CN106350496A - Multi-structural-domain endochitinase sourcing from insects, and related biological material and application of multi-structural-domain endochitinase - Google Patents
Multi-structural-domain endochitinase sourcing from insects, and related biological material and application of multi-structural-domain endochitinase Download PDFInfo
- Publication number
- CN106350496A CN106350496A CN201610803226.4A CN201610803226A CN106350496A CN 106350496 A CN106350496 A CN 106350496A CN 201610803226 A CN201610803226 A CN 201610803226A CN 106350496 A CN106350496 A CN 106350496A
- Authority
- CN
- China
- Prior art keywords
- seq
- chitinase
- protein
- chtii
- domain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2442—Chitinase (3.2.1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01014—Chitinase (3.2.1.14)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses multi-structural-domain endochitinase sourcing from insects, and a related biological material and application of the multi-structural-domain endochitinase. A large number of experiments prove that by the chitinase, a chitin substrate can become fluffy in a chitin hydrolyzing process, the acting mode is special, and the multi-structural-domain endochitinase has not been discovered in other kinds of chitinase at present. By the special acting mode, the multi-structural-domain endochitinase can be used for producing chitin oligosaccharides, by the synergistic effect of the multi-structural-domain endochitinase and other chitinase, the chitin can be hydrolyzed effectively, products of the multi-structural-domain endochitinase have wide application prospects in the fields of medicine, food, energy, agriculture and the like, and therefore, the multi-structural-domain endochitinase has important significance and high application value.
Description
Technical field
The invention belongs to biological technical field and in particular to a kind of insecticide source Multidomain endochitinase, its
Related biomaterial and its application.
Background technology
Chitin is that the straight chain being polymerized by β-(1,4) glycosidic bond by β-n- acetylglucosamine is linearly high poly-
Thing, is primarily present in fungal cell wall, in the ectoskeleton of shrimp and crab shells and insecticide.It is that content is only second to fiber in nature
The natural polysaccharide of element, at least 10,000,000,000 tons of annual production, is important regenerative resource.Its derivant and hydrolyzate chitin are few
Sugar has antibacterial, antitumor isoreactivity, is with a wide range of applications in fields such as medical science, food, the energy, agriculturals.
In nature, chitinous degraded is mainly realized by the chitinase belonging to 18 family's glycoside hydrolases.Its
Be mainly distributed on microorganism using chitin as carbon source and by chitin as constituent funguses, Crustacean and elder brother
In worm.Research finds, chitinase can be divided into endochitinase and circumscribed chitinase two class, and endochitinase can
Random cut-out chitin sugar chain, and circumscribed chitinase can cut chitin sugar chain from one end.
The chitinase majority of research at present has higher activity for the tobacco brown spot pathogen after soda acid heat treatment.Pass through
The synergism of inscribe and circumscribed chitinase just can realize chitinous effectively hydrolyzing.However, natural chitin structure
It is very fine and close, chitinase can only act on chitinous surface, efficiency is very low, chitinous fine and close knot can not be destroyed
Structure, what this was serious have impact on chitinous hydrolysis efficiency.Although chitin qualitative change can be made fluffy by soda acid heat-treating methods,
But there is a problem of needing to consume the substantial amounts of energy and pollute environment.How will be fluffy for the chitin qualitative change of compact structure, make several
Ding Zhilian discharges, and is conducive to the hydrolysis of chitinase, is the difficult problem facing in chitinous degradation process.
Content of the invention
By proteomics research, it is found by the applicant that insecticide is responsible for there is one kind in the degraded chitinous ecdysial fluid of epidermis
Unique chitinase chtii.In its enzyme molecule, there is multiple chitin binding structural domains and catalyst structure domain, and
Know that the enzyme with chitin degrading activity of report has very big difference.It hydrolyzes chitin and can make chitinous fine and close knot
Structure becomes fluffy, and in this insecticide, distinctive new chitinase is significant for developing chitin resource.
First, the present invention discloses a kind of protein, specifically a kind of Multidomain endochitinase in insecticide source, its
One of for 1a)～4a):
1a) there is the protein of such as seq id no.3, seq id no.4 or aminoacid sequence shown in seq id no.6；
2a) at seq id no.3, seq id no.4 or the n end of aminoacid sequence and/or c end shown in seq id no.6
Connect the fused protein that label obtains；
3a) by the aminoacid sequence shown in seq id no.3, seq id no.4 or seq id no.6 through 1,2,
The protein with identical function that the replacement of 3,4 or more amino acid and/or disappearance and/or interpolation obtain；
4a) contain seq id no.3, seq id no.4 in ordered list or the aminoacid sequence shown in seq id no.6
There is the protein of identical function.
It is a further object to provide the biomaterial with above-mentioned albumen qualitative correlation.
The present invention provide the biomaterial with above-mentioned albumen qualitative correlation be following 1b) -4b) and in any one；
1b) encode the nucleic acid of above-mentioned protein；
2b) contain 1b) expression cassette of described nucleic acid molecules；
3b) contain 1b) recombinant vector of described nucleic acid molecules or contain 2b) recombinant vector of described expression cassette；
4b) contain 1b) recombinant bacterium of described nucleic acid molecules or contain 2b) recombinant bacterium of described expression cassette or contain 3b) institute
State the recombinant bacterium of recombinant vector.
Another object of the present invention be provide a kind of relevant biological material mentioned above in, 1b) described nucleic acid molecules be as
Lower 1c), 2c) or dna molecule 3c):
1c) the dna molecule as shown in seq id no.2, seq id no.5 or seq id no.7；
2c) with 1c) the dna sequence that limits at least has 70%, at least has 75%, at least have 80%, at least have
85%th, at least have 90%, at least have 95%, at least have 96%, at least have 97%, at least have 98% or at least have
There is the dna molecule of 99% homology code for said proteins；
3c) under strict conditions with 1c) or 2c) the dna sequence hybridization that limits and code for said proteins dna molecule.
