The pH of electroporation buffer is 7.0.

3) HDEN method electric shock fusarium moniliforme spore is used

The fusarium moniliforme spore suspension of 60 μ l, and 10 μ g green fluorescent proteins are added in the hole of 96 porocyte culture plates Coding RNA, mixing, obtain spore and RNA mixture, container be placed in ice bath 10min on ice, then use Etta Biotech X-Porator H1 electroporation carries out HDEN method electric shock, by with matrix form electrode electric shock head insert spore with Inside RNA mixture, energising so that spore is internal with RNA mixture produces electric field, is placed in by Tissue Culture Plate after electric shock again Ice bath 10min on ice, then by spore and RNA mixture sucking-off, obtains importing the fusarium moniliforme spore of the dormancy of exogenous RNA Son；

The present embodiment shock parameters is as follows: voltage 350V, pulsewidth 2000ms, is repeated 3 times, every minor tick 500ms.

4) confirmatory experiment

By spore and the RNA mixture of above-mentioned sucking-off, joining in the YPD culture medium of 100 times of volumes, 30 DEG C of cultivations 20 are little Shi Hou, uses confocal laser scanning microscope.

While carrying out above-mentioned experimental procedure, need to prepare matched group: " spore and RNA mix by that do not shock by electricity, identical Compound ", join in another YPD culture medium, cultivate under the same terms, then observe with laser confocal microscope.

Result shows: the cell unstressed configuration of matched group, and the cell of sample sets at least 95% has green fluorescence, shows have successfully RNA convert.

Embodiment 2

Expression red fluorescent protein (RFP) in fusarium moniliforme cell:

One, plasmid construction

The nucleotide sequence of RFP as shown in SEQ ID NO.7,

The protein sequence of RFP as shown in SEQ ID NO.8,

The primer of amplification RFP gene is as follows:

Forward primer: RFP-F:5'CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3'

Downstream primer: RFP-R:5'TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'

Forward primer 5 end, with EcoR I restriction enzyme site, the GCCACC sequence of band underscore, is used for promoting that this DNA transcribes After becoming RNA, translation initiation factor is combined with RNA, and this sequence is close to the start codon ATG of expressed genes of interest.

Downstream primer 5 end is with Sal I restriction enzyme site.

According to the way of embodiment 1, RFP gene is expanded by PCR, does molecular cloning, be connected to pGEM-T easy and carry On body, then do in vitro transcription, and gained RNA is converted host's spore.

Two, the coding RNA of red fluorescent protein is used to express red fluorescent protein in fusarium moniliforme resting spore, step Rapid as follows:

1) fusarium moniliforme is cultivated and spore is collected

In 15cm culture dish, prepare solid agar medium (YPD culture medium), at solid agar medium surface seeding Fusarium moniliforme ATCC 46493, temperature 16 DEG C, under humidity 15-50%, cultivates 15, allows media surface cover with beading sickle Cutter bacterium spore.

2) fusarium moniliforme spore pretreatment

Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then from The heart, collects spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer, Microscope is observed, and confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last by spore When being resuspended in electroporation buffer, the volume of electroporation buffer should be controlled well, keep fusarium moniliforme spore suspension miospore concentration It is 10¹¹Individual/ml.

Described electroporation buffer is by the HEPES of final concentration of 0.01mmol/L and the mannitol of final concentration of 0.5mmol/L Composition, the pH of electroporation buffer is 3.0.

3) HDEN method electric shock fusarium moniliforme spore is used

The fusarium moniliforme spore suspension of 0.6 μ l, and 0.1 μ g red fluorescence egg is added in the hole of 96 porocyte culture plates White coding RNA, mixing, obtain spore and RNA mixture, container is placed in ice bath 15min on ice, then uses Etta Biotech X-Porator H1 electroporation carries out HDEN method electric shock, by with matrix form electrode electric shock head insert spore with Inside RNA mixture, energising so that spore is internal with RNA mixture produces electric field, is placed in by Tissue Culture Plate after electric shock again Ice bath 15min on ice, then by spore and RNA mixture sucking-off, obtains importing the fusarium moniliforme spore of the dormancy of exogenous RNA Son；

The present embodiment shock parameters is as follows: voltage 1V, pulsewidth 2000000ms, repeats 100 times, every minor tick 5ms.