In the case of preferably, present invention 4b above) described in recombinant bacterium be by aminoacid sequence such as seq id no.3, seq
Obtain in the encoding gene importing Host Strains of the chitinase shown in id no.4 or seq id no.6,
In present invention recombinant bacterium mentioned above, the encoding gene of described chitinase is to import Host Strains by recombinant vector
's；
Present invention recombinant vector mentioned above is to carry the nucleic acid molecules insertion expression of protein described in coding claim 1
Body, obtains expressing the carrier of protein described in claim 1；The expression vector selected in the embodiment of the present invention is ppic9.
Seq id no.2, seq id in the sequence of the encoding gene of present invention chitinase mentioned above such as sequence table
Shown in no.5 or seq id no.7.
In present invention recombinant bacterium mentioned above, described Host Strains are pichia pastoris phaff gs115.
It is a further object to provide one kind prepares chitinase method.
The chitinase method of preparing that the present invention provides comprises the steps: the above-mentioned recombinant bacterium of fermentation culture, obtains chitin
Matter enzyme.
Above-mentioned protein is falling within one object of the present invention as the application in chitinase.
It is a still further object of the present invention to provide the new application of above-mentioned protein or above-mentioned relevant biological material.
The invention provides above-mentioned protein or above-mentioned relevant biological material are in unhydrolyzed solids chitin, tobacco brown spot pathogen
And/or the application in the product of chitin oligosaccharide.
Present invention also offers the application in preparing chitin oligosaccharide of above-mentioned protein or above-mentioned relevant biological material.
The present invention has cloned a kind of Multidomain endo-chitinase genes having in insecticide and has carried out heterologous
Expression, restructuring enzyme purification and its property research, by proving to the experiment of truncated protein chitinase chtii-b4c1: this chitin
Matter enzyme can make chitin substrate become fluffy during hydrolysis chitin, has special model of action, at present in other
Also it is not found in the chitinase of species.Because total length chtii has more than truncated protein chitinase chtii-b4c1
Many chitin binding structural domains and catalyst structure domain, therefore have reason to believe that its full-length proteins has ratio chitinase chtii-
B4c1 preferably hydrolyzes chitinous effect.Its special model of action can be used for the production of chitin oligosaccharides, with other chitins
Matter enzyme synergism can be realized to chitinous effectively hydrolyzing, and its product has in fields such as medical science, food, the energy, agriculturals
It is widely applied prospect, be of great significance and value.
Brief description
Fig. 1. the gene of Ostrinia furnacalis 2 family chitinase chtii obtains.A: homology obtains pcr product d1 gel electricity
Swimming figure；B: 3 ' race amplified production 3-1 gel electrophoresis figure for the first time；C: second 3 ' race amplified production 3-2 gel electrophoresis figures；
D: 5 ' race amplified production 5-1 gel electrophoresis figure for the first time；E: second homology obtains product d2 gel electrophoresis figure；F:
Smarter 5 race amplified production 5-2 gel electrophoresis figure (purpose band is shown in arrow)；G: first time race walking
Amplified production 5-3 gel electrophoresis figure (purpose band is shown in arrow)；H: second race walking pcr product 5-4 gel
Electrophoretogram (purpose band is shown in arrow)；I: third time race walking pcr product 5-5 gel electrophoresis figure (purpose band
Shown in arrow)；J: 5 ' race amplified production 5-6 gel electrophoresis figure for the third time；K:race checking amplified production chtii gel electricity
Swimming figure.
Fig. 2. the domain composition of chitinase chtii；
Fig. 3. recombiant protein chitinase chtii-c1 after purification, the electrophoretogram of chitinase chtii-b4c1；
Fig. 4. chitinase chtii-c1 is to pnp- (glcnac)2The optimum ph of substrate；
Fig. 5. chitinase chtii-c1 is to pnp- (glcnac)2The optimum temperature of substrate；
Fig. 6. chitinase chtii-c1 is to pnp- (glcnac)2The enzymatic kinetic curve of substrate；
Fig. 7. chitinase chtii-c1, the chtii-b4c1 enzyme kineticss double reciprocal curve to tobacco brown spot pathogen substrate；
Fig. 8. chitinase chtii-c1, the chtii-b4c1 Langmuir adsorption isothermal curve to tobacco brown spot pathogen substrate；
Fig. 9. chitinase chtii-c1, chtii-b4c1 change over to tobacco brown spot pathogen substrate hydrolysis；
Figure 10. chitinase chtii-b4c1 changes over to solid chitin substrate hydrolysis；Ck: comparison；
Figure 11. chitinase chtii-b4c1 is to the sem observation after solid chitin substrate hydrolysis；
Figure 12. chitinase chtii-b4c1 is to the transmission electron microscope observation after solid chitin substrate hydrolysis.
Specific embodiment
Following nonlimiting examples can make those of ordinary skill in the art that the present invention is more fully understood, but not with
Any mode limits the present invention.In embodiment, experimental technique used if no special instructions, is conventional method, is used
Material, reagent if no special instructions, all can obtain from commercial channels.
The embodiment of the present invention 1 the primer is synthesized by commercial sources, and relevant information is as follows:
D1-f-outer:5 '-cttgggcgatagacttggacgac-3 ',
D1-r-inner:5 '-tgtgagaagttctacgtttgcgtga-3 ',
D1-f-outer:5 '-ggrtactcccagtsgakgtc-3 ',
D1-r-inner:5 '-ccagtsgakgtccakyccgtcraa-3 ',
3r1-outer:5 '-tgcaactcaacgatgaagttcct-3 ',
3r1-inner:5 '-gtacgcaatgctcccgactgact-3 ',
3r2-outer:5 '-agtgccagttttagctcgccttct-3 ',
3r2-inner:5 '-ccaacggccttaatattcctgtc-3 ',
5r1-outer:5 '-agacgggttttgtaggcttagagg-3 ', '
5r1-inner:5 '-gagttgcatagaggtagattccc-3 ',
D2-f-outer:5 '-ggamhgactcvshaggvgayaarta-3 ',
D2-f-inner:5 '-ttggaactatcccgtttgctggc-3 ',
D2-r-outer:5 '-tagtggtggtcgtgctgggcgt-3 ',
D2-r-inner:5 '-cacagcagcggttgttgaagtc-3 ',
5r2-outer:5 '-cgccaccttttagaagagctttgat-3 ',
5r2-inner:5 '-caggaacaagtggggtatgatgcc-3 ',
5r3-outer:5 '-cataattcgccttatcggacgctg-3 ',
5r3-inner:5 '-gaagttgtgcatgcgcaggaaaggta-3 ',
5r4-outer:5 '-cccaatccaaggagtactttgacg-3 ',
5r4-inner:5 '-gtcggtcctcttcgcacagcatt-3 ',
5r5-outer:5 '-atacacttagcgacatccaaatgacc-3 ',
5r5-inner:5 '-cgttgaaatggtgctcagtattggga-3 ',
5r6-outer:5 '-gtcgaataatgcgaatgaattgccag-3 ',
5r6-inner:5 '-tgccagcttcatcgaatgcaaccac-3 ',
Chtii-f-outer:5 '-tcgcgacacgcacggcctaaacgca-3 ',
Chtii-f-inner:5 '-acggcctaaacgcaggcgcatcttc-3 ',
Chtii-r-outer:5 '-gcaagtacctatattgaacg-3 ',
Chtii-r-inner:5 '-gctagcgtggctattcctagtctaa-3 ',
c1-f:5′-aagcttacgtagaattctccttgcttaattctaggta-3′；
c1-r:5′-ggcgaattaattcgcggccgcttaatggtgatgatgatggtgactagtaggcttatgtggc
ttctgct-3′；
b4c1-f:5′-aagcttacgtagaattctcgggagacaatccgttcga-3′；
b4c1-r:5′-ggcgaattaattcgcggccgcttaatggtgatgatgatggtgactagtaggcttatgtg
gcttctgct-3′.
Embodiment 1. Ostrinia furnacalis group ii chitinase gene homology obtains
1. the acquisition of conserved sequence
Carry out packet to biological group ii chitinase genes various in document using clustalw2 to compare, according to
Conserved sequence designs degenerate primer d1-f-outer, d1-r-inner, d1-f-outer, d1-r-inner.During being in prepupa
Ostrinia furnacalis ostrinia furnacalis (guenee) (coming from Plant Protection institute, Chinese Academy of Agricultral Sciences) of phase
For material, total rna is extracted using rnaiso plus reagent (purchased from Dalian takara company), and adopts primescript
Reverse transcriptase test kit (purchased from Dalian takara company) reverse transcription becomes cdna as template.Using above-mentioned
The primer of design, carries out nido pcr reaction using la-taq dna polymerase (purchased from Dalian takara company), expands first
Fragment.Pcr amplified production electroresis appraisal result is as shown in Figure 1a.Amplified production fragment length 252bp, its nucleotide sequence is such as
Shown in seq id no.1.This sequence and reference sequences similarity very high it may be determined that being Ostrinia furnacalis group chitin
Enzyme gene homologous sequence.
2.3′race
The known array (252bp) being acquired according to homology before, designs 3 ' race primers: 3r1-outer, 3r1-
inner.Expanded using 3 ' race test kits with above-mentioned primer respectively, obtained pcr amplified production electroresis appraisal result as schemed
Shown in 1b.Glue reclaim is cut to 3 ' race products, and it is sequenced, find to be not up to 3 ' ends, primer is designed according to known array
3r2-outer, 3r2-inner carry out second 3 ' race, are expanded using 3 ' race test kits with above-mentioned primer respectively,
Pcr amplified production electroresis appraisal result is as illustrated in figure 1 c.Glue reclaim is cut to 3 ' race products, and it is sequenced and sequence alignment,
Determine that the 3 ' race pcr products obtaining are Ostrinia furnacalis group chitinase gene 3 ' terminal sequences, have arrived at termination
Codon.
2.5′race
Designed according to the known array that homology acquires, design primer: 5r1-outer, 5r1-inner；More than respectively
State primer to be expanded using 5 ' race test kits, pcr amplified production electroresis appraisal result is as shown in Figure 1 d.To 5 ' race products
Cut glue reclaim, and it is sequenced and sequence alignment, gained sequence is purpose sequence, but do not reach 5 ' ends.
3. second homology obtains
According to existing known array design primer and homologous sequence conservative region design primer d2-f-outer,
D2-f-inner, d2-r-outer, d2-r-inner, carry out nido pcr, the pcr product electrophoresis mirror of acquisition using above-mentioned primer
Determine result as shown in fig. le, glue reclaim is cut to each product, and it is sequenced and sequence alignment, obtain the homologous sequence of chtii.