4) confirmatory experiment

By spore and the RNA mixture of above-mentioned sucking-off, joining in the YPD culture medium of 10 times of volumes, 10 DEG C of cultivations 25 are little Shi Hou, uses confocal laser scanning microscope.

Result shows: the cell unstressed configuration of matched group, and more than at least 90% cell of sample sets has red fluorescence, shows have Successfully RNA converts.

Embodiment 3

Expression yellow fluorescence protein (YFP) in fusarium moniliforme cell:

One, plasmid construction

The nucleotide sequence of YFP as shown in SEQ ID NO.9,

The protein sequence of YFP as shown in SEQ ID NO.10,

Use the primer identical for GFP with embodiment 1, and according to same experimental procedure and method, GFP gene is passed through PCR expands, and does molecular cloning, is connected on pGEM-T easy carrier, then does in vitro transcription, and gained RNA is converted host's spore Son.

Two, the coding RNA of yellow fluorescence protein is used to express yellow fluorescence protein in fusarium moniliforme resting spore, step Rapid as follows:

1) fusarium moniliforme is cultivated and spore is collected

In 15cm culture dish, prepare solid agar medium (PDA culture medium), at solid agar medium surface seeding Fusarium moniliforme ATCC 46493, temperature 40 DEG C, under humidity 60-85%, cultivates 3, allows media surface cover with beading sickle Cutter bacterium spore.

2) fusarium moniliforme spore pretreatment

Precipitate (volume adding electroporation buffer should be able to fill full centrifuge tube) with the resuspended spore of electroporation buffer, then from The heart, collects spore precipitation, removes supernatant fluid.After repeat the above steps twice, again spore is resuspended in electroporation buffer, Microscope is observed, and confirms to mix pollution without mycelium in spore suspension, and confirms that spore is not all sprouted.Last by spore When being resuspended in electroporation buffer, the volume of electroporation buffer should be controlled well, keep fusarium moniliforme spore suspension miospore concentration It is 10⁴Individual/ml.

Described electroporation buffer is by the HEPES of final concentration of 100mmol/L and the mannitol of final concentration of 5000mmol/L Composition, the pH of electroporation buffer is 7.0.

3) HDEN method electric shock fusarium moniliforme spore is used

In the hole of 96 porocyte culture plates, add the fusarium moniliforme spore suspension of 60000 μ l, and 10000 μ g redness are glimmering The coding RNA of photoprotein, mixing, obtain spore and RNA mixture, container is placed in ice bath 10min on ice, then uses Etta Biotech X-Porator H1 electroporation carries out HDEN method electric shock, by with matrix form electrode electric shock head insert spore with Inside RNA mixture, energising so that spore is internal with RNA mixture produces electric field, is placed in by Tissue Culture Plate after electric shock again Ice bath 10min on ice, then by spore and plasmid mixture sucking-off, obtains importing the fusarium moniliforme spore of the dormancy of exogenous RNA Son；

The present embodiment shock parameters is as follows: voltage 6000V, pulsewidth 2ms, is repeated 1 times, and is spaced 50000ms.

4) confirmatory experiment

By spore and the RNA mixture of above-mentioned sucking-off, joining in the YPD culture medium of 10 times of volumes, 40 DEG C of cultivations 24 are little Shi Hou, uses confocal laser scanning microscope.

Result shows: the cell unstressed configuration of matched group, and more than at least 90% cell of sample sets has yellow fluorescence, shows have Successfully RNA converts.

Embodiment 4

The present embodiment shock parameters is: voltage 30V, pulsewidth 1000000ms, shocks by electricity 50 times, is spaced 5000ms, and other is with real Execute example 1.

Embodiment 5

The present embodiment shock parameters is: voltage 3000V, pulsewidth 100ms, shocks by electricity 5 times, is spaced 25000ms, and other is with implementing Example 1.

Linear rna by coded protein of the present invention imports cell, protein at cell inner expression, Ke Yishi This cell, these species self just can encode the protein that can express, it is also possible to is the protein in other living species source, or It is the protein of engineer.

The RNA of all of external source strand coded protein, can convert by the method for the present invention, is not limited only to implement Green, the red or coding RNA of yellow fluorescence protein described in example.