4.smarter 5ˊrace
In the sequence basis that step 3 homology acquires, using smartertm race cdna amplification
Kit carries out 5 ' race.Primer 5r2-outer, 5r2-inner are designed according to known array, is adopted with above-mentioned primer respectively
Smartertm race cdna amplification kit test kit is expanded, and pcr amplified production electroresis appraisal result is such as
Shown in Fig. 1 f.Glue reclaim is cut to purpose product, and it is sequenced and sequence alignment, confirmation gained sequence is purpose sequence, but not
Reach 5 ' ends, proceed race walking.According to known primers 5r3-outer, 5r3-inner；First
Secondary race walking, pcr amplified production electroresis appraisal result is as shown in Figure 1 g.Glue reclaim is cut to purpose product, and it is surveyed
Sequence and sequence alignment, confirmation gained sequence is purpose sequence, but still does not reach 5 ' ends, proceeds race walking.Root
According to known primers 5r4-outer, 5r4-inner；Second race walking, pcr amplified production electrophoresis reflects
Determine result as shown in figure 1h.Glue reclaim is cut to purpose product, and it is sequenced and sequence alignment, confirmation gained sequence is purpose sequence
Row, but still do not reach 5 ' ends, proceed race walking.According to known primers 5r5-outer, 5r5-
Inner, third time race walking, pcr amplified production electroresis appraisal result is as shown in figure 1i.Cut glue to purpose product to return
Receive, and it is sequenced and sequence alignment, confirmation gained sequence is purpose sequence, but still do not reach 5 ' ends, change sample and continue
Carry out 5 ' race.Design primer is 5r6-outer, 5r6-inner；Pcr amplified production electroresis appraisal result is as shown in fig. ij.Right
Purpose product cuts glue reclaim, and it is sequenced and sequence alignment, and gained sequence is purpose sequence, at its 5 ' end after sequence assembly
Find termination codon before start codon, show that the gene order obtaining has reached the noncoding region at 5 ' ends.
5. complete sequence checking
According to the primers that obtain of splicing, chtii-f-outer, chtii-f-inner, chtii-r-outer,
chtii-r-inner；Respectively nido pcr reaction, pcr amplified production electroresis appraisal result such as Fig. 1 k institute are carried out with above-mentioned primer
Show.Glue reclaim is cut to the purpose product of about 9k, and it is sequenced and sequence alignment, confirm that this sequence is Ostrinia furnacalis group
Chitinase gene full length sequence.
As shown in seq id no.2, length is 9077bp, wherein cds area 8790bp to its nucleotide sequence, is named as
ofchtii.Amino acid sequence analysis are carried out to this ofchtii gene thus it is speculated that going out the 157-8943 position core of this nucleotide sequence
Thuja acid encodes 2929 aminoacid, and its aminoacid sequence is as shown in seq id no.3.8944-8952 position nucleotide was three ends
Only codon tagtaataa.Amino acid sequence analysis show that this 2929 aminoacid have 7 chitin binding structural domain: b1
(aa520-571)；b2(aa1100-1149)；b3(aa1228-1276)；b4(aa1313-1362)；b5(aa1415-1463)；
b6(aa1494-1543)；B7 (aa2489-2536), (as Fig. 2) and 5 chitinases catalyst structure domain n1 (aa145-484)；
n2(aa630-969)；N3 (aa2560-2896), c1 (aa1616-1967), c2 (aa2062-2403) (as Fig. 2).By amino
Acid sequence homology analysis find, its 3rd and the 4th catalyst structure domain contain all of conservative amino participating in being catalyzed
This two catalytic domains are named as c1, c2 by acid respectively successively；And there is mutation in the 1st, 2,5 its catalytic amino acid of catalytic domain, point
It is not named as n1, n2, n3 (n1-n3, the such as domain of Fig. 2 chitinase chtii form).
Embodiment 2 chitinase gene chtii-c1, the acquisition of chtii-b4c1 and clone
1. the acquisition of chitinase gene chtii-c1, chtii-b4c1
According to the domains characteristic of chtii, the present embodiment 2 have chosen independent one active catalytic domain c1, and
One section of aminoacid b4c1 containing chitin binding structural domain and active catalytic domain is expressed.Respectively in accordance with c1 (as sequence table
Middle seq id no.4) and b4c1 (as seq id no.6 in sequence table) aminoacid sequence, and to the codon of c1 part
Preference is optimized, and using the method for full genome synthesis, is respectively synthesized as seq id no.5 and seq id in sequence table
The base sequence of no.7.
2. the clone of chitinase gene chtii-c1, chtii-b4c1
The present invention chooses pichia yeast expression system and carries out restructuring table to chtii truncate chtii-c1 and chtii-b4c1
Reach, genes of interest is cloned in ecori the and noti restriction enzyme site of expression vector ppic9, and add at the c end of recombiant protein
6 histidine are used for isolating and purifying.Separately design primer following c1-f, c1-r, b4c1-f, b4c1-r for corresponding gene piece
Duan Jinhang pcr expands.Expression vector ppic9 uses dna restricted enzyme ecori and noti (public purchased from Dalian takara first
Department) carry out linearisation, then test kit (purchased from clontech company) is connected by in-fusion, chtii-c1 will be contained,
The pcr product of chtii-b4c1 gene order is connected respectively in ppic9.Obtain contains chtii-c1, chtii-b4c1 base
The recombiant plasmid of cause is named as ppic9-c1 and ppic9-b4c1, determines genes of interest (seq id no.5 and seq through sequencing
The base sequence of id no7) it is cloned in expression vector ppic9.
Embodiment 3 chitinase chtii-c1, the expression of chtii-b4c1 and purification
1. the structure of recombinant pichia yeast strain
By the recombiant plasmid ppic9-c1 obtaining in embodiment 2, ppic9-b4c1, by electroporated method, turns respectively
Change in Pichi strain gs115, by histidine deficient plate screening positive bacterium colony.Further by the method for pcr
Whether the yeast cells of identification restructuring contain genes of interest.Screen and adopt after ypd culture activation for positive cell, add dense eventually
Spend the glycerol for 30% and deposit in -80 DEG C of Refrigerator stores, for the expression of subsequent protein.