SEQUENCE LISTING

<110>University of Fuzhou

<120>a kind of method of marking protein in fusarium moniliforme resting spore

<130> 1

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 31

<212> DNA

<213>artificial sequence

<400> 1

agatgacgtc gctagcatgg tgagcaaggg c 31

<210> 2

<211> 27

<212> DNA

<213>artificial sequence

<400> 2

acgcgtcgac ttacttgtac agctcgt 27

<210> 3

<211> 34

<212> DNA

<213>artificial sequence

<400> 3

cggaattcgc caccatggcc tcctccgagg acgt 34

<210> 4

<211> 28

<212> DNA

<213>artificial sequence

<400> 4

tcgagctcgt taggcgccgg tggagtgg 28

<210> 5

<211> 720

<212> DNA

<213>artificial sequence

<400> 5

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

<210> 6

<211> 239

<212> PRT

<213>artificial sequence

<400> 6

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210> 7

<211> 678

<212> DNA

<213>artificial sequence

<400> 7

atggcctcct ccgaggacgt catcaaggag ttcatgcgct tcaaggtgcg catggagggc 60

tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120

acccagaccg ccaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180

ctgtcccctc agttccagta cggctccaag gcctacgtga agcaccccgc cgacatcccc 240

gactacttga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300

gacggcggcg tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac 360

aaggtgaagc tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc 420

atgggctggg aggcctccac cgagcggatg taccccgagg acggcgccct gaagggcgag 480

atcaagatga ggctgaagct gaaggacggc ggccactacg acgccgaggt caagaccacc 540

tacatggcca agaagcccgt gcagctgccc ggcgcctaca agaccgacat caagctggac 600

atcacctccc acaacgagga ctacaccatc gtggaacagt acgagcgcgc cgagggccgc 660

cactccaccg gcgcctaa 678

<210> 8

<211> 225

<212> PRT

<213>artificial sequence

<400> 8

Met Ala Ser Ser Glu Asp Val Ile Lys Glu Phe Met Arg Phe Lys Val

1 5 10 15

Arg Met Glu Gly Ser Val Asn Gly His Glu Phe Glu Ile Glu Gly Glu

20 25 30

Gly Glu Gly Arg Pro Tyr Glu Gly Thr Gln Thr Ala Lys Leu Lys Val

35 40 45

Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile Leu Ser Pro Gln

50 55 60

Phe Gln Tyr Gly Ser Lys Ala Tyr Val Lys His Pro Ala Asp Ile Pro

65 70 75 80

Asp Tyr Leu Lys Leu Ser Phe Pro Glu Gly Phe Lys Trp Glu Arg Val

85 90 95

Met Asn Phe Glu Asp Gly Gly Val Val Thr Val Thr Gln Asp Ser Ser

100 105 110

Leu Gln Asp Gly Glu Phe Ile Tyr Lys Val Lys Leu Arg Gly Thr Asn

115 120 125

Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr Met Gly Trp Glu

130 135 140

Ala Ser Thr Glu Arg Met Tyr Pro Glu Asp Gly Ala Leu Lys Gly Glu

145 150 155 160

Ile Lys Met Arg Leu Lys Leu Lys Asp Gly Gly His Tyr Asp Ala Glu

165 170 175

Val Lys Thr Thr Tyr Met Ala Lys Lys Pro Val Gln Leu Pro Gly Ala

180 185 190

Tyr Lys Thr Asp Ile Lys Leu Asp Ile Thr Ser His Asn Glu Asp Tyr

195 200 205

Thr Ile Val Glu Gln Tyr Glu Arg Ala Glu Gly Arg His Ser Thr Gly

210 215 220

Ala

225

<210> 9

<211> 720

<212> DNA

<213>artificial sequence

<400> 9

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccttcggcta cggcctgcag tgcttcgccc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagct accagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtga 720

<210> 10

<211> 239

<212> PRT

<213>artificial sequence

<400> 10

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Phe Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys

225 230 235

Claims

1. the method for marking protein in fusarium moniliforme resting spore, it is characterised in that: described method includes following Step:

1) fusarium moniliforme is cultivated and spore is collected

At solid agar medium surface seeding fusarium moniliforme, cultivate and cover with fusarium moniliforme spore to media surface, wash The fusarium moniliforme spore of lower media surface, sucking-off spore suspension also filters removal mycelia, collects the filtrate containing spore, will Filtrate is centrifuged, and collects the resting spore of precipitation；

2) fusarium moniliforme spore pretreatment

With the resuspended spore of electroporation buffer, centrifugal and collect spore precipitation, after repeating above-mentioned resuspended and centrifugation step 3-4 time, general The spore precipitation finally collected is resuspended in electroporation buffer, and obtaining spore concentration is 10⁴-10¹¹The fusarium moniliforme spore of individual/ml Fullness over the chest during pregnancy liquid；