2. the expression of recombinant pichia yeast strain
Take out the bacterium preserving in step 1 under aseptic condition to protect, single bacterium is obtained using histidine deficient plate loop method
Fall.Picking single bacterium colony, is inoculated in 10mlypd culture medium, 30 DEG C, activated strains under the conditions of 200rpm.After activation
Bacterial strain is added in 100mlbmgy culture medium with 1% ratio, and under the conditions of 200rpm, culture 24h amplification is so as to od (600nm)
Value reaches 2-4.The yeast cells suspension of activation is transferred in centrifuge tube, cell under the conditions of 4500rpm, is collected by centrifugation.Abandon
Clearly, with after the resuspended thalline of a little bmmy culture medium, it is transferred in 500mlbmmy culture medium.Then every 100ml is divided in
In 500ml triangular flask, cultivate under conditions of 30 DEG C, 200rpm.Carry out abduction delivering every the methanol that 24h adds 1%, continue
5 days (120h) of induction.
3. chitinase chtii-c1, chtii-b4c1 isolate and purify
Take the fermentation liquid in step 2 respectively, under the conditions of 4 DEG C, 8000rpm, supernatant is collected by centrifugation.Sulfur is added in supernatant
Sour ammonium makes its saturation reach 75% (476g/l), stands overnight protein precipitation in 4 DEG C of refrigerators.In 4 DEG C, 12000rpm condition
Lower centrifugation 20min collects ammonium sulfate precipitation.Then by resolution of precipitate in ni-a buffer (20mm phosphate, ph7.4；500mm
Nacl in).By metal chelate chromatography, using ge company imac sepharose (5ml) chromatographic column to containing histidine mark
The chitinase chtii-c1 signing, chtii-b4c1 are isolated and purified.First, adopt ni-a buffer with the stream of 1ml/min
Fast pre-equilibration chromatographic column；Then, by sample with the flow velocity loading of 1ml/min, continue after loading to be reached with ni-a buffer solution for cleaning
Balance；Afterwards, respectively with the ni-a buffer containing 20mm imidazoles, and the ni-a buffer of 50mm imidazoles be respectively washed non-specific
Property combine recombiant protein, until balance；Finally, carry out eluting with the ni-a buffer containing 250mm imidazoles, obtain after purification
Recombiant protein chitinase chtii-c1, chtii-b4c1, be respectively designated as chitinase chtii-c1 and chitinase
Chtii-b4c1, as shown in Figure 3.
The determination of activity of embodiment 4 chitinase
Because the truncated protein chitinase chtii-c1 and chitinase chtii-b4c1 of chtii contain identical activity
Catalyst structure domain, therefore for the model substrate pnp- (glcnac) of chitinase2(sigma, st louis, mo, usa), this
Embodiment only lists the activity determination method isolating and purifying the chitinase chtii-c1 obtaining in embodiment 2.
1. the determination of optimum ph
Measure the vigor of chitinase chtii-c1 under different ph: using the reaction system of 60 μ l, with pnp- (glcnac)2
For substrate, final concentration of 0.1mm.Take the chitinase chtii-c1 ph different from 48.8 μ l obtaining in 10 μ l embodiments 2 respectively
Britton-robinson buffer mix in 96 orifice plates after add the pnp- (glcnac) of 1.2 μ l 5mm2, anti-at 30 DEG C
Answer 30min (controlling base consumption to be less than 20%).Reaction adds the na of 60 μ l 0.5mm after terminating2co3Terminating reaction,
Mensuration absorbance under 405nm wavelength condition.With ph as abscissa, the product amount recording under the conditions of different ph is mapped for vertical coordinate,
The optimum ph determining chitinase chtii-c1 is between 5-6 (as Fig. 4).
2. the determination of optimum temperature
Measure the vigor of chitinase chtii-c1 under different temperatures: using the reaction system of 60 μ l, with pnp-
(glcnac)2For substrate, final concentration of 0.1mm.Take the chitinase chtii-c1 and 48.8 obtaining in 10 μ l embodiments 2 respectively
μ l ph is 6.0 phosphate buffer mixing, in the preheating temperature 5min of different tests.Add the pnp- of 1.2 μ l 5mm
(glcnac)2, react 30min.Reaction adds the na of 60 μ l 0.5mm after terminating2co3Terminating reaction, measures 405nm wavelength light and shines
Under the conditions of absorbance.According to the product formation mapping measuring under different temperatures, determine chitinase chtii-c1 to substrate
pnp-(glcnac)2Optimum temperature be 30 DEG C (as Fig. 5).
3. chitinase chtii-c1 is to pnp- (glcnac)2The kinetic constant of substrate
Using the reaction system of 60 μ l, Final substrate concentrations are 0.01mm, 0.02mm, 0.03mm, 0.04mm, 0.05mm,
0.06mm, 0.07mm, 0.08mm, 0.1mm, 0.15mm and 0.2mm.It is separately added into the chitin obtain in 10 μ l embodiments 2
Enzyme chtii-c1, the residual volume phosphate buffer polishing of ph 6.0, mix in 96 orifice plates, react under the conditions of 30 DEG C
30min.The na of 60 μ l 0.5m is added after the completion of reaction2co3Terminating reaction, measures the absorbance under 405nm wavelength condition.Using double
Graphing method reciprocal, with the inverse of concentration of substrate as abscissa, with the inverse of product paranitrophenol concentration as vertical coordinate, makes one
Bar straight line, this straight line is -1/km with the intersection point of abscissa, can try to achieve chitinase chtii-c1 to pnp- (glcnac)2Km
For 0.0958mm (as Fig. 6).