Described electroporation buffer is by the 4-hydroxyethyl piperazine ethanesulfonic acid of final concentration of 0.01-100mmol/L and final concentration of 0.5- The mannitol composition of 5000mmol/L, the pH of electroporation buffer is 3.0-9.5；

3) HDEN method electric shock fusarium moniliforme spore is used

In the hole of Tissue Culture Plate, add fusarium moniliforme spore suspension and RNA to be transformed that above-mentioned steps obtains, mix, Obtain spore and RNA mixture, Tissue Culture Plate is placed in ice bath 10-15min on ice, then uses Etta Biotech X- Porator H1 electroporation carries out HDEN method electric shock, is inserted in spore and RNA mixture by the electric shock head with matrix form electrode Portion, energising so that spore is internal with RNA mixture produces electric field, and Tissue Culture Plate is placed in after electric shock ice bath 10-more on ice 15min, then by spore and RNA mixture sucking-off, obtains importing the fusarium moniliforme spore of the dormancy of exogenous RNA；

Described fusarium moniliforme suspension with the ratio of RNA to be transformed is: the fusarium moniliforme spore suspension of 0.6-60000 μ l: The RNA to be transformed of 0.1-10000 μ g；

Described shock parameters is as follows: voltage 1-6000V, and pulsewidth 2-2000000ms repeats 1-100 time, every minor tick 5- 50000ms。

A kind of method of marking protein in fusarium moniliforme resting spore the most according to claim 1, its feature exists In: the culture medium of described step 1) is PDA culture medium, YPD culture medium or Czapek's medium.

A kind of method of marking protein in fusarium moniliforme resting spore the most according to claim 1, its feature exists In described step 1) condition of culture of fusarium moniliforme is: temperature 16-40 DEG C, humidity 15-85%, cultivates 3-15 day.

A kind of method of marking protein in fusarium moniliforme resting spore the most according to claim 1, its feature exists In described step 2) fusarium moniliforme spore suspension before electric shock, in basis of microscopic observation, confirm in spore suspension without mycelia Body mixes pollution and spore is not all sprouted, and shocks by electricity the most again.

A kind of method of marking protein in fusarium moniliforme resting spore the most according to claim 1, its feature exists In: described step 3), RNA to be transformed is the RNA of external source strand coded protein, and this RNA can go out institute at host cell inner expression The protein of coding.

A kind of method of marking protein in fusarium moniliforme resting spore the most according to claim 5, its feature exists In: the RNA of described external source strand coded protein be the coding RNA of green fluorescent protein, the coding RNA of red fluorescent protein or The coding RNA of yellow fluorescence protein.

A kind of method of marking protein in fusarium moniliforme resting spore the most according to claim 6, its feature exists In: utilize following PCR primer amplification green fluorescence protein gene or yellow fluorescent protein gene:

F:5'AGATGACGTCGCTAGCATGGTGAGCAAGGGC 3' ；

R:5'ACGCGTCGACTTACTTGTACAGCTCGT3'；

Near 5 ' the GCTAGC sequences held in primers F, after being used for promoting that this DNA is transcribed into RNA, translation initiation factor is tied with RNA Closing, this sequence is close to the start codon ATG of expressed genes of interest.

A kind of method of marking protein in fusarium moniliforme resting spore the most according to claim 6, its feature exists In: utilize following PCR primer expand red fluorescent protein gene:

Forward primer: RFP-F:5'CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3'；

Downstream primer: RFP-R:5'TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'；

Near 5 ' the GCCACC sequences held in primer RFP-F, after being used for promoting that this DNA is transcribed into RNA, translation initiation factor with RNA combines, and this sequence is close to the start codon ATG of expressed genes of interest.

A kind of method of marking protein in fusarium moniliforme resting spore the most according to claim 6, its feature exists In: described step 3), fusarium moniliforme suspension with the ratio of RNA to be transformed is: the fusarium moniliforme spore suspension of 60 μ l: 10 μ g RNA to be transformed.

A kind of method of marking protein in fusarium moniliforme resting spore the most according to claim 1, its feature exists In: described step 3), shock parameters is as follows: voltage 350 V, pulsewidth 2000ms, is repeated 3 times, every minor tick 500ms.