Embodiment 5 chitinase chtii-c1, the Nature comparison of chtii-b4c1
1. chitinase chtii-c1, chtii-b4c1 compare to the catalytic kineticses constant of tobacco brown spot pathogen
Reacted using the reaction system of 100 μ l in the centrifuge tube of 1.5ml.Final substrate concentrations respectively 0.5mg/ml,
0.75mg/ml, 1.0mg/ml, 1.5mg/ml, 2.0mg/ml, 3.0mg/ml, 4.0mg/ml, are separately added in 10 μ l embodiments 2
Chitinase chtii-c1 and chtii-b4c1 obtaining, the residual volume phosphate buffer polishing of ph 6.0.By centrifuge tube
As for reaction 2h in 30 DEG C of water-baths.Reaction measures, using the method that the potassium ferricyanide surveys reducing sugar, the reducing sugar producing after terminating
Amount.The k of 300 μ l 2.0g/l is added in 100 μ l reactant liquors3[fe(cn)6], it is placed in 100 DEG C of boiling water and boil 15min.
Under 12000rpm, centrifugation 5min precipitates the albumen after remaining chitin and degeneration, takes 200 μ l supernatants to be added in 96 orifice plates, surveys
Determine the absorbance under 405nm wavelength.Using double-reciprocal plot method, with the inverse of concentration of substrate as abscissa, with the reduction producing
The inverse of sugared concentration is vertical coordinate, makes straight line, and this straight line is -1/km with the intersection point of abscissa, then can ask respectively
Obtain chitinase chtii-c1 and chtii-b4c1 and 1.806mg/ml and 1.205mg/ml is respectively (such as to the km of tobacco brown spot pathogen
Fig. 7), maximum reaction rate vmax is respectively 1.107 and 2.444, and the affinity to substrate for the chitinase chtii-b4c1 is described
Higher, reaction is rapider.
2. chitinase chtii-c1 and chtii-b4c1 is compared with tobacco brown spot pathogen binding ability
Na using 10mm, ph8.0 of ionic strength very little2hpo4Buffer is strong to reduce ion as level pad
The impact of degree.The gradient scope of the final concentration of protein of chitinase chtii-c1 and chtii-b4c1 in the reaction system of 300 μ l
For 0.5 μm, 1.0 μm, 1.5 μm, 2.0 μm, 2.5 μm, the final concentration of 3mg/ml of substrate tobacco brown spot pathogen.Residual volume is used
The phosphate buffer polishing of ph8.0.Using the bsa of comparable sodium, react at identical conditions as negative control.Using rotation
Turn mixing agitator and fully mix system, react two hours under room temperature.Centrifuging and taking supernatant solution after reaction, uses Coomassie Brilliant Blue
Survey the concentration of albumen in supernatant.Protein concentration according to supernatant can draw the protein content of combination, indirectly tries to achieve uncombined albumen
Amount.With unconjugated protein concentration as abscissa, protein-bonded concentration maps (as Fig. 8) for vertical coordinate.By Langmuir
Isothermal adsorpting equation tries to achieve chitinase chtii-c1, the constant k that chtii-b4c1 is combined with tobacco brown spot pathogendIt is respectively
0.5552 and 0.3316, illustrate that the chitinous ability of chitinase chtii-b4c1 association colloid is higher.
3. chitinase chtii-c1 and the chitinous expression activitiy of chtii-b4c1 hydrocolloid
Reacted using the reaction system of 300 μ l in 1.5ml centrifuge tube.Including final concentration of 5 μm of enzyme, final concentration of
The chitin of 2mg/ml, the residual volume phosphate buffer polishing of ph6.0.1.5ml centrifuge tube is lain in a horizontal plane in 30 DEG C
Constant incubator in be incubated, respectively react 0.5h, 1h, 2h, 4h, 8h, 20h.Measured using the potassium ferricyanide method in step 1 and produce
The content of reducing sugar in thing, with the response time as abscissa, production concentration is mapped for vertical coordinate.Result is as shown in figure 9, adding
In the case of equimolar enzyme, chitinase chtii-c1 is identical with the chitinase catalytic domain contained by chtii-b4c1.Chitin
The product amount that matter enzyme chtii-b4c1 hydrocolloid chitin produces, apparently higher than chitinase chtii-c1, illustrates its activity relatively
Chtii-c1 significantly improves.
By step 1, can learn containing three for the comparison of chitinase chtii-c1 and chtii-b4c1 in 2,3
The chitinase chtii-b4c1 of chitin binding structural domain has higher affinity and hydrolysing activity to substrate.
Embodiment 6 chitinase chtii-b4c1 chitinous effect to solid
Present embodiments provide the solid chitin hydrolyzing difficult degradation with the chitinase chtii-b4c1 obtaining in embodiment 2
The embodiment of matter.
1. the observation to solid chitin powder hydrolysis for the chitinase chtii-b4c1
0.2mlpcr pipe is reacted using 0.2ml reaction system, is comprised several in final concentration of 1 μm of embodiment 2
Fourth matter enzyme chtii-b4c1, concentration is the solid chitin of 4mg/ml, the residual volume phosphate buffer of 0.1m ph6.0
Polishing.It is placed in 0.2ml centrifuge tube after solution mixing, lies in a horizontal plane in 30 DEG C, concussion in the shaking table of 200rpm is reacted.With
Add comparable sodium solid chitin powder, not enzyme-added as a control group.In different time points sampling, centrifuge tube is vertically put
Put, static 10min with allow solid chitin settle, the situation that before and after observing response, chitin increases or decreases.Permissible by Figure 10
Find out, compared with not enzyme-added matched group, prolongation over time, add the solid chitin plastid of chitinase chtii-b4c1
Long-pending change is big, and the hydrolysis that this phenomenon is likely due to chitinase chtii-b4c1 leads to chitin granule to become fluffy.
2. the microexamination of the hydrolysis to solid chitin powder for the chitinase chtii-b4c1
In 2ml centrifuge tube, the reaction system using 1ml is reacted.Comprise chitin in final concentration of 1 μm of embodiment 2
Matter enzyme chtii-b4c1, concentration is the solid chitin of 4mg/ml, and residual volume is mended with the phosphate buffer of 0.1m ph6.0
Together.After solution mixing, centrifuge tube is lain in a horizontal plane in 30 DEG C, concussion in the shaking table of 200rpm is reacted.After 167 hours, pass through
Scanning electron microscope (fei company of U.S. nova nanosem 450) and transmission electron microscope (Japanese jem2000ex) are seen
Examine enzyme hydrolysiss experimental group chitinous structure change of solid compared with not enzyme-added matched group.
Sem observation condition: question response takes the centrifugation of 0.1ml sample to remove supernatant after terminating, add
0.5ml100% washes of absolute alcohol once, abandons supernatant after centrifugation, add the dehydrated alcohol of 0.1ml to preserve.Take first during observation
So as to spread out on silicon chip on the silicon chip of 0.4cm × 0.4cm that the reacted chitin of 10 μ l drops in well cutting.Then
Metal spraying, puts in scanning electron microscope, is observed under the conditions of 3.0kv.As shown in figure 11, chtii-b4c1 hydrolyzes result
The edge of chitin granule is no longer clear afterwards, and structure becomes loose, there is some fibre and departs from from big granule and discharges.
Transmission electron microscope observation condition: question response takes the centrifugation of 0.1ml sample to remove supernatant after terminating, add
0.5ml100% washes of absolute alcohol once, abandons supernatant after centrifugation, add the dehydrated alcohol of 0.1ml to preserve.First will during observation
10 μ l chitins drop on the copper mesh of the common carbon film of 200 purposes, are observed under the conditions of 120kv.Result is as shown in figure 12,
After b4c1 hydrolysis, chitin granule becomes loose, around has tiny fiber to be present in around larger particles.
Claims (9)
1. a kind of protein it is characterised in that: for 1a)～4a) one of:
1a) there is the protein of such as seq id no.3, seq id no.4 or aminoacid sequence shown in seq id no.6；
2a) connect in seq id no.3, seq id no.4 or the n end of aminoacid sequence shown in seq id no.6 and/or c end
The fused protein that label obtains；
3a) aminoacid sequence shown in seq id no.3, seq id no.4 or seq id no.6 is passed through one or more ammonia
The protein with identical function that the replacement of base acid residue and/or disappearance and/or interpolation obtain；
4a) contain seq id no.3, seq id no.4 in ordered list or the aminoacid sequence shown in seq id no.6 has
The protein of identical function.
2. a kind of biomaterial of albumen qualitative correlation as claimed in claim 1 it is characterised in that: for following 1b)～4b) in one
Kind；
1b) the nucleic acid of protein described in coding claim 1；
2b) contain 1b) expression cassette of described nucleic acid molecules；
3b) contain 1b) recombinant vector of described nucleic acid molecules or contain 2b) recombinant vector of described expression cassette；
4b) contain 1b) recombinant bacterium of described nucleic acid molecules or contain 2b) recombinant bacterium of described expression cassette or contain 3b) described heavy
The recombinant bacterium of group carrier.
3. protein relevant biological material according to claim 2 it is characterised in that: described in 1b), nucleic acid molecules are
One of 1c), 2c) or 3c):
1c) the dna molecule as shown in seq id no.2, seq id no.5 or seq id no.7；
2c) and 1c) the dna sequence that limits at least has 70%, at least has 75%, at least having 80%, at least having 85%,
At least have 90%, at least have 95%, at least have 96%, at least have 97%, at least have 98% or at least have
The dna molecule of 99% homology code for said proteins；
3c) under strict conditions with 1c) or 2c) the dna sequence hybridization that limits and code for said proteins dna molecule.
4. protein relevant biological material according to claim 2 it is characterised in that: recombinant bacterium described 4b) is by ammonia
The encoding gene of chitinase as shown in seq id no.3, seq id no.4 or seq id no.6 for the base acid sequence imports place
Obtain in main bacterium.
5. protein relevant biological material according to claim 4 it is characterised in that: in recombinant bacterium described 4b), pass through
The volume of recombinant vector chitinase as shown in seq id no.3, seq id no.4 or seq id no.6 by aminoacid sequence
Code channel genes Host Strains.
6. protein relevant biological material according to claim 5 it is characterised in that: in recombinant bacterium described 4b), described
Host Strains are pichia pastoris phaff gs115.
7. the biomaterial of protein as claimed in claim 1 or albumen qualitative correlation as claimed in claim 2 is several in unhydrolyzed solids
Application in the product of Ding Zhi, tobacco brown spot pathogen and/or chitin oligosaccharide.
8. chitin widow prepared by the biomaterial of protein as claimed in claim 1 or albumen qualitative correlation as claimed in claim 2
Application in sugar.
9. one kind prepare chitinase method it is characterised in that: comprise the steps: fermentation culture egg as claimed in claim 2
4b in the related biomaterial of white matter) recombinant bacterium, obtain chitinase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610803226.4A CN106350496B (en) | 2016-09-06 | 2016-09-06 | A kind of Multidomain endochitinase in insect source, its relevant biomaterial and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610803226.4A CN106350496B (en) | 2016-09-06 | 2016-09-06 | A kind of Multidomain endochitinase in insect source, its relevant biomaterial and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106350496A true CN106350496A (en) | 2017-01-25 |
| CN106350496B CN106350496B (en) | 2019-11-26 |
Family
ID=57858980
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610803226.4A Active CN106350496B (en) | 2016-09-06 | 2016-09-06 | A kind of Multidomain endochitinase in insect source, its relevant biomaterial and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106350496B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109258693A (en) * | 2018-09-30 | 2019-01-25 | 大连理工大学 | Application of the recombinant chitinase at desinsection or antibacterial aspect |
| CN115125227A (en) * | 2022-05-23 | 2022-09-30 | 中国农业科学院植物保护研究所 | Chitin complex enzyme and application thereof |
| CN115851675A (en) * | 2022-08-04 | 2023-03-28 | 广西科学院 | N-terminal truncated mutant of chitinase and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103340909A (en) * | 2013-06-07 | 2013-10-09 | 浙江五养堂药业有限公司 | Biological wall-breaking method of powder |
| CN103450352A (en) * | 2013-08-30 | 2013-12-18 | 中国农业科学院饲料研究所 | Chitin-binding protein CBP21 and encoding genes and applications thereof |
| CN105062993A (en) * | 2015-08-19 | 2015-11-18 | 中国农业大学 | Exo-chitinase originating from environment, and encoding genes and application of exo-chitinase |
| CN105624177A (en) * | 2016-02-04 | 2016-06-01 | 浙江大学 | Insect-fusion-resistant gene, coding protein, carrier and application thereof |
-
2016
- 2016-09-06 CN CN201610803226.4A patent/CN106350496B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103340909A (en) * | 2013-06-07 | 2013-10-09 | 浙江五养堂药业有限公司 | Biological wall-breaking method of powder |
| CN103450352A (en) * | 2013-08-30 | 2013-12-18 | 中国农业科学院饲料研究所 | Chitin-binding protein CBP21 and encoding genes and applications thereof |
| CN105062993A (en) * | 2015-08-19 | 2015-11-18 | 中国农业大学 | Exo-chitinase originating from environment, and encoding genes and application of exo-chitinase |
| CN105624177A (en) * | 2016-02-04 | 2016-06-01 | 浙江大学 | Insect-fusion-resistant gene, coding protein, carrier and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| CHEN,W.: "group II chitinase [Ostrinia furnacalis]GenBank: ASO66823.1", 《GENBANK》 * |
| 无: "probable chitinase 10 [Spodoptera litura]NCBI Reference Sequence: XP_022819856.1", 《NCBI》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109258693A (en) * | 2018-09-30 | 2019-01-25 | 大连理工大学 | Application of the recombinant chitinase at desinsection or antibacterial aspect |
| CN109258693B (en) * | 2018-09-30 | 2021-03-16 | 大连理工大学 | Application of recombinant chitinase in insecticidal or bacteriostatic aspects |
| CN115125227A (en) * | 2022-05-23 | 2022-09-30 | 中国农业科学院植物保护研究所 | Chitin complex enzyme and application thereof |
| CN115125227B (en) * | 2022-05-23 | 2024-01-30 | 中国农业科学院植物保护研究所 | Chitin complex enzyme and application thereof |
| CN115851675A (en) * | 2022-08-04 | 2023-03-28 | 广西科学院 | N-terminal truncated mutant of chitinase and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106350496B (en) | 2019-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109295043A (en) | A kind of novel algin catenase, preparation method and application | |
| CN109628433B (en) | Pullulanase with high secretion capacity and application thereof | |
| WO2013087043A1 (en) | Flavobacterium strain, endo-alginate lyase encoding gene, and preparation and use of said gene | |
| CN106995811B (en) | A kind of algin catenase, preparation method and application | |
| CN106350496A (en) | Multi-structural-domain endochitinase sourcing from insects, and related biological material and application of multi-structural-domain endochitinase | |
| Gao et al. | Enhanced carboxymethylcellulase production by a newly isolated marine bacterium, Cellulophaga lytica LBH-14, using rice bran | |
| CN103103206B (en) | Alpha-amylase and gene of alpha-amylase, engineering bacteria containing gene and application of engineering bacteria | |
| CN104911197B (en) | The acquisition methods of the natural variation body of enzyme and super heat resistant fibre disaccharide-hydrolysing enzymes | |
| Ojwach et al. | Purification and biochemical characterization of an extracellular fructosyltransferase enzyme from Aspergillus niger sp. XOBP48: implication in fructooligosaccharide production | |
| Tang et al. | The function of CBM32 in alginate lyase VxAly7B on the activity on both soluble sodium alginate and alginate gel | |
| CN105695436B (en) | Heat resistance xylobiase | |
| Kovaleva et al. | Characteristics of inulinases: methods for regulation and stabilization of their activity | |
| CN105176949B (en) | A kind of cellobiohydrolase mutant | |
| CN107974438A (en) | A kind of 'beta '-mannase in micro- spore head mold source and its encoding gene and application | |
| CN107267484A (en) | A kind of α glycosidases, encoding gene, carrier, engineering bacteria and the application of grand gene source | |
| CN108865913B (en) | Method for constructing recombinant bacterium capable of efficiently secreting and expressing chondroitin sulfate hydrolase | |
| CN103865905B (en) | A kind of endoglucanase | |
| Zhu et al. | Purification and characterization of an intracellular β-glucosidase from the protoplast fusant of Aspergillus oryzae and Aspergillus niger | |
| TW201716571A (en) | Agarase, composition containing the same, and application thereof | |
| CN105154416B (en) | A kind of cellobiohydrolase mutant and its application | |
| Velikodvorskaya et al. | Family 28 carbohydrate-binding module of the thermostable endo-1, 4-β-glucanase CelD from Caldicellulosiruptor bescii maximizes enzyme activity and irreversibly binds to amorphous cellulose | |
| CN113046378B (en) | Incision alginate lyase, coding gene and application thereof | |
| CN105886520B (en) | The mutated gene TlXynA_2 of zytase TlXynA a kind of and its application | |
| CN110205313B (en) | Expression and purification method of aspergillus awamori beta-1, 3-1, 4-glucanase | |
| CN103667212B (en) | Glucoamylase and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |