CN106318941A - Glucose derepression induction promoter and terminator, and applications of promoter and terminator - Google Patents

Abstract

A promoter and a terminator which can be widely applied to gene expression, genetic engineering operation and strain improvement of Rhodosoporidium, Sporidiobolus, Sporobolomyces and Rhodotorula in red yeast through amplifying the upstream and downstream sequences of Rhodosporidium toruloides glucose derepression induction alcohol dehydrogenase Adh2 genome DNA and carrying out biological information analysis and functional verification, the nucleotide sequence of the promoter is represented by SEQ ID NO:1, and the nucleotide sequence of the terminator is represented by SEQ ID NO:2. The invention also relates to a DNA expression box or a recombinant vector containing above elements, a method using the correlated elements to construct Rhodosoporidium, Sporidiobolus, Sporobolomyces and Rhodotorula gene engineering strains, and corresponding strains.

Description

A kind of glucose derepresses evoked promoter and terminator and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to the promoter of circle rhodosporidium toruloides (Rhodosporidium toruloides) eventually Only son and application thereof, including method for transformation necessary to construction method of gene engineering strain etc..

Background technology

Microorganism is to be distributed one of widest species in nature, has the biosynthesis ability of brilliance, almost can synthesize on the earth all of Organic chemicals.Compared with multicellular organism, although the metabolic pathway of microorganism is relatively easy, but the production of its compound is efficiently, fast, Have reaction condition gentleness, controllability is strong, be prone to the features such as large-scale production, can be as an excellent cell factory.

In nature, a part of microorganism can exceed the oils and fats of its dry cell weight 20% under given conditions (as nitrogen source lacks) in intracellular storage, its In based on triglyceride, the microorganism with this phenotype is referred to as oleaginous microorganism, including antibacterial, yeast, mycete, algae etc. (Ratledge, C.and Wynn,J.P.Adv Appl Microbiol,2002,51,1-51.).Utilize microorganism conversion of biomass resource to produce oils and fats, can develop into Substantially be independent of ploughing, can produce continuously, reduce the new technique of agricultural pollution, comprehensive utilization of resources, is that the fossil resources forming chemicals substitutes Production ways that product are new (Zhao Zongbao. Chinese biological engineering magazine, 2005,25,8-11.).Natural production bacterial strain or environment as a certain chemicals are controlled Ought to use bacterial strain, its specific production performance is often and non-optimized.How to optimize or change metabolism network and the expression regulation network of industrial strain, To improve the accumulating rate of biobased products or the quality of oriented control target product, it is the genetic engineering modified focus of current biological technical field and difficulty Point.Although for some conventional yeasts genetic engineering modified the most ripe (Alper H, Stephanopoulos G.Nat Rev Microbiol, 2009,7,715-723.), but the genetic manipulation for these unconventional oleaginous yeasts is still in the starting stage, and many unconventional oleaginous yeasts do not have Suitably genetic manipulation platform.Developing suitable genetic manipulation method, the application value for these unconventional microorganisms is great.

Circle rhodosporidium toruloides belongs to Basidiomycota heterothallism type fungus, is a kind of particularly important microorganism in fermentation industry, may utilize and comes from The hexose of biomass and pentose are the biobased products that raw material production is important: microbial grease, and intracellular oils and fats is up to more than the 60% of dry cell weight (Ratledge C,Wynn J P.Adv.Appl.Microbiol.2002,51:1-51；Li Y,Zhao Z,Bai F.Enzyme Microb.Technol. 2007,41(3):312-317)；Industrial enzymes or pharmaceutical synthesis enzyme such as phosphodiesterase, PAL (Hodgins D S.J Biol. Chem.1971,246(9):2977-2985；Gilbert H J,Clarke I N,Gibson R K,et al.J Bacteriol.1985,161(1): 314-320), D amino acid oxidase (Gadda G, Negri A, Pilone M S.J Biol.Chem.1994,269 (27): 17809-17814；Liao 55-61) etc. and many outside beta-carotene and born of the same parents G J, Lee Y J, Lee Y H, et al.Biotechnol.Appl.Biochem.1998,27 (Pt 1): Sugar；And in sewage disposal and bio-pharmaceuticals, have wide application.Test result indicate that, this bacterium can utilize pentose and the hexose to be simultaneously Substrate, good stress resistance, directly can accumulate oils and fats with corn straw acid hydrolysis liquid for carbon source, biomass efficiently turning to biobased products can be realized Change (Li Yonghong, Liu Bo, Sun Yan, etc. Chinese biological engineering magazine, 2005,25 (12): 39-44).The research of R.toruloides functional gene at present Mainly carry out (Gilbert H J, Clarke I N, Gibson R K, et al. by gene clone, heterogenous expression and saccharomyces cerevisiae function reasonableness J Bacteriol.1985,161(1):314-320；Liao G J,Lee Y J,Lee Y H,et al.Biotechnol.Appl.Biochem.1998,27(Pt 1):55-61).But from molecular level, to carry out R.toruloides oil and fat accumulation mechanism, genetic development, growth metabolism and bacterial strain genetic modification grind Study carefully, it is necessary to possess corresponding genetic operating system.But for R.toruloides widely distributed, that prospects for commercial application is good, due to Its special sort status and biochemical characteristic and the shortage of genetic operating system so that its genetic improvement and Advances in research on molecular mechanism are slow, mesh Front effective genetic operating system is to open based on himself glycerol 3-phosphate kinase promoter pPGK and glyceraldehyde-3-phosphate dehydrogenase GPD The agrobacterium mediation converted system (Lin XP, Wang YN, Zhang SF, et al.Fems Yeast Res.2014,14:547 555) of mover.But Use constitutive promoter cannot a certain genetic transcription of selective regulation, be not suitable for the process LAN of cytotoxic gene；Meanwhile, metabolic engineering It is also required to more promoter and terminator element is available, to realize the accuracy controlling of each gene expression dose of a certain metabolic pathway.

Inducible promoter, under the stimulation of specific physically or chemically signal, regulates and controls startup and closedown that downstream gene is transcribed, to some cells The genetic manipulation of virulent gene is particularly important.Glucose derepresses and induces ethanol dehydrogenase Adh2, is the key in glycolysis and glyoxylate cycle Enzyme, its synthesis is by glucose repression and the regulation and control derepressed, and to be proved to this regulation and control be transcriptional level control.ADH2 promoter Inducing without adding derivant or changing culture medium, be suppressed in the presence of fermentation early metaphase glucose, in fermentation culture fluid in latter stage, glucose is consumed It is induced time to the greatest extent, produces a large amount of recombiant protein, be very suitable for the production of the cytotoxic proteins such as cell wall lysis enzymes, contribute to intracellular oils and fats The development of green extraction technique.Although once having numerous researcher separation saccharomyces cerevisiaes (Saccharomyces cerevisiae) or other ascus yeast ADH2 promoter or other glucose derepress evoked promoter for himself genetic engineering operate (Hintz WE1, Lagosky PA. Biotechnology(N Y).1993,11(7):815-818.；Weinhandl K,Winkler M,Glieder A,et al.Microb Cell Fact.2014, 13:5.；Shen MW,Fang F,Sandmeyer S,et al.Yeast.2012,29(12):495-503.；Lee KM,DaSilva NA.Yeast.2005, 22(6):431-440.；Li Wei, Li Yuyang. Acta Genetica Sinica, 1997,24 (6): 561-568.；Qiao Xuefeng, Lu person of outstanding talent, Xiao Ciying, etc. East China science and engineering College journal (natural science edition), 2013,39 (5): 559-564), but such promoter cannot be applied to Rhodosporidium (Rhodosoporidium), lock throws Saccharomyces (Sporidiobolus), Sporobolomyces (Sporobolomyces) and Rhodotorula (Rhodotorula) The genetic engineering operation of middle gene expression, genetic engineering procedure and strain improvement.It is meanwhile, known to the skilled person in the art that " different microorganisms exists There is big difference in genetic background, gene expression pattern, physiological and biochemical property aspect, even if being all yeast, there is also very between different kinds Big difference, such as, belongs to the saccharomyces cerevisiae of Ascomycota together, Pichia sp., Ye Shi solve fat yeast, it is necessary to build its genetic system respectively, Select autogenous promoter ".But, promoter is essential for genetic operating system.Therefore, separation can be at these red ferment The galactokinase promoter starting reporter gene expression in mother becomes the focus of research at present.

Terminator sequence, is the DNA sequence giving rna polymerase transcribe termination signal, also determines the stability of mRNA simultaneously, turns Record efficiency and mRNA are from the release of transcription complex.In the synthetic biology document of commercialization Yeast expression carrier and report, more options height table Reach the terminator of gene as transcription terminator element.

Summary of the invention

In view of above-mentioned prior art bottleneck, the main object of the present invention is to provide and can be universally used in Rhodosporidium (Rhodosoporidium), lock Throw gene expression, heredity in Saccharomyces (Sporidiobolus), Sporobolomyces (Sporobolomyces) and Rhodotorula (Rhodotorula) The promoter of the middle exogenous gene expression of Engineering operation and strain improvement and terminator, and use suitable transformation technology to these Rhodothece glutinis bacterial strains The method carrying out improveing.

For realizing the purpose of the present invention, the present invention is by being analyzed the genome sequence of circle rhodosporidium toruloides, it is thus achieved that response glucose goes resistance Hinder ethanol dehydrogenase Adh2 promoter (ADH2p) sequence of induction, and pass through round pcr further from circle rhodosporidium toruloides chromosome DNA has been successfully separated the DNA fragmentation comprising effective promoter, use suitable method for transformation will containing circle rhodosporidium toruloides alcohol dehydrogenase The exogenous dna fragment of enzyme Adh2 promoter (ADH2p) is directed respectively into Rhodosporidium, lock throws Saccharomyces, Sporobolomyces and red ferment In female genus, it is successfully realized the expression of exogenous gene, completes the present invention.

The present invention has been successfully separated and can throw start report base in Saccharomyces, Sporobolomyces and Rhodotorula yeast at Rhodosporidium, lock Because of round rhodosporidium toruloides galactokinase promoter (ADH2p) promoter expressed, and construct its expression vector.

Specifically, the present invention comprises following technical proposals (A) to (H):

(A) the present invention relates to one there is Rhodosporidium, lock and throw Saccharomyces, Sporobolomyces and Rhodotorula transcripting promoter activity DNA fragmentation, described DNA fragmentation:

(1) there is the full sequence of DNA sequence as shown in SEQ ID NO:1 or comprise this DNA sequence from 3 '-end within 500bp Partial sequence,

(2) have and can play the partial sequence within 500bp with the whole of sequence as shown in SEQ ID NO:1 or its DNA sequence 3 '-end That hybridize and that holding transcripting promoter is active sequence, or

(3) deoxynucleotide sequence shown in SEQ ID NO:1 is carried out one or or 50 bases within replacement, lack, insert or Interpolation is obtained, and has more than 70% homology with sequence shown in SEQ ID NO:1 and has the sequence of promoter activity.

(B) a kind of DNA fragmentation justifying rhodosporidium toruloides by oneself, described DNA fragmentation can as terminator, and: (1) has such as SEQ DNA sequence shown in ID NO:2 whole or comprise the partial sequence of this DNA sequence 5 '-end；Or (2) have can be with such as (1) Shown in sequence hybridization and keep as described in (1) sequence of sequence active.

(C) one can complete target gene Rhodosporidium, lock throw Saccharomyces, Sporobolomyces and Rhodotorula yeast transcription initial and The DNA molecular of tanscription termination, it have described in above-mentioned (A) have Rhodosporidium, lock throw Saccharomyces, Sporobolomyces and Rhodothece glutinis Belong to yeast transcriptional promoter activity DNA sequence, or have simultaneously described in above-mentioned (A) have Rhodosporidium, lock throw Saccharomyces, Sporobolomyces and the DNA sequence of Rhodotorula yeast transcriptional promoter activity, and the DNA fragmentation described in (B), and (B) is described DNA fragmentation be positioned at the downstream of the DNA sequence described in (A), be adjacent the DNA fragmentation of 1-10000 nucleotide.

(D) the DNA expression cassette that target gene can be connected by one with any one described DNA molecular of (A)-(C), in order to described Target gene can be thrown express the DNA of restructuring in Saccharomyces, Sporobolomyces and Rhodotorula yeast at Rhodosporidium, lock.Described target base Because protein-encoding nucleotide or antisensenucleic acids code nucleic acid.Preferably, the cDNA sequence of described genes of interest has such as SEQ ID NO:4 Shown nucleotide sequence (galactokinase cDNA).

(E) one carry described in (A)-(D) DNA molecular in the recombinant vector of any one.Described carrier can be free Type carrier or integrating vector, described episomal vector such as, but not limited to, pMD18-T, pUC18, pYES2c/t or pYX212 etc., Described integrating vector is agriculture bacillus mediated binary expression vector, such as, but not limited to, PZPK or pZP2000 etc..

(F) one by the DNA molecular as described in (D) or the carrier as described in (E) proceed to Rhodosporidium, Saccharomyces thrown by lock, Sporobolomyces and the method for transformation of Rhodotorula bacterial strain.

(G) one has proceeded to the DNA expression cassette as described in (D) or the Rhodosporidium of the recombinant vector as described in (E), has locked and throw The engineering strain of Saccharomyces, Sporobolomyces and Rhodotorula.

(H) galactokinase (ADH2) promoter, it is characterised in that: its source is circle rhodosporidium toruloides, can start genes of interest red The transcript and expression in Saccharomyces, Sporobolomyces and Rhodotorula yeast thrown by winter spore Saccharomyces, lock, described promoter: (1) has such as SEQ The full sequence of DNA sequence shown in ID NO:1 or comprise this DNA sequence partial sequence from 3 '-end within 500bp, (2) have Have can with the whole of sequence as shown in SEQ ID NO:1 or its DNA sequence 3 '-end rise within 500bp partial sequence hybridization and Keep the sequence of transcripting promoter activity, or (3) deoxynucleotide sequence shown in SEQ ID NO:1 is carried out one or or 50 bases with In replacement, lack, insert or add and obtained, with sequence shown in SEQ ID NO:1, there is more than 70% homology and having and open The sequence of promoter activity；

Galactokinase terminator of the present invention, it is characterised in that: its source is circle rhodosporidium toruloides, can terminate genes of interest in the red winter The transcript and expression in Saccharomyces, Sporobolomyces and Rhodotorula yeast thrown by spore Saccharomyces, lock, described terminator: (1) has such as SEQ ID DNA sequence shown in NO:2 whole or comprise the partial sequence of this DNA sequence 5 '-end, (2) have can with such as SEQ ID NO: That the partial sequence of whole or its DNA sequence 5 '-end of sequence shown in 2 hybridizes and that holding transcription terminator is active sequence, or (3) are right Deoxynucleotide sequence shown in SEQ ID NO:2 carries out replacement within one or 50 bases, lacks, inserts or add and obtained, With sequence shown in SEQ ID NO:2, there is more than 70% homology and there is the sequence of terminator activity.

Use the DNA molecular with promoter activity of the present invention and there is the DNA of transcription terminator activity, exogenous gene or interior can be realized Source gene throws the expression in Saccharomyces, Sporobolomyces and Rhodotorula yeast at Rhodosporidium, lock.

Present invention provide for Rhodosporidium, to throw Saccharomyces, Sporobolomyces and Rhodotorula yeast strain genetically engineered for lock Promoter, terminator and carrier.Throw Saccharomyces, Sporobolomyces and Rhodotorula yeast strain open one for Rhodosporidium, lock Breeding new way, and therefore the saccharomyces neoformans bacterial strain with industrial use can be provided.

In sum, the present invention provides following technical proposals:

1. glucose goes to hinder induction ethanol dehydrogenase Adh2 promoter, and its nucleotide sequence is as shown in SEQ ID NO:1.

2. the 1st described ethanol dehydrogenase Adh2 promoter can throw Saccharomyces at c (Rhodosoporidium), lock for structure (Sporidiobolus), the restructuring table expressed in the yeast strain of Sporobolomyces (Sporobolomyces) and Rhodotorula (Rhodotorula) Reach carrier application, wherein cloned the Rhodosporidium of the recombinant expression carrier comprising described ethanol dehydrogenase Adh2 promoter, locked and throw ferment Female genus constitutes Rhodosporidium with Rhodotorula yeast strain, locks and throw Saccharomyces, Sporobolomyces and Rhodotorula genetic operating system.

3. a DNA expression cassette, it contains the nucleotide sequence of the ethanol dehydrogenase Adh2 promoter shown in SEQ ID NO:1.

4. the 3rd described expression cassette, its possibly together with the nucleotide sequence shown in SEQ ID NO:2 as terminator, wherein SEQ ID NO: Sequence shown in 1 is positioned at the upstream of the sequence shown in SEQ ID NO:2, for coding mesh between SEQ ID NO:1 and SEQ ID NO:2 The open reading frame of gene.

5. the 4th described DNA expression cassette, it is characterised in that: the cDNA sequence tool of the open reading frame of described coding genes of interest Just like the nucleotide sequence shown in SEQ ID NO:4.

6. the recombinant vector of the DNA expression cassette comprised according to any one of 3-5 item.

7. the 6th described recombinant vector, it is characterised in that: described carrier is sequestered or integrating vector.

8. the 7th described recombinant vector, described integrating vector is agriculture bacillus mediated binary expression vector, such as PZPK or pZP2000, Or it is the homologous recombination vector carrying target gene flank 1500-4000 base homologous recombination arm, described homologous recombination vector skeleton or described Episomal vector is selected from E. coli cloning vector or yeast shuttle vector, preferably pMD18-T, pUC18, pYES2c/t or pYX212.

9. the host cell comprising the recombinant vector according to any one of 6-8 item is Bacillus coli cells or yeast cells.

10., for an expression system for oleaginous yeast genetic expression, described expression system comprises:

(1) Saccharomyces, Sporobolomyces and Rhodotorula can be thrown and belong to, at Rhodosporidium, lock, the improved carrier expressed in bacterial strain, described Improved carrier is by throwing integrant expression or the expression that dissociates in Saccharomyces, Sporobolomyces and Rhodotorula at Rhodosporidium, lock Plasmid inserts the promoter sequence shown in SEQ ID NO:1 and the terminator sequence construct shown in SEQ ID NO:2 obtains, wherein SEQ Promoter sequence shown in ID NO:1 is positioned at the upstream of the terminator sequence shown in SEQ ID NO:2, the sequence shown in SEQ ID NO:1 It is multiple clone site between sequence shown in row and SEQ ID NO:2, and described carrier also comprises selected marker；

(2) genes of interest open reading frame sequence, it can be inserted into operably in the improved carrier described in (1), and make described mesh Gene and the promoter in improved carrier described in (1) and terminator meet the connection of reading frame, and

(3) Rhodosporidium, lock throw Saccharomyces, Sporobolomyces and Rhodotorula bacterial strain.

The expression system for oleaginous yeast genetic expression of 11. the 10th, wherein the improved carrier described in (1) is by can be at red winter spore Saccharomyces, lock are thrown and are inserted the promoter sequence shown in SEQ ID NO:1 in the plasmid expressed in Saccharomyces, Sporobolomyces and Rhodotorula Obtain with the terminator sequence construct shown in SEQ ID NO:2.

The expression system for oleaginous yeast genetic expression of 12. the 11st, wherein (1) described plasmid is sequestered or integrative plasmid, Further, wherein said integrative plasmid is agriculture bacillus mediated double base expression plasmid, such as PZPK or pZP2000, and, described free Type plasmid is selected from pMD18-T, pUC18, pYES2c/t or pYX212.

The expression system for oleaginous yeast genetic expression of 13. the 10th, wherein the Rhodosporidium toruloides described in (3) is selected good strains in the field for seed and is justified the red winter by oneself Spore yeast (Rhodosporidium toruloides), Bei Jiwei rhodosporidium toruloides (Rhodosporidium babjevae), Saccharomyces thrown by described lock (Sporidiobolus) bacterial strain is selected from intending pink lock shadow yeast (Sporidiobolus pararoseus), described Sporobolomyces (Sporobolomyces) bacterial strain is selected from pink shadow yeast (Sporobolomyces roseus), described Rhodotorula (Rhodotorula) bacterium Select good strains in the field for seed from rhodothece rubra (Rhodotorula rubra), rhodotorula mucilaginosa (Rhodotorula mucilaqinosa), Rhodotorula marina (Rhodotorula Marina), this Rhodothece glutinis of standing grain (Rhodotorula graminis) and rhodotorula glutinis (Rhodotorula glutinis).

The expression system for oleaginous yeast genetic expression of 14. the 10th, wherein the genes of interest open reading frame sequence described in (2) has Nucleotide sequence as shown in SEQ ID NO:4.

It should be appreciated by those skilled in the art that term " expression system " refers to recombinant vector, the encoding nucleoside of target protein to be expressed The composition system of acid sequence, applicable host cell or host strain etc., is used for expressing described mesh in described host cell or host strain Mark albumen.

The invention has the beneficial effects as follows:

Throw the yeast of Saccharomyces and Rhodotorula provide promoter, terminator genetic transforming method for Rhodosporidium, lock, will be strong Promote that Rhodosporidium from now on, lock throw the saccharomycetic strain improvement of Saccharomyces, Sporobolomyces and Rhodotorula and metabolic engineering research.

Accompanying drawing explanation

The agarose gel electrophoresis result figure of Fig. 1, ADH2 degenerate pcr product (swimming lane 1), swimming lane M is molecular weight standard.

The structural representation of Fig. 2, PZPK-ADH2p-hyg-ADH2t carrier, LB, T-DNA left margin；RB, T-DNA right margin.

Fig. 3, use HYG gene transformation R.babjevae NCYC 2630 obtain the PCR qualification result figure of recon, and swimming lane M is molecular weight Standard, swimming lane 1-6 represents different Hyg resistant transformants respectively, and 7 is wild type control.

Fig. 4, the detection of expression Western blot analysis result figure of expression HYG, swimming lane 1-3 is R.babjevae NCYC 2630 hygromycin Transformant 1-3 total protein；Swimming lane 4 (WT) is starting strain R.babjevae NCYC 2630 total protein sample as negative control.

The transcriptional level expression analysis RT-PCR result figure of Fig. 5, BLE resistance Ura3 auxotrophy circle rhodosporidium toruloides recombinant bacterial strain, swimming lane 1-7 is BLE resistance Ura3 auxotrophy circle rhodosporidium toruloides ATCC 10788 recombinant bacterial strain 1-7, and swimming lane 8 is the control strain red winter spore of circle Yeast ATCC 10788.

The structural representation of Fig. 6, PZPK-ADH2p-hyg-Thsp carrier, LB, T-DNA left margin；RB, T-DNA right margin.

The structural representation of Fig. 7, pZPK-ADH2p-MCS-Thsp carrier, LB, T-DNA left margin；RB, T-DNA right margin.

The structural representation of Fig. 8, PZPK-HYG-ADH2p-MCS-Thsp carrier, LB, T-DNA left margin；RB, T-DNA right margin.

The structural representation of Fig. 9, pZPK-HYG-ADH2p-CpFAH-Thsp carrier, LB, T-DNA left margin；On the right of RB, T-DNA Boundary.

Figure 10, the detection of expression Western blot analysis result figure of expression CpFAH, swimming lane 1-3 is for intending pink lock shadow yeast JCM 3765 Hygromycin transformant 1-3 total protein；Swimming lane 4 is that the starting strain as negative control intends pink lock shadow yeast JCM 3765 total protein sample Product.

The structural representation of Figure 11, pZPK-HYG-ADH2p-ME-Thsp carrier, LB, T-DNA left margin；RB, T-DNA right margin.

Figure 12, the detection of expression Western blot analysis result figure of expression RtME, swimming lane 1-3 is pink shadow yeast S.roseus JCM 8242 Hygromycin transformant 1-3 total protein；Swimming lane 4 is the total egg of the pink shadow yeast S.roseus JCM of the starting strain as negative control 8242 White sample.

The structural representation of Figure 13, pZPK-HYG-ADH2p-GFP-Thsp carrier, LB, T-DNA left margin；RB, T-DNA right margin.

Figure 14, the detection of expression Western blot analysis result figure of expression GFP, swimming lane 1-3 is restructuring rhodothece rubra CGMCC 2.279 tide Mycin transformant 1-3 total protein；Swimming lane 4 is starting strain restructuring rhodothece rubra CGMCC 2.279 total protein sample as negative control.

Figure 15, the detection of expression Western blot analysis result figure of expression GFP, swimming lane 1-3 is restructuring rhodotorula mucilaginosa CGMCC 2.22 tide Mycin transformant 1-3 total protein；Swimming lane 4 is starting strain restructuring rhodotorula mucilaginosa CGMCC 2.22 total protein sample as negative control.

The structural representation of Figure 16, pZPK-HYG-ADH2p-INU-Thsp carrier, LB, T-DNA left margin；RB, T-DNA right margin.

Sequence table explanation

Detailed description of the invention

In this article, " promoter " refers to the DNA sequence transcribed by RNA polymerase identification, combination energy promotor gene.Term " promoter " may also be understood to be: include 5 ' noncoding regions, cis acting element (such as enhancer) and other can be combined with transcription factor Nucleotide sequence.

Existence or the intensity of promoter represent typically by promoter activity, its assay method: connected by reporter gene (such as resistant gene) In the downstream of described promoter, and this DNA construct being converted corresponding host cell, whether examining report gene expresses.If people observe To the expression being connected to described promoter downstream reporter gene, it is possible to think that described promoter is active in the host cell that it is converted.

In this article, " terminator " refers to provide termination signal to make RNA polymerase separate with DNA profiling and make tanscription termination on chromosome Section of DNA sequence.Reporter gene effective expression can be made to determine terminator by " promoter-reporter gene-terminator " construct Activity.

" circle rhodosporidium toruloides " in the present invention, lacks including any diploid and monoploid, wild-type strain and nutrition belonging to these " species " Swaged bacterial strain." Rhodosporidium, lock throw Saccharomyces, Sporobolomyces and Rhodotorula " in the present invention, is not specifically limited, in fact Example includes circle rhodosporidium toruloides (Rhodosporidium toruloides), Bei Jiwei rhodosporidium toruloides (Rhodosporidium babjevae), powder Red lock shadow yeast (Sporidiobolus pararoseus), pink shadow yeast (Sporobolomyces roseus), rhodothece rubra (Rhodotorula Rubra), rhodotorula mucilaginosa (Rhodotorula mucilaqinosa), Rhodotorula marina (Rhodotorula marina), this Rhodothece glutinis of standing grain (Rhodotorula graminis) and rhodotorula glutinis (Rhodotorula glutinis).

" genes of interest " of the present invention, including throwing Saccharomyces, Sporobolomyces and Rhodotorula belong in bacterial strain at Rhodosporidium, lock Albumen coded sequence, antisense RNA coding sequences and the nuclease coded sequence expressed.Saccharomyces can be thrown at Rhodosporidium, lock, throw The example of the albumen coded sequence expressed in spore Saccharomyces and Rhodotorula bacterial strain includes coming from the albumen in this two classes Pseudomonas or nucleotide sequence, And be not limited thereto, also include deriving from other microorganism, the albumen of plant and animal or nucleotide sequence.Art technology arbitrarily should Understand, when use derive from other microorganism, plant and animal albumen coded sequence as genes of interest (that is, external source genes of interest) time, The expression in Saccharomyces, Sporobolomyces and Rhodotorula bacterial strain is thrown at Rhodosporidium, lock, it usually needs for red winter spore ferment for optimizing Female genus, lock are thrown the codon preference of Saccharomyces, Sporobolomyces and Rhodotorula bacterial strain and are carried out codon optimized to described genes of interest.And Codon optimized belong to ordinary skill in the art means.

Promoter in the present invention: (1) has the full sequence of DNA sequence as shown in SEQ ID NO:1 or comprises this DNA sequence certainly 3 '-end plays the partial sequence within 500bp, (2) have can with the whole of sequence as shown in SEQ ID NO:1 or its DNA sequence 3 '- Sequence that is that end plays the partial sequence hybridization within 500bp and that keep transcripting promoter activity, or (3) are to shown in SEQ ID NO:1 Deoxynucleotide sequence carries out replacement within one or 50 bases, lacks, inserts or add and obtained, with SEQ ID NO:1 institute Show that sequence has more than 70% homology and has the sequence of promoter activity.

Terminator in the present invention: (1) have the whole of the DNA sequence as shown in SEQ ID NO:2 or comprise this DNA sequence 5 '- The partial sequence of end, (2) have can be miscellaneous with whole or its DNA sequence 5 '-end partial sequences of sequence as shown in SEQ ID NO:2 That hand over and keep the sequence of transcription terminator activity, or (3) carry out one or 50 to the deoxynucleotide sequence shown in SEQ ID NO:2 Replacement within individual base, lack, insert or add and obtained, with sequence shown in SEQ ID NO:2 have more than 70% homology, And there is the sequence of terminator activity.

The construct of the promoter-genes of interest in the present invention, the construct of genes of interest-terminator or the structure of promoter-genes of interest-terminator Build body, directly or Saccharomyces, Sporobolomyces and Rhodotorula bacterial strain can be thrown through carrier mediated conversion Rhodosporidium, lock, in order to Destination gene expression, it may be preferred to plasmid vector is as mediation carrier.

Below in conjunction with the accompanying drawings and embodiment the invention will be further described, it will help those of ordinary skill in the art understands the present invention, but Limit the present invention the most in any form.The synthesis of all primers and examining order in following embodiment, the most then by Dalian TakaRa Company completes.Experimental technique in following embodiment, if no special instructions, is conventional method.Experiment material used in following embodiment, If no special instructions, it is and is commercially available from routine biochemistry Reagent Company.

R.toruloides CGMCC 2.1389: China General Microbiological DSMZ (CGMCC), is derived from Tokyo University and applies micro-life Thing institute (IFO 8766), from IFO 0559 and IFO 0880 through with diploid, be equal to CBS 6016 or NBRC 8766 Or NRRL Y-6987.

R.toruloides ATCC 10788: Unite States Standard biology product collecting center (ATCC), is derived from CBS-KNAW fungal biodiversity Centre, be equal to IFO 0559 or JCM 3792 or CCRC 20306 or DBVPG 6740 or IAM 13469 or IGC 4416 or MUCL 30249 or NCYC 921 or NRRL Y-1091 or VKM Y-334 or PYCC 4416.

Rhodosporidium babjevae NCYC 2630 is purchased from United Kingdom National barms preservation center (National Collection of Yeast Cultures, NCYC).

Intend pink lock shadow yeast (Sporidiobolus pararoseus) JCM 3765 to manage purchased from purchased from China General Microbiological culture presevation Center (CGMCC).

Pink shadow yeast (Sporobolomyces roseus) JCM 8242 is purchased from Japan's Culture Collection (JCM).

Rhodothece rubra (Rhodotorula rubra) CGMCC 2.279 is purchased from barms preservation center (purchased from China General Microbiological bacterium Plant preservation administrative center (CGMCC).

Rhodotorula mucilaginosa CGMCC 2.22 purchased from barms preservation center (purchased from China General Microbiological culture presevation administrative center (CGMCC)。

Rhodotorula marina (Rhodotorula marina) CGMCC 2.4203 (is purchased from the common micro-life of China purchased from barms preservation center Thing culture presevation administrative center (CGMCC).

Rhodotorula glutinis (Rhodotorula glutinis) NCYC 2666 is purchased from United Kingdom National barms preservation center (National Collection Of Yeast Cultures, NCYC).

Embodiment 1: the extraction of circle rhodosporidium toruloides (Rhodosporidium toruloides) CGMCC 2.1389 total serum IgE

By circle rhodosporidium toruloides (R.toruloides) CGMCC 2.1389 (purchased from China General Microbiological culture presevation administrative center (China General Microbiological Culture Collection Center, CGMCC)) by inclined plane inoculating to 10mL YEPD fluid medium (Portugal Grape sugar 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, cultivate 24h in 30 DEG C of shaking tables, then with 1:50 Volume ratio bacterium solution is transferred to respectively in 100mL YEPD fluid medium, cultivate 14h in 30 DEG C of shaking tables and reach exponential phase.? At 4 DEG C, 5000rpm is centrifuged 4min, collects thalline, with liquid nitrogen quick freeze thalline, grinds breaking cellular wall (Yang F, Tan HD, Zhou YJ, et al.Mol.Biotechnol.2010,47(2):144–151.).Use TakaRa company RNAiso test kit, and extract according to its standard step total RNA。

RNA carries out 1.5% (mass/volume concentration) agarose gel electrophoresis, uses fluorescence-uv analyzer to observe and identifies, it is seen that clearly Two bands.With ultraviolet/visible light spectrometer analysis total serum IgE sample, record OD₂₆₀/OD₂₈₀=1.99, show that total serum IgE quality is fine.Always RNA sample is frozen in-80 DEG C, standby.

Embodiment 2: circle rhodosporidium toruloides CGMCC 2.1389cDNA the first chain synthesis and ADH2 degenerate pcr

To justify rhodosporidium toruloides CGMCC 2.1389 total serum IgE as template, reverse transcription synthesis cDNA the first chain.First, by total for 1.0 μ L RNA (about 2 μ g), 1.0 μ L primer SMART IV: 5 '-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3 ' and 1.0 μ L oligo dT-adapter-primer CDS III / 3':5 '-ATTCTAGAGGCCGAGGCGGCCGACATG-d (T)_30N-1N-3 ', 2.0 μ L DEPC process water (pyrocarbonic acid diethyl ester Process water, purchased from Dalian TakaRa company), join in PCR pipe and mix, be incubated 2min in 72 DEG C, be immediately placed on cooled on ice 2min, By 2.0 μ L5 × the first chain buffer (Clontech company), 1.0 μ L DTT (20mM), 1.0 μ L dNTP (10mM), 1.0 μ L Powerscript reverse transcription (Clontech company) joins in system, mixing.In 42 DEG C of extension 60min, last 4 DEG C of knots Shu Fanying, is stored in-20 DEG C, standby.

Design two degenerate primer ADH2-sense:5 '-ATGAG (AGCT) AA (CT) of synthesis CC (AGCT) CAGATCCC (AGCT) AAg-3 ' (in bracket, base occurs at random in this position, for degeneracy base) and ADH2-anti:5 '- TTAGAA (AG) TT (CT) TT (AGCT) AG (AGCT) ACGAT (AGCT) CG-3 ' (in bracket, base occurs at random in this position, For degeneracy base), with reverse transcription synthesis cDNA the first chain as template, carry out ADH2 gene degenerate pcr amplification, 5 × PCR delay Rush liquid 10.0 μ L, dNTPs (10mM) 1.0 μ L, forward primer (50mmol/l) 1.0 μ L, downstream primer (50mmol/l) 1.0ul, PrimeSTAR archaeal dna polymerase (Dalian TakaRa) 0.5 μ L, cDNA the first chain template 1.0 μ L, ddH of synthesis₂O adds to 50 μ L, It is incubated 3min in 94 DEG C, then in 98 DEG C of insulations 10s, 62 DEG C of 10s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.Amplified production carries out 1% (mass/volume concentration) agarose gel electrophoresis, it was observed that the band (figure of about 1.1kb 1), DNA is utilized to reclaim test kit (purchased from the raw work in Shanghai), according to supplier's proposed steps purified pcr product.PCR primer is with reference to big The method that even TakaRa company provides is cloned into pMD18-T carrier (purchased from Dalian TakaRa), is transformed into E.coli DH5 α competent cell, Wherein by Calcium Chloride Method, (the Molecular Cloning: A Laboratory guide third edition, Pehanorm Brooker writes competent cell, and yellow training hall etc. is translated, and Science Press goes out Version) prepare.Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction.The order-checking of Dalian TakaRa company delivered to by recombiant plasmid sample, The aminoacid sequence that sequence results deduces is analyzed through Blastp, it was demonstrated that for galactokinase enzyme sequence (RtADH2 aminoacid sequence), such as SEQ Shown in ID NO:5.Glucose goes to hinder induction ethanol dehydrogenase cDNA sequence (RtADH2cDNA) such as SEQ ID NO:4 sequence Shown in.

Embodiment 3: the amplification of circle rhodosporidium toruloides CGMCC 2.1389RtADH2CDS

The extracting genome DNA of circle rhodosporidium toruloides CGMCC 2.1389 uses bead breaking cellular wall method (fine works molecular biology experiment guide The third edition the 13rd chapter, Ao Sibai etc. writes, and face grain husk etc. is translated, and Science Press publishes).The genomic DNA prepared, utilizes Nanodrop ND-1000 measures, and records OD₂₆₀/OD₂₈₀=1.85, show that genomic DNA quality is fine.Concentration is 280ng/ μ L, totally 500 μ L, Genome DNA sample is frozen in-20 DEG C, standby.

Go to hinder ethanol dehydrogenase (RtADH2) cDNA sequence of induction according to the glucose obtained in embodiment 2, design 1 is to gene Specific primer, ADH2-p1:5 '-atgagcaaccctcaaatccccaaggaaggc-3 ' and ADH2-p2:5 '- Ttagaagttcttgaggacgatgcggcc-3 ', with justify rhodosporidium toruloides CGMCC 2.1389 genomic DNA as template, according to routine side Method carries out PCR amplification, obtains the PCR primer (not shown) of about 1.5kb.Pcr amplification product returns according to the operating procedure of embodiment 2 Receive, be cloned into pMD18-T carrier, and check order, obtain the DNA sequence (RtADH2 as shown in sequence table SEQ ID NO:3 CDS).Warp and the galactokinase cDNA sequence comparison of acquisition in embodiment 2, it was demonstrated that this genetic fragment is its galactokinase coding Region sequence, wherein contains 6 introns and 7 exons.

Embodiment 4: chromosome walking obtains RtADH2 gene 5 ' flank sequence (promoter)

The present embodiment utilizes Genome Walking Kit (purchased from Dalian TakaRa) to complete.

According to the RtADH2CDS sequence obtained in embodiment 3, design 3 Specific Primer (gene-specific primer), respectively For ADH2-SP1:5 '-gtcttgggcgcagcgggccagtcgccctt-3 ', ADH2-SP2:5 '-ggcgatctgtcagccttcttcctctcgtc-3 ' and ADH2-SP3:5 '-gtcgacgcgaatcggtccgttgcattt-3 ', as downstream primer, carries out following operation according to test kit description.

1.1^stPCR reacts

Genomic DNA refined in embodiment 3, as template, carries out first round amplification.Reaction system 50 μ L:10 × LA PCR buffer II (Mg²⁺Plus, Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 8.0 μ L, LA Taq archaeal dna polymerase (5U/ μ L, Dalian TakaRa) 1.0 μ L, AP1Primer (100 μm ol/l, Dalian TakaRa) 1.0 μ L, ADH2-SP1 (10 μm ol/l) 1.0 μ L, the red winter spore ferment of circle Female CGMCC 2.1389 genomic DNA template (120ng/ μ L) 1.0 μ L, ddH₂O adds to 50 μ L.Reaction condition: first carry out 5 The high specific reaction of individual high temperature anneal temperature, then carries out the low specific reaction of 1 extremely low annealing temperature；Then heat is carried out asymmetric The high specific reaction of PCR:2 high annealing temperature (65 DEG C) and the low specific reaction alternate cycles of 1 low temperature thermal oxidation (44 DEG C), Totally 15 times.Design parameter is as follows: 94 DEG C of 1min, 98 DEG C of 1min；94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, totally 5 Circulation；94 DEG C of 30s, 25 DEG C of 3min, 72 DEG C of 2min；94℃30s,65℃1min,72℃2min,94℃30s,65℃1 Min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min, totally 15 circulations；72 DEG C of 10min, terminate reaction.

2.2^ndNest-type PRC reacts

Reaction system 50 μ L:10 × LA PCR buffer II (Mg²⁺Plus, Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 8.0 μ L, LA Taq archaeal dna polymerase (5U/ μ L, Dalian TakaRa) 1.0 μ L, AP1Primer (100 μm ol/l, Dalian TakaRa) 1.0 μ L, 1^st PCR product 1.0 μ L, ADH2-SP2 (10 μm ol/l) 1.0 μ L, ddH₂O adds to 50 μ L.Reaction condition: 94 DEG C of 30s, 65 DEG C 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min, totally 15 Individual circulation；72 DEG C of 10min, terminate reaction.

3.3^rdNest-type PRC reacts

Reaction system 50 μ L:10 × LA PCR buffer II (Mg²⁺Plus, Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 8.0 μ L, LA Taq archaeal dna polymerase (5U/ μ L, Dalian TakaRa) 1.0 μ L, AP1Primer (100 μm ol/l, Dalian TakaRa) 1.0 μ L, 2^ndNest-type PRC product 1.0 μ L, ADH2-SP3 (10 μm ol/l) 1.0 μ L, ddH₂O adds to 50 μ L.Reaction condition: 94 DEG C 30s,65℃1min,72℃2min,94℃30s,65℃1min,72℃2min,94℃30s,44℃1min,72℃ 2min, totally 15 circulations；72 DEG C of 10min, terminate reaction.

3^rdNest-type PRC product cuts purpose band after 1% (mass/volume concentration) agarose gel electrophoresis, utilizes DNA fragmentation Gel purification kit (purchased from the green skies) is purified.DNA fragmentation after purification inserts pMD18-T carrier through TA clone and (is purchased from Dalian TakaRa company), convert DH5 α competent cell；Wherein competent cell by Calcium Chloride Method (the Molecular Cloning: A Laboratory guide third edition, Pehanorm Brooker writes, and yellow training hall etc. is translated, and Science Press publishes) prepare.Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction. The order-checking of Dalian TakaRa company delivered to by recombiant plasmid sample, obtains the DNA sequence as shown in SEQ ID NO:1, it was demonstrated that for intended RtADH2 promoter sequence (ADH2p).

Embodiment 5: chromosome walking obtains RtADH2 gene 3 ' flank sequence (terminator)

The present embodiment completes also with Genome Walking Kit (purchased from Dalian TakaRa).

According to the ADH2DNA sequence obtained in embodiment 3, design 3 Specific Primer (gene-specific primer) and be respectively ADH2-SP11:5 '-gaaccgccaggacgcgatcgaggcgct-3 ', ADH2-SP22:5 '-cctgttcgcagcgcacttcgaccctttc-3 ' and ADH2-SP33:5 '-gtctaccaccgcatggagcaaggcgccgt-3 ', as forward primer, carries out 3 ' flank chromosomes according to test kit description Step moves operation, and except Specific Primer respectively by ADH2-SP1, ADH2-SP2, ADH2-SP3 are replaced by ADH2-SP11 successively, Outside ADH2-SP22, ADH2-SP33, the other the same as in Example 4.

3^rdNest-type PRC product (not shown) utilizes DNA fragmentation gel purification kit (purchased from the green skies) to be purified, warp TA clone inserts pMD18-T carrier (purchased from Dalian TakaRa company), converts DH5 α competent cell；Wherein competent cell is pressed Prepared by Calcium Chloride Method (the Molecular Cloning: A Laboratory guide third edition, Pehanorm Brooker writes, and yellow training hall etc. is translated, and Science Press publishes).Select Amp Resistant transformants carries out Zengjing Granule, plasmid extraction.The order-checking of Dalian TakaRa company delivered to by recombiant plasmid sample, obtains such as SEQ ID NO: DNA sequence shown in 2, it was demonstrated that go to hinder the terminator sequence of induction alcohol dehydrogenase gene for intended glucose.

Embodiment 6:RtADH2 promoter-open reading frame-terminator full-length gene obtains

According to the promoter obtained in embodiment 4 and embodiment 5 and terminator sequence, redesign pair of primers and carry out RtGAL " promoter -open reading frame-terminator " amplification of full-length gene.PADH2-p1:5 '-GGCTGAGGCTTCCCCGACGCCCCTCCT-3 ', ADH2t-p2:5’-CGAGCGGTTTGCTGGGCGGGGCGCTGC-3’.With the round rhodosporidium toruloides of preparation in embodiment 3 CGMCC 2.1389 genomic DNA is that template carries out PCR amplification.PCR system (50 μ L): 10 × Speed buffer (Dalian TakaRa) 5.0 μ L, dNTPs (10mmol/l) 1.0 μ L, forward primer (10 μm ol/l) 2.0 μ L, downstream primer (10 μm ol/l) 2.0 μ L, SpeedSTAR^TMHS archaeal dna polymerase (amplification rate is fast, and 1kb/10s, purchased from Dalian TakaRa company) 0.5 μ L, genomic DNA Template (120ng/ μ L) 2 μ L, ddH₂O adds to 50 μ L.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 1.0min, 35 Individual circulation, 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer is profit after 1% (mass/volume concentration) agarose gel electrophoresis is analyzed It is purified with PCR fragment purification kit (purchased from the green skies).Fragment inserts pMD18-T carrier (purchased from Dalian TakaRa through TA clone Company), convert DH5 α competent cell；Wherein competent cell presses Calcium Chloride Method (the Molecular Cloning: A Laboratory guide third edition, Pehanorm cloth Shandong Gram writing, yellow training hall etc. is translated, and Science Press publishes) prepare.Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction.Restructuring matter The order-checking of Dalian TakaRa company delivered to by grain sample, it was demonstrated that go to hinder induction alcohol dehydrogenase gene full length sequence pADH2t for intended glucose, The named T-pADH2t of this recombinant vector.

Embodiment 7:RF cloning builds hygromycin protein expression box ADH2p-hyg-ADH2t

HYG protein sequence according to NCBI report entrusts Shanghai Sheng Gong company full genome synthesis HYG gene (such as SEQ ID NO:6 Shown in).With synthesis gene as template, reference literature method (van den Ent F, Lowe J J.Biochem Biophys Methods, 2006,67, 67-74.), design RF cloning primer: HYG-RF-p1:5 '-CAGCTGCCACGTCTCCGACAGTCACAatgccggagctcac Ggcgacgtcggtc-3 ' and HYG-RF-p2:5 '-gtcgacgcgcccgcgggcgaaagaatagTCGTCCC TCCTCGCTTTCGTCTCTGCTT-3 ' is primer, carries out PCR amplification.Carry out RF first round amplification.System (50 μ L): 5 × Prime Buffer (Dalian TakaRa) 10.0 μ L, dNTPs (2.5mmol/l) 4.0 μ L, forward primer (10 μm ol/l) 2.0 μ L, downstream primer (10 μm ol/l) 2.0 μ L, PrimeSTAR HS archaeal dna polymerase (Dalian TakaRa) 1.0 μ L, T-GFPuv plasmid (100ng/ μ L) 1 μ L, ddH₂O adds to 50 μ L.Reaction condition: 95 DEG C of 3min, 98 DEG C of 8s, 49 DEG C of 15s, 72 DEG C of 1min, 35 circulations, 72 DEG C 10min, 4 DEG C are terminated reaction.RF I product utilizes DNA fragmentation glue to reclaim Purification Kit, and-20 DEG C save backup.

RF II reacts: 5 × Prime buffer (Dalian TakaRa) 10.0 μ L, dNTPs (2.5mmol/l) 4.0 μ L, builds in embodiment 6 T-pADH2t plasmid (100ng/ μ L) 1.0 μ L, RF I product (200ng/ μ L) 5.0 μ L, PrimeSTAR in the present embodiment abovementioned steps HS archaeal dna polymerase (Dalian TakaRa) 1.0 μ L, ddH₂O adds to 50 μ L.Reaction condition: 95 DEG C of 3min, 68 DEG C of 12min, 95 DEG C of 30s afterwards, 65 DEG C of 45s (-1 DEG C/cyc), 68 DEG C of 12min, 15 circulations, carry out the most again taking turns: 95 DEG C of 30s, 55 DEG C of 45s, 68 DEG C of 12min, 20 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.

DpnI digestion is with electroporated: takes 8 μ L RF II product and adds 1 μ L DpnI (purchased from TaKaRa) and 1 μ L DpnI buffer, After mixing after 37 DEG C of effect 120min remove former T-pADH2t plasmid, take 2 μ L electroporated DH5 α competent cell, competence Cell prepares (the Molecular Cloning: A Laboratory guide third edition, Pehanorm Brooker writes, and yellow training hall etc. is translated, and Science Press publishes) by standard method, Electroporated parameter: 2200-2500V, 400 Ω, 25 μ F, 0 DEG C, 4-8ms.Select Amp resistant transformants and carry out Zengjing Granule, matter Grain extracts, and utilizes RF I reaction the primer HYG-RF-p1 and HYG-RF-p2 to carry out bacterium colony PCR qualification, identifies positive restructuring Carrier send Dalian TakaRa to check order, and obtains 5 ' ends and 3 ' ends are respectively ADH2 promoter and ADH2 terminator " ADH2p-hyg-ADH2t " expression cassette, meanwhile, the named T-ADH2p-hyg-ADH2t of this recombinant vector.Complete " ADH2p-hyg-ADH2t " expression cassette is as shown in SEQ ID NO:7.

Embodiment 8:hyg abduction delivering in Bei Jiwei rhodosporidium toruloides (Rhodosporidium babjevae) NCYC 2630

Agrobacterium tumefaciems (Agrobacterium tumefaciens) can enter host tissue, by it by scab or wound under field conditions (factors) Internal section of DNA proceeds in Plant Genome, and final stimulation host is infecting position formation crown gall nodule.This characteristic of Agrobacterium is answered the earliest For the transformation of Plant Genome, referred to as ATMT technology.Subsequently ATMT technology be widely used in multiple fungus and Yeast Genetics transformation and T-DNA insertion mutation library construction.

ATMT conversion process substantially can be divided into vector construction, Agrobacterium activation, host material to prepare, cotransformation and transformant screening this five Individual step.First in the T-DNA suitable selected marker of interregional insertion of binary vector, and Agrobacterium is proceeded to；Agriculture bar containing binary vector With acetosyringone (AS) induction after the activation of bacterium engineered strain；Host strain is diluted to certain concentration after overactivation；After activating and induce Agrobacterium mix with host material, coat be covered with mounting medium co-culture on flat board, carry out cotransformation at a suitable temperature；Will be altogether The mixed bacterium cultivated is transferred to screen on flat board, is placed at the optimum temperature of Host Strains cultivation, occurs to transformant.

1. the structure of binary vector PZPK-ADH2p-hyg-ADH2t

PZPK skeleton carrier derives from Dalian Chemiclophysics Inst., Chinese Academy of Sciences's Zhao Zongbao researcher's laboratory (Lin XP, Wang YN, Zhang SF, et al.Fems Yeast Res.2014,14:547 555), the structure of PZPK-ADH2p-hyg-ADH2t carrier then uses ADH2-HYG-RF-p1: 5 '-CCGAATTGAATTCGAGCTCGCTCGGTACCCGGggctgaggcttccccgacgcccct cct-3 ' and ADH2-HYG-RF-p2:5 '-GCTTGCATGCTGCAGGTCGACTCTAGA cgagcggtttgctgggcggggcgctgc-3 ' is for drawing Thing, obtains " ADH2p-hyg-ADH2t " fragment with the T-ADH2p-hyg-ADH2t that embodiment 7 builds for template amplification, and PCR glue returns Use RF cloning process (as shown in Example 7) that " ADH2p-hyg-ADH2t " fragment is inserted the LB of PZPK binary vector after receipts And between RB.The named PZPK-ADH2p-hyg-ADH2t of carrier obtained, structure is as shown in Figure 2.

2. contain the structure of the Agrobacterium tumefaciens attachment of PZPK-ADH2p-hyg-ADH2t plasmid

The PZPK-ADH2p-hyg-ADH2t binary vector obtained uses electroporated method to convert to Agrobacterium tumefaciems (Agrobacterium Tumefaciems) in AGL1 (purchased from Unite States Standard biology product collecting center (ATCC)), in the LB containing 50ng/ μ L kanamycin Picking transformant on flat board.Agrobacterium-mediated Transformation is verified initially with the method for bacterium colony PCR.Verify correct transformant, extract wherein Plasmid, convert in escherichia coli.Binary vector send sequence verification after being enriched with in a large number by escherichia coli.Agriculture containing order-checking correct plasmid Bacillus strain is engineered strain, saves backup.

3.HYG gene abduction delivering in Rhodosporidium babjevae NCYC 2630

R.babjevae NCYC 2630 purchased from United Kingdom National barms preservation center (National Collection of Yeast Cultures, NCYC).Take the R.babjevae NCYC 2630 after a ring activation, be connected to 5mL YEPD (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in culture fluid, 30 DEG C, 200r/min cultivates 12h.After washing one time with sterilized water, adjust Save to OD₆₀₀=0.1-0.8, standby.After Agrobacterium activation containing PZPK-ADH2p-hyg-ADH2t plasmid, it is connected to 5mL and contains card In the LB liquid of that mycin (50ng/ μ L) and rifampicin (50ng/ μ L), 30 DEG C, 200r/min cultivates 8h.Wash with sterilized water One time, regulate to OD₆₀₀=0.1-1.6, standby.

Take above-mentioned yeast and each 400 μ L of Agrobacterium diluent, mixing, directly drip in induce flat board (5mmol/l glucose, 0.5% glycerol, 1.45g/L potassium dihydrogen phosphate, 2.05g/L dipotassium hydrogen phosphate, 0.15g/L sodium chloride, 0.5g/L Magnesium sulfate heptahydrate, 66mg/L calcium chloride dihydrate, 2.48g/L green-vitriol, 0.5g/L ammonium sulfate, 40mmol/l MES (2-(N-morpholine) ethyl sulfonic acid), 2% agar powder, 200 μm ol/L second Acyl syringone) upper (Bundock P, den Dulk-Ras A, Beijersbergen A, et al.EMBO J, 1995,14,3206-3214.), 24-25 DEG C, Cultivate 4 days.Being washed down by mixing lawn with the sterilized water of about 10mL, 3000r/min is centrifuged 5min, discards upper strata and mainly contains Agrobacterium Liquid, remaining cell is resuspended with 800 μ L sterilized water, take 50-200 μ L coat galactose substitute glucose be carbon source YPGR training Foster base (50ng/ μ L hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, Agar powder 1.5g/L, PH 6.0) on, cultivate in 30 DEG C, until transformant occurs.

The PCR of 4.R.babjevae NCYC 2630 hygromycin transformant identifies

Random 6 hygromycin resistance R.babjevae transformants of picking, access the YPGR fluid medium (50 containing 50ng/ μ L hygromycin Ng/ μ L hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0) In, cultivate 36h in 30 DEG C of shaking tables.Bead breaking cellular wall method described in reference example 3 extracts restructuring R.babjevae strain gene group DNA, Employing HYG-RF-p1 and HYG-RF-p2 is primer, carries out PCR qualification.PCR system (50 μ L): 10 × PCR buffer (Dalian TakaRa) 5.0 μ L, dNTPs (2.5mmol/l) 4.0 μ L, forward primer (10 μm ol/l) 2.0 μ L, downstream primer (10 μm ol/l) 2.0 μ L, rTaq archaeal dna polymerase (Dalian TakaRa) 1.0 μ L, genomic DNA (30ng/ μ L) 1 μ L, ddH₂O adds to 50 μ L.Instead Answer condition: 95 DEG C of 3min, 98 DEG C of 10s, 55 DEG C of 15s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C of end Reaction.PCR primer is through 1% (mass/volume concentration) agarose gel electrophoresis analysis.Result is as shown in Figure 3.Visible, external source HYG Fragment is successfully integrated in R.babjevae NCYC 2630 genome.

The Western blot of 5.R.babjevae NCYC 2630 hygromycin transformant analyzes

Except directly utilizing hygromycin resistance phenotype to determine that round rhodosporidium toruloides ADH2 promoter can start hygromycin gene at R. Outside the expression of babjevae NCYC 2630, owing to the C-end of hygromycin gene expression product carries 6 × His Tag, it is also with anti-His Tag antibody analyzes the expression determining corresponding albumen by Western blot.Above-mentioned PCR identifies 6 correct transformants, random picking 3 Individual transformant, accesses in the YPGR fluid medium that 10mL contains 50ng/ μ L hygromycin, cultivates 48h, 4000r/min in 30 DEG C of shaking tables Centrifugal 10min collects bacterial strain.The thalline obtained sterilized water washs after one time, add 400 μ L protein extract buffer (8M carbamide, 65 MM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH It is 7.4) resuspended, add the pickling glass pearl of equal volume.Bead breaking cellular wall method smudge cells is used to extract total protein of cell (fine works molecule The biological experiment guide third edition the 13rd chapter, Ao Sibai etc. writes, and face grain husk etc. is translated, and Science Press publishes).Total protein of cell is 12% After separating on SDS-PAGE glue, transfer to (Solarbio, Beijing, China) on nitrocellulose filter, use little mouse-anti His-tag Antibody (purchased from the green skies, Shanghai Bioisystech Co., Ltd) and horseradish peroxidase-labeled goat anti-mouse IgG are (purchased from the green skies, Shanghai Bioisystech Co., Ltd) anti-anti-with two as one, DAB horseradish peroxidase colour reagent box (has purchased from the green skies, Shanghai biotechnology Limit company) develop the color, the expression (Fig. 4) of hygromycin gene all be can be observed.

Embodiment 9: the URA3 gene knockout utilizing ADH2p-hyg-ADH2t expression cassette to carry out justifying rhodosporidium toruloides ATCC 10788 is held concurrently BLE Abduction delivering

At this, utilization circle rhodosporidium toruloides URA3 gene is as integration site, by RF cloning process so that " ADH2p-hyg-ADH2t " The 5 ' of expression cassette and 3 ' ends carry the round rhodosporidium toruloides URA3 homologous recombination arm of about 1500bp, utilize BLE resistance screening mark Remember the screening of row transformant into.

1. justify the acquisition of rhodosporidium toruloides URA3 gene

According to circle rhodosporidium toruloides URA3 (orotidine-5'-phosphate decarboxylase) gene order (NCBI accession number: KB722658.1, EU693529.1), design special primer: URA3-P1: 5 '-TGGCTCCAATGAGTCGTTGCTTCCAGCGC-3 ' and URA3-P2: 5 '-CAAGGAGAGAGGCGTTAAGCCTAAAG-3 ', to justify rhodosporidium toruloides ATCC 10788 genome as template, amplification Obtain containing URA3 promoter, reading frame and the full-length gene group sequence of terminator.DNA is utilized to reclaim kits PCR primer After, it is cloned into pMD18-T carrier, is transformed into escherichia coli (E.coli) DH5 α competent cell.Select Amp resistant transformants to carry out Zengjing Granule, plasmid extraction.Recombiant plasmid sample delivers to the order-checking of Dalian TakaRa company, sequence results and gene order-checking result comparison, card Comprise the DNA sequence (as shown in SEQ ID NO:8, URA3p-URA3-URA3t) of URA3 promoter, terminator and reading frame in fact. The named T-URA3 of this plasmid.

2.RF cloning process builds ADH2p-BLE-ADH2t expression cassette

With pPICZ α A (purchased from Invitrogen) as template, utilize pair of primers BLE-RF-p1: 5 '-CAGCTGCCACGTCTCCGACAGTCACAatggccaagttgaccagtgccgttcc-3 ' and BLE-RF-p2: 5 '-GCAGAGACGAAAGCGAGGAGGGACGAtcagtcctg ctcctcggccacgaagt-3 ', carry out PCR amplification.According to enforcement RF cloning process described in example 7, with T-ADH2p-hyg-ADH2t as skeleton, inserts ADH2p by BLE (SEQ ID NO:9) And between ADH2t, the named T-ADH2p-BLE-ADH2t of plasmid being built into.

3.URA3-BLE knock out the structure of box

Employing primer URA3-ADH2-BLE-RF-P1: 5 '-CTTGTCTTCTACAGTATATCCCTAAATTggctgaggcttccccgacgcccctcct-3 ' and URA3-ADH2-BLE-RF-P2:5 '-CTGCCCTTCACTCATCAATTACCA cgagcggtttgctgggcggggcgctgc-3 ' is for drawing Thing, carries out PCR amplification.According to the RF cloning process described in embodiment 3, with T-URA3 as skeleton, by " ADH2p-BLE-ADH2t " Expression cassette inserts in RtURA3, the sequence of gained after Takara checks order as shown in SEQ ID NO:10 (pURA3-ADH2p-BLE-URA3t), the named T-URA3-ADH2-BLE of plasmid being built into, structure is as shown in Figure 7.Restructuring Plasmid samples delivers to the order-checking of Dalian TakaRa company, sequence results and gene order-checking result comparison, it was demonstrated that this genetic fragment be two ends with " URA3-ADH2-BLE-URA3 " of 1500bp URA3 restructuring arm knocks out box.

4.URA3-ADH2-BLE-URA3 knocks out a large amount of preparations of box

With T-URA3-ADH2-BLE plasmid as template, with URA3-P1 and URA3-P2 as primer, carry out " URA3-ADH2-BLE-URA3 " knocks out a large amount of preparations of box.PCR system (500 μ L): 10 × Speed buffer (Dalian TakaRa) 50.0 μ L, dNTPs (10mmol/l) 10.0 μ L, forward primer (10 μm ol/l) 20.0 μ L, downstream primer (10 μm ol/l) 20.0 μ L, SpeedSTAR HS archaeal dna polymerase (amplification rate is fast, and 1kb/10s, purchased from Dalian TakaRa company) 5.0 μ L, genomic DNA Template (120ng/ μ L) 15.0 μ L, ddH₂O adds to 500 μ L, subpackage after mixing.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.

PCR primer utilizes PCR fragment purification kit (purchased from raw work) after 1% (mass/volume concentration) agarose gel electrophoresis analysis It is purified.DNA fragmentation concentration after purification is 500ng/ μ L, totally 60 μ L, and-20 DEG C save backup.

5. justify rhodosporidium toruloides ATCC 10788 competent cell to prepare

The preparation of circle rhodosporidium toruloides ATCC 10788 competent cell: circle rhodosporidium toruloides ATCC 10788 chooses colony inoculation 10mL YEPD culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0), 30 DEG C, 200rpm, Cultivate 20h；The culture 1:50 ratio fresh YEPD culture medium of switching, 100mL (500mL conical flask, liquid amount 100mL), 30 DEG C, 200rpm, cultivates 6-9h, OD value and reaches 0.6-1.2；Culture ice bath 10-30min, 4 DEG C, 4000r/min is centrifuged 5min, abandons Clearly；0 DEG C of aseptic Milli-Q washes 1 time；0 DEG C of 1mol/l sorbitol washes 2 times；Ice bath, standby.Take 100 μ L circle rhodosporidium toruloides ATCC 10788 competent cell, adds " URA3-ADH2-BLE-URA3 " and knocks out box 10 μ L (5 μ g altogether), move into after mixing It is cooled in advance in the electric shock cup of 0 DEG C, parameter: voltage 0.8-2.0 kilovolt, resistance 200 Ω, electric capacity 25 μ F, time 4-8ms；Stand after electric shock I.e. add 1mL YEPD, 30 DEG C of incubation 1-2h containing 1M sorbitol；Coating YPGR culture medium (the 50ng/ μ L containing 1M sorbitol Bleomycin, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, 1.5 agar powders, PH 6.0), cultivate 5 for 30 DEG C More than it, sub-appearance to be transformed.

6. the bacterium colony PCR of transformant identifies

Blasticidin resistance transformant inoculation 10mL YPGR fluid medium (50ng/ μ L bleomycin, 1% yeast extract, 2% albumen Peptone, 1% cottonseed sugar, 2% galactose, PH 6.0).Extract genomic DNA with reference to bead breaking cellular wall method in embodiment 3, use BLE-RF-p1 PCR qualification is carried out with BLE-RF-p2.PCR system (25 μ L): 10 × PCR buffer (Dalian TakaRa) 2.5 μ L, dNTPs (2.5 Mmol/l) 2.0 μ L, forward primer (10 μm ol/l) 1.0 μ L, downstream primer (10 μm ol/l) 21.0 μ L, rTaq archaeal dna polymerase is (big Even TakaRa) 0.5 μ L, genomic DNA (20ng/ μ L) 1 μ L, ddH₂O adds to 25 μ L.Reaction condition: 95 DEG C of 3min, 95 DEG C 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations, 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer through 1% (quality/ Volumetric concentration) agarose gel electrophoresis analysis.Result shows, all round rhodosporidium toruloides ATCC 10788 recombinant bacterial strains are the most amplifiable out Source BLE genetic fragment, control strain circle rhodosporidium toruloides ATCC 10788 is then without corresponding PCR primer (not shown).

Further the transformant that above-mentioned qualification is correct is carried out phenotype checking.5 '-FOA resistant phenotype analysis results show, this uracil nutrition Deficiency circle rhodosporidium toruloides engineered strain containing 5 '-FOA galactose SD culture medium (0.1%5 '-FOA, galactose 20g/L, (NH₄)₂SO₄0.1g/L, yeast powder 0.75g/L, KH₂PO₄0.06g/L, MgSO₄·7H₂O 1.5g/L, pH 6.0) on can normally give birth to Long, the R.toruloides ATCC 10788 of wild type then cannot grow in the culture medium containing 5 '-FOA.

Therefore, from genotype to phenotype, all disappearances of checking circle rhodosporidium toruloides ATCC 10788 recombinant bacterial strain URA3 gene.

7.Ble the expression analysis of gene (transcriptional level expression analysis, RT-PCR)

Except directly utilizing bleomycin resistance phenotype to determine that round rhodosporidium toruloides FBA promoter can start bleomycin resistance gene and justify The expression of the rhodosporidium toruloides expression of Lay mycin resistant gene (the bleomycin resistance phenotype be decided by) outward, also utilizes RT-PCR method to detect The expression of the transcriptional level of bleomycin resistance gene ble.

(50ng/ μ L bleomycin, 1% yeast carry random picking 7 strain blasticidin resistance transformant inoculation 10mL YPGR fluid medium Take thing, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), inducing culture 48h.Cell is extracted total with reference to embodiment 1 method RNA, carries out reverse transcription (RT) with reference to embodiment 2 method, with synthesized cDNA the first chain as template, utilizes BLE-p1: ATGGCCAAGTTGACCAGTGCCG and BLE-p2:TCAGTCCTGCTCCTCGGC CACG is that primer carries out PCR Amplification.PCR system (25 μ L): 10 × Ex Taq buffer (Dalian TakaRa) 2.5 μ L, dNTPs (10mmol/l) 0.5 μ L, on Trip primer BLE-p1 (10 μm ol/l) 1.0 μ L, downstream primer BLE-p2 (10 μm ol/l) 1.0 μ L, Ex Taq archaeal dna polymerase 0.25 μ L, CDNA the first chain template 1.0 μ L, ddH₂O adds to 25 μ L.Reaction condition: 98 DEG C of 1min, 98 DEG C of 10s, 65 DEG C of 60s, 35 Individual circulation, 72 DEG C of 10min, 4 DEG C are terminated reaction.Result shows, all round rhodosporidium toruloides ATCC 10788 recombinant bacterial strains are the most amplifiable Going out 0.3kb BLE genetic fragment, control strain circle rhodosporidium toruloides ATCC 10788 is then without corresponding PCR primer (Fig. 5).

Embodiment 10: the structure of double expression boxes ADH2 promoter vector

The structure of 1.pZPK-ADH2p-hyg-Thsp mono-expression cassette carrier

In embodiment 3, the R.toruloides CGMCC2.1389 genomic DNA of preparation is as template, utilizes primer HSPt-H1: CGAAAGAACACCACCATCACCATCACTAGacgattccgcccc gtctcacctcgcat and HSPt-H2: GCATGCTGCAGGTCGACTCTAGAGGATCC cgcgcacttctctgcactgcatctttg, amplification obtains Thsp terminator sequence (SEQ ID NO:11), PCR primer reclaims test kit (purchased from raw work) through DNA glue and uses RF cloning process (such as embodiment after purification Shown in 7) by the ADH2 terminator of Thsp terminator fragment displacement PZPK-ADH2p-hyg-ADH2t carrier, the carrier obtained is ordered Entitled PZPK-ADH2p-hyg-Thsp, structure is as shown in Figure 6.

2. the introducing and the structure of pZPK-ADH2p-MCS-Thsp mono-expression cassette carrier of multiple clone site

Selection pZPK-pPGK-hyg-Tnos carrier (Lin XP, Wang YN, Zhang SF, et al.Fems Yeast Res.2014,14: 547 555) 3 restriction enzyme sites EcoR V, the Nco and all not contained in the PZPK-ADH2p-HYG-Thsp carrier of previous step structure I, Spe I design multiple clone site MCS (Multiple Cloning Site).With reference to RF cloning mechanisms, directly design two is completely reversed complementation And containing EcoR V, Nco I, Spe I restriction enzyme site long strand primer ADH2-HSPt-H1:5 '- CacgtctccgacagtcacaGATATCCCATGGACTAGTacgattccgccccgtctca-3 ' and ADH2-HSPt-H1:5 '- TgagacggggcggaatcgtACTAGTCCATGGGATATC tgtgactgtcggagacgtg-3 ' as big primer (mega-primer), etc. Mol ratio adds RFII reaction system, with PZPK-ADH2p-HYG-Thsp carrier for the carrier that sets out, directly carries out RF II clone (strictly according to the facts Execute shown in example 7) by the hyg ORF of the PZPK-ADH2p-HYG-Thsp carrier of MCS fragment displacement previous step structure, constructed The named pZPK-ADH2p-MCS-Thsp of carrier.Structure is as shown in Figure 7.

3. the structure of double expression boxes inducible expression carrier based on ADH2 promoter

With pZPK-ADH2p-MCS-Thsp carrier as template, utilize primer ADH2-HSPt-p1:5 '- AgcttgagcttggatcagattgtcgtTTCGGCTGAGGCTTCCCCGACGCCCC-3 ' and ADH2-HSPt-p1:5 '- CaaacactgatagtttaaactgaaggcggCGCGCACTTCTCTGCAC TGCATC-3 ' carries out " ADH2p-MCS-Thsp " expression cassette Amplification, PCR primer reclaims purification kit (purchased from raw work) through DNA glue and uses RF cloning process (institute in such as embodiment 7 after purification Show) it is inserted in pZPK-pPGK-hyg-Tnos carrier (Lin XP, Wang YN, Zhang by equidirectional for " ADH2p-MCS-Thsp " expression cassette SF, et al.Fems Yeast Res.2014,14:547 555) " pPGK-hyg-Tnos " between expression cassette and RB, " pPGK-hyg-Tnos " Having the intervening sequence of about 100bp between expression cassette (being called for short HYG) and " ADH2p-MCS-Thsp ", the carrier obtained is named PZPK-HYG-ADH2p-MCS-Thsp, structure is as shown in Figure 8." pPGK-hyg-Tnos " expression cassette of this carrier is used for screening restructuring Son, " ADH2p-MCS-Thsp " is then for insertion clone and the abduction delivering of genes of interest.

Embodiment 11: fatty acid hydroxylase expression in lock Sporobolomyces S.pararoseus JCM 3765

Castor oil acid (12-hydroxy-octadeca-cis-9-enoic acid:C18:1-OH) is a class the most valuable essential industry raw material.Existing Predominantly plant is squeezed in source, but resource is restricted.Derive from pathogenic epiphyte Clavicipitaceae (Claviceps purpurea) oleic acid hydroxylation The enzyme gene (CpFAH, Genbank registration number: EU661785) expression in microorganism can be that the supply of castor oil acid provides a new way Footpath.PADH2 promoter is utilized to carry out the abduction delivering of oleate hydroxylase gene C pFAH, to realize synthesizing Semen Ricini in circle rhodosporidium toruloides The purpose of oleic acid.

1.CpFAH glucose removes to hinder the structure of inducible expression carrier

The raw work full genome in Shanghai is entrusted to synthesize this gene according to CpFAH (EU661785) gene of report on NCBI, sequence such as SEQ ID Shown in NO:12 (CpFAH).Primer CpFAH-NcoI-E1:5 '-cggCCATGGACatggcttccgctactcctgcaatg-3 ' and CpFAH-NcoI-E2:5 '-CCGACTAGTctaGTGGTGGTGGTGGTGGTGctgagtcttcattgaaat-3 ' is primer, carries out PCR Amplification.Pcr amplification product utilizes DNA glue to reclaim purification kit (purchased from raw work) and is purified, and it is double to utilize Nco I, Spe I to carry out Enzyme action, and connect into the pZPK-HYG-ADH2p-MCS-Thsp that same Nco I, Spe I process, it is inserted in promoter ADH2p and end Only between sub-Thsp, the glucose of success structuring fatty acid hydroxylase goes to hinder inducible expression carrier pZPK-HYG- ADH2p-CpFAH-Thsp, structure is as shown in Figure 9.The C end of recombinant expressed fatty acid hydroxylase introduces 6 × His Tag, can be used for Western Blot operates.

2. contain the structure of the Agrobacterium tumefaciens attachment of pZPK-HYG-ADH2p-CpFAH-Thsp carrier

Constructed pZPK-HYG-ADH2p-CpFAH-Thsp carrier uses electroporated method to convert to Agrobacterium AGL1, in containing Picking transformant on the LB flat board of 50ng/ μ L kanamycin.Kalamycin resistance Agrobacterium-mediated Transformation enters initially with the method for bacterium colony PCR Row checking.Verify correct transformant, named AGL1/ZPK-HYG-ADH2p-CpFAH-Thsp, save backup.

3.CpFAH is integrated into lock Sporobolomyces S.pararoseus JCM 3765 chromosome through ATMT

Intend pink lock shadow yeast (S.pararoseus) JCM 3765 purchased from China General Microbiological culture presevation administrative center (CGMCC). Take one ring activation after S.pararoseus JCM 3765, be inoculated in 5mL YEPD (glucose 20.0g/L, yeast extract 10.0g/L, Peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulate to OD₆₀₀=1-2, Standby.

The recombinational agrobacterium AGL1/ZPK-HYG-ADH2p-CpFAH-Thsp that step 2 obtains is inoculated in 5mL and contains kanamycin (100 Ng/ μ L) and the LB liquid of rifampicin (80ng/ μ L) in, 250 DEG C, 200r/min overnight incubation.Washing one time with sterilized water, regulation is extremely OD₆₀₀=1-3, standby.

Take above-mentioned plan pink lock shadow yeast the JCM 3765 and each 200 μ L of Agrobacterium diluent, mixing, directly drip in induction flat board (5mmol/l Glucose, 0.5% glycerol, 1.45g/L potassium dihydrogen phosphate, 2.05g/L dipotassium hydrogen phosphate, 0.15g/L sodium chloride, 0.5g/L Magnesium sulfate heptahydrate, 66mg/L calcium chloride dihydrate, 2.48g/L green-vitriol, 0.5g/L ammonium sulfate, 40mmol/l MES (2-(N-morpholine) ethyl sulfonic acid), 2% Agar powder, 200 μm ol/L acetosyringones) surface filter membrane on, 25 DEG C, cultivate 2 days.Filter membrane is induced flat board from IM by aseptic nipper On transfer to galactose induction screening flat board (50ng/ μ L hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, 1.5 agar powders, PH 6.0) on, it is inverted for 30 DEG C and cultivates 48h, until transformant occurs.

4. the bacterium colony PCR intending the hygromycin resistant transformed son of pink lock shadow yeast JCM 3765 identifies

Random 6 geneticin resistant S.pararoseus JCM 3765 transformants of picking access 50mL and contain the half of 50 μ g/mL hygromycin Lactose medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% half Lactose, PH 6.0) in, bead breaking cellular wall method described in reference example 3 extracts genomic DNA, use CpFAH-NcoI-E1 and CpFAH-NcoI-E2 is primer, carries out PCR qualification.Result proves, CpFAH is successfully integrated into S.pararoseus JCM 3765 Genome (not shown).

5. the pink lock shadow yeast JCM 3765 of restructuring plan produces the fermenting experiment of castor oil acid

3 bacterium colony PCR of picking identify that correct plan pink lock shadow yeast JCM 3765 transformant list bacterium colony is connected to 5mL YEPD and cultivates In base (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Cultivate 24h, with the inoculation of 1:50 Amount be connected to galactose inducing culture that 50mL contains 50 μ g/mL hygromycin (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% Yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0) in, as secondary seed.After secondary seed cultivates 24h, Take in the galactose inducing culture that 5mL adds 45mL.Fermentation is terminated after cultivating 96h.Take 40mL zymocyte liquid and be placed in 50mL circle End centrifuge tube, 8000r/min room temperature is centrifuged 5min and collects thalline, is washed with deionized 2 times, and 105 DEG C are dried 24h to constant weight.After taking-up Cooling down in exsiccator, then weigh record, add the ratio of 6mL 4mol/l hydrochloric acid after weighing in 1g dry mycelium, often pipe adds 4mL 4 Mol/l hydrochloric acid, 78 DEG C of water-bath digestion 1h, add the chloroform/methanol (1:1, v/v) of 2 times of volumes, mixing of fully vibrating after cooling, extract 1h Rear centrifugal, take chloroform layer and put in a new centrifuge tube.Aqueous phase extracts once again with equal-volume chloroform, fully centrifugal after vibration, takes chlorine Imitative layer is put in above-mentioned new centrifuge tube and is merged, and adds equal-volume 0.1% sodium chloride solution, centrifugal after vibration mixing.With syringe by lower floor Organic facies carefully extracts and injects (degreasing cotton filled in advance by funnel, and adds appropriate anhydrous sodium sulfate) in preprepared glass funnel, In treating that in funnel, organic solution flows into the glass oil bottle of lower section substantially, add appropriate chloroform and rinse funnel 4 times, in the lump below inflow in oil bottle, Extraction has the chloroform of oils and fats to use Rotary Evaporators to carry out Grease Collection, and the oil bottle that have collected oils and fats is put into oven for drying 24h.

Bacterium oil is carried out esterification: weigh the oils and fats to be measured of 70.0mg, add the CH containing 5%KOH₃OH solution 0.5mL, heating Backflow 50min, is subsequently adding BF₃Methanol solution (V_{BF3 diethyl ether solution}: V_CH3OH=4:10) 0.7mL, continues backflow 10min.After cooling Adding 1mL deionized water and 0.7mL normal hexane, sucking-off organic facies after mixing, for gas chromatographic analysis after deionized water wash twice.

6. the pink lock shadow yeast JCM 3765 of restructuring plan produces the detection of castor oil acid

Transesterification for step 5 sample obtained is dissolved in normal hexane, employing document (Meesapyodsuk, D., and Qiu, X.Plant Physiol., 2008,147,1325-1333.) method in detects, and standard substance are methyl ricinolcic acid (CAS:141-24-2), and negative control is that wild type is intended The transesterification product of oils and fats of pink lock shadow yeast JCM 3765.Result shows, proceeds to the plan pink lock shadow yeast JCM of CpFAH gene Truly having castor oil acid to produce in 3765, content is 280 μ g/mL, and total amount accounts for more than the 62% of overall free fatty acid content.

7. CpFAH expression analysis Western blot during pink lock shadow yeast JCM 3765 is intended in restructuring

Determine that round rhodosporidium toruloides ADH2p promoter can start oleate hydroxylase gene and exist except directly producing phenotype by castor oil acid Outside the expression of lock Sporobolomyces, owing to the C-end of oleate hydroxylase gene expression product carries 6 × His Tag, it is also with anti-His Tag and resists The body expression by immunoblotting assay oleate hydroxylase gene.In above-mentioned steps 4, PCR identifies 6 correct transformants, random picking 3 Individual, access 10mL galactose inducing culture (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% Peptone, 1% cottonseed sugar, 2% galactose, PH 6.0) in, cultivate 48h, 4000r/min in 30 DEG C of shaking tables and be centrifuged 10min collection bacterium Strain.Thalline sterilized water washs after one time, add 400 μ L protein extract buffer (8M carbamide, 65mM DTT, 0.1%Triton X-100, 100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH are 7.4) resuspended, by embodiment 8 Step 5 carries out SDS-PAGE and Western blot and analyzes, and the expression (Figure 10) of oleate hydroxylase all be can be observed.

Embodiment 12: malate dehydrogenase expression in Sporobolomyces Sporobolomyces roseus

Malate dehydrogenase (Malic enzyme, ME) is the main generation enzyme of NADPH, provides reducing power for oil synthesis.If amassed at oils and fats During the tired phase, process LAN malate dehydrogenase increases the supply of NADPH, can improve the intracellular fat content of bacterial strain in theory.

1. justify the structure of the galactose inducible expression carrier of rhodosporidium toruloides malate dehydrogenase RtME

According to justifying rhodosporidium toruloides ME gene place Scaffold sequence (NCBI accession number: KB722664.1), design special primer: ME-P1:5 '-atgcccgcacactttgccccctcccagc-3 ' and ME-P2:5 '-atgcccgcacactttgccccctcccagccc-3 ', obtains with embodiment 1 Round rhodosporidium toruloides CGMCC 2.1389 total serum IgE obtained is template, and method as shown in embodiment 2 carries out RT-PCR, and amplification acquisition contains The full length cDNA sequence of ME.After utilizing DNA to reclaim kits PCR primer, it is cloned into pMD18-T carrier, is transformed into big Enterobacteria (E.coli) DH5 α competent cell.Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction.Recombiant plasmid sample Deliver to the order-checking of Dalian TakaRa company, sequence results and gene order-checking result comparison, it was demonstrated that comprising ME encoding gene total length, its sequence is such as Shown in SEQ ID NO:13, (RtME).The named T-ME of this plasmid.

Design primer ME-NcoI-E1:5 '-cggCCATGGACatgcccgcacactttgccccctccca gcccctcca-3 ' and ME-NcoI-E2: 5 '-CCGACTAGTctaGTGATGGTGATGGTGGTG ctgcgcctgctgct-3 ', with T-ME as template, carry out PCR amplification. Pcr amplification product utilizes DNA glue to reclaim purification kit (purchased from raw work) and is purified, and utilizes Nco I, Spe I to carry out double digestion, And connect into the pZPK-HYG-ADH2-MCS-Thsp that same Nco I, Spe I process, it is inserted in promoter ADH2p and terminator Thsp Between, the glucose successfully building malate dehydrogenase removes to hinder inducible expression carrier pZPK-HYG-ADH2p-ME-Thsp, shown (pZPK-HYG-ADH2p-ME-Thsp), structure is as shown in figure 11.The C end of recombinant expressed fatty acid hydroxylase introduces 6 × His Tag, Can be used for Western blot operation.

2. contain the structure of the Agrobacterium tumefaciens attachment of pZPK-HYG-ADH2p-ME-Thsp carrier

Constructed pZPK-HYG-ADH2p-ME-Thsp carrier uses electroporated method to convert to Agrobacterium AGL1, in containing 50 Picking transformant on the LB flat board of ng/ μ L kanamycin.Kalamycin resistance Agrobacterium-mediated Transformation is carried out initially with the method for bacterium colony PCR Checking.Verify correct transformant, named AGL1/ZPK-HYG-ADH2p-ME-Thsp, save backup.

3.ME is integrated into Sporobolomyces pink shadow yeast JCM 8242 chromosome through ATMT

Pink shadow yeast (Sporobolomyces roseus) JCM 8242 is purchased from Japan's Culture Collection (JCM).Take one S.roseus JCM 8242 after ring activation, is inoculated in 5mL YEPD (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulate to OD₆₀₀=1-2, standby.

The recombinational agrobacterium AGL1/ZPK-HYG-ADH2p-ME-Thsp that step 2 obtains is inoculated in 5mL and contains kanamycin (100 Ng/ μ L) and the LB liquid of rifampicin (80ng/ μ L) in, 250 DEG C, 200r/min overnight incubation.Washing one time with sterilized water, regulation is extremely OD₆₀₀=1-3, standby.

Take above-mentioned pink shadow yeast the JCM 8242 and each 200 μ L of Agrobacterium diluent, mixing, carry out ATMT by embodiment 13 step 3 Operation, until transformant occurs.

The bacterium colony PCR of the most pink hygromycin resistant transformed son of shadow yeast JCM 8242 identifies

Random 6 geneticin resistant S.roseus JCM 8242 transformants of picking access the gala that 50mL contains 50ng/ μ L Geneticin Sugar inducing culture (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% Galactose, PH 6.0), bead breaking cellular wall method described in reference example 3 extracts genomic DNA, uses ME-NcoI-E1 and ME-NcoI-E2 For primer, carry out PCR qualification.Result proves, ME encoding gene is successfully integrated into S.roseus JCM 8242 genome (not shown).

5. pink shadow yeast S.roseus JCM 8242 oil fermentation of restructuring

3 bacterium colony PCR of picking identify correct pink shadow yeast JCM 8242 transformant list bacterium colony, as shown in embodiment 11 step 5 Method carries out fermenting, intracellular oils and fats extracts and analyzes.Result shows, than wild strain S.roseus JCM 8242, and process LAN circle red winter The restructuring S.roseus JCM 8242 intracellular fat content of spore yeast malate dehydrogenase has been brought up to 45% by 25%, adds 80%.

6. ME expression analysis Western blot in restructuring S.roseus JCM 8242

Determine that round rhodosporidium toruloides ADH2p promoter can start round rhodosporidium toruloides Fructus Mali pumilae except directly increasing performance by oil and fat accumulation Acid enzyme (RtME) gene, outside the expression of lock Sporobolomyces, owing to the C-end of RtME expression product carries 6 × His Tag, is also with The expression by immunoblotting assay ME of the anti-His Tag antibody.In above-mentioned steps 4, PCR identifies 6 correct transformants, random picking 3, access 10mL galactose inducing culture (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% Peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), cultivate 48h, 4000r/min in 30 DEG C of shaking tables and be centrifuged 10min collection bacterial strain. Thalline sterilized water washs after one time, add 400 μ L protein extract buffer (8M carbamide, 65mM DTT, 0.1%Triton X-100, 100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH are 7.4) resuspended, by embodiment 8 Step 5 carries out SDS-PAGE and Western blot and analyzes, and the expression (Figure 12) of RtME all be can be observed.

Embodiment 13:GFP abduction delivering in Rhodotorula rhodothece rubra CGMCC 2.279

In view of rhodothece rubra genetic background is unintelligible, it is impossible to separation its own promoter and terminator element carry out the expression of genes of interest, this technology Invention utilizes circle rhodosporidium toruloides ADH2 promoter and Thsp terminator, establishes rhodothece rubra genetic manipulation system, it is achieved that GFP exists Abduction delivering in rhodothece rubra CGMCC 2.279.

1.GFP glucose removes to hinder the structure of inducible expression carrier

According to the aminoacid sequence (AFA52654.1) of the GFP of report on NCBI, it is optimized by circle rhodosporidium toruloides codon preference, Entrusting the raw work full genome in Shanghai to synthesize its gene, sequence is as shown in SEQ ID NO:16 (GFP).Primer GFP-NcoI-E1: 5 '-cggCCATGGACatgtcgaagggtgaggagcttttc-3 ' and GFP-NcoI-E2: 5 '-CCGACTAGTctaGTGGTGGTGGTGGTGGTGcttgtagagttcgtccatgccgtg-3 ' are primer, carry out PCR amplification.PCR Amplified production utilizes DNA glue to reclaim purification kit (purchased from raw work) and is purified, and utilizes Nco I, Spe I to carry out double digestion, and connects Access the pZPK-HYG-ADH2p-MCS-Thsp that same Nco I, Spe I process, be inserted in promoter ADH2p and terminator Thsp it Between, the glucose successfully building green fluorescent protein goes to hinder inducible expression carrier pZPK-HYG-ADH2p-GFP-Thsp, structure such as Figure 13 Shown in.The C end of recombinant expressed green fluorescent protein introduces 6 × His Tag, can be used for Western blot operation.

2. contain the structure of the Agrobacterium tumefaciens attachment of pZPK-HYG-ADH2p-GFP-Thsp carrier

Constructed pZPK-HYG-ADH2p-GFP-Thsp carrier uses electroporated method to convert to Agrobacterium AGL1, in containing 50 Picking transformant on the LB flat board of ng/ μ L kanamycin.Kalamycin resistance Agrobacterium-mediated Transformation is carried out initially with the method for bacterium colony PCR Checking.Verify correct transformant, named AGL1/ZPK-HYG-ADH2p-GFP-Thsp, save backup.

3.GFP is integrated into rhodothece rubra CGMCC 2.279 chromosome through ATMT

Rhodothece rubra (Rhodotorula rubra) CGMCC 2.279 is purchased from barms preservation center (purchased from China General Microbiological bacterium Plant preservation administrative center (CGMCC).Take the rhodothece rubra CGMCC 2.279 after a ring activation, be inoculated in 5mL YEPD (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min incubated overnight.Use aseptic washing After washing one time, regulate to OD₆₀₀=1-2, standby.

The recombinational agrobacterium AGL1/ZPK-HYG-ADH2p-GFP-Thsp that step 2 obtains is inoculated in 5mL and contains kanamycin (100 Ng/ μ L) and the LB liquid of rifampicin (80ng/ μ L) in, 250 DEG C, 200r/min overnight incubation.Washing one time with sterilized water, regulation is extremely OD₆₀₀=1-3, standby.

Take above-mentioned rhodothece rubra the CGMCC 2.279 and each 200 μ L of Agrobacterium diluent, mixing, carry out ATMT by embodiment 13 step 3 Operation, until transformant occurs.

4. the bacterium colony PCR of the hygromycin resistant transformed son of rhodothece rubra CGMCC 2.279 identifies

Random 6 geneticin resistant rhodothece rubra CGMCC 2.279 transformants of picking access 50mL and contain 50ng/ μ L Geneticin Galactose inducing culture (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), bead breaking cellular wall method described in reference example 3 extracts genomic DNA, use GFP-NcoI-E1 and GFP-NcoI-E2 is primer, carries out PCR qualification.Result proves, GFP gene is successfully integrated into rhodothece rubra CGMCC 2.279 base Because of group (not shown).

5. the Fluirescence observation of the hygromycin resistant transformed son of rhodothece rubra CGMCC 2.279

3 bacterium colony PCR of picking identify that the correct rhodothece rubra CGMCC 2.279 single bacterium colony of hygromycin resistant transformed son is connected to 5mL YEPD In culture medium (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Cultivate 24h, with 1:50's Inoculum concentration be connected to galactose inducing culture that 50mL contains 50ng/ μ L hygromycin (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), as secondary seed.After secondary seed cultivates 24h, Take in the galactose inducing culture that 5mL adds 45mL.Fermentation is terminated after cultivating 48h.Take bacterium solution 10 μ L point in microscope slide, cover Coverslip is placed on fluorescence microscope and carries out green fluorescence observation, excitation wavelength 498nm, launches wavelength 516, and GFP restructuring rhodothece rubra can Observe green fluorescence, compare wild type rhodothece rubra CGMCC 2.279 then unstressed configuration and (not shown) occurs.

6. GFP expression analysis Western blot in restructuring rhodothece rubra CGMCC 2.279

Except directly determining that round rhodosporidium toruloides ADH2p promoter can start GFP at the dark red ferment of Rhodotorula by green fluorescence phenotype Outside female expression, owing to the C-end of restructuring GFP carries 6 × His Tag, it is also with anti-His Tag antibody by immunoblotting assay GFP Expression.In above-mentioned steps 4, PCR identifies 6 correct transformants, random picking 3, accesses the galactose culture medium (50 of 10mL μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), Cultivate 48h, 4000r/min in 30 DEG C of shaking tables and be centrifuged 10min collection bacterial strain.After thalline washs one time with sterilized water, add 400 μ L's Protein extract buffer (8M carbamide, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH are 7.4) resuspended, carry out SDS-PAGE and Western blot by the step 5 of embodiment 8 and divide Analysis, all can be observed the expression (Figure 14) of GFP.

Embodiment 14:GFP galactose abduction delivering in Rhodotorula rhodotorula mucilaginosa CGMCC 2.22

In view of rhodotorula mucilaginosa (Rhodotorula mucilaqinosa) genetic background is unintelligible, it is impossible to separate its own promoter and terminator element enters The expression of row genes of interest, this technological invention utilizes circle rhodosporidium toruloides ADH2p promoter and Thsp terminator, establishes rhodothece rubra and loses Pass operation system, it is achieved that GFP abduction delivering in rhodotorula mucilaginosa CGMCC 2.22.

1.GFP is integrated into rhodotorula mucilaginosa CGMCC 2.22 chromosome through ATMT

The restructuring agriculture bar AGL1/ZPK-HYG-ADH2p-GFP-Thsp that embodiment 13 step 2 obtains is inoculated in 5mL and contains kanamycin In the LB liquid of (100ng/ μ L) and rifampicin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.Wash one time with sterilized water, Regulate to OD₆₀₀=1-3, standby.

Rhodotorula mucilaginosa CGMCC 2.22 purchased from barms preservation center (purchased from China General Microbiological culture presevation administrative center (CGMCC).Taking the rhodotorula mucilaginosa CGMCC 2.22 after a ring activation, (glucose 20.0g/L, yeast extracts to be inoculated in 5mL YEPD Thing 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulation is extremely OD₆₀₀=1-2, standby.

Take above-mentioned rhodotorula mucilaginosa the CGMCC 2.22 and each 200 μ L of Agrobacterium diluent, mixing, carry out ATMT by embodiment 13 step 3 Operation, until transformant occurs.

2. the bacterium colony PCR of the hygromycin resistant transformed son of rhodotorula mucilaginosa CGMCC 2.22 identifies

Random 6 geneticin resistant rhodothece rubra CGMCC 2.279 transformants of picking access 50mL and contain 50ng/ μ L Geneticin Galactose culture medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% Galactose, PH 6.0), bead breaking cellular wall method described in reference example 3 extracts genomic DNA, use GFP-NcoI-E1 and GFP-NcoI-E2 is primer, carries out PCR qualification.Result proves, GFP gene is successfully integrated into rhodotorula mucilaginosa CGMCC 2.22 gene Group (not shown).

3. the Fluirescence observation of the hygromycin resistant transformed son of rhodotorula mucilaginosa CGMCC 2.22

3 bacterium colony PCR of picking identify that the correct rhodotorula mucilaginosa CGMCC 2.22 single bacterium colony of hygromycin resistant transformed son is by embodiment 13 step 5 carry out strain culturing and microscope observation, and GFP restructuring rhodotorula mucilaginosa can be observed green fluorescence, and compares wild type rhodotorula mucilaginosa CGMCC There is (not shown) in 2.22 unstressed configuration.

4. GFP expression analysis Western blot in restructuring rhodotorula mucilaginosa CGMCC 2.22

Except directly determining that round rhodosporidium toruloides PADH2 promoter can start GFP at the red ferment of Rhodotorula glue by green fluorescence phenotype Outside the expression of female CGMCC 2.22, owing to the C-end of restructuring GFP carries 6 × His Tag, it is also with anti-His Tag antibody by immunity The expression of engram analysis GFP.In above-mentioned steps 3, PCR identifies 6 correct transformants, random picking 3, accesses the half of 10mL Lactose medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% half Lactose, PH 6.0), cultivate 48h, 4000r/min in 30 DEG C of shaking tables and be centrifuged 10min collection bacterial strain.After thalline washs one time with sterilized water, Add 400 μ L protein extract buffer (8M carbamide, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH are 7.4) resuspended, by the step 5 of embodiment 8 carry out SDS-PAGE and Western blot analyzes, and the expression (Figure 15) of GFP all be can be observed.

Embodiment 15: fatty acid hydroxylase expression in Rhodotorula Rhodotorula marina

The oleate hydroxylase gene (CpFAH, Genbank registration number: EU661785) deriving from Clavicipitaceae is real under PADH2 promoter starts Show the synthesis in castor oil acid Rhodothece glutinis by the sea.

1.CpFAH is integrated into Rhodotorula marina CGMCC 2.4203 chromosome through ATMT

The AGL1/ZPK-HYG-ADH2p-CpFAH-Thsp recombinational agrobacterium that embodiment 11 step 2 obtains, is inoculated in 5mL and contains card In the LB liquid of that mycin (100ng/ μ L) and rifampicin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.Wash with sterilized water One time, regulate to OD₆₀₀=1-3, standby.

Rhodotorula marina (Rhodotorula marina) CGMCC 2.4203 (is purchased from the common micro-life of China purchased from barms preservation center Thing culture presevation administrative center (CGMCC).Take the Rhodotorula marina CGMCC 2.4203 after a ring activation, be inoculated in 5mL YEPD (Portugal Grape sugar 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min incubated overnight.With aseptic After water washs one time, regulate to OD₆₀₀=1-2, standby.

Take above-mentioned plan Rhodotorula marina the CGMCC 2.4203 and each 200 μ L of Agrobacterium diluent, carry out ATMT by embodiment 13 step 3 Operation, until transformant occurs.

2. the bacterium colony PCR of the hygromycin resistant transformed son of Rhodotorula marina CGMCC 2.4203 identifies

Random 6 geneticin resistant Rhodotorula marina CGMCC 2.4203 transformants of picking access 50mL and contain 50ng/ μ L hygromycin Galactose inducing culture (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), bead breaking cellular wall method described in reference example 3 extracts genomic DNA, use CpFAH-NcoI-E1 and CpFAH-NcoI-E2 is primer, carries out PCR qualification.Result proves, CpFAH is successfully integrated into Rhodotorula marina CGMCC 2.4203 Genome (not shown).

3. restructuring Rhodotorula marina CGMCC 2.4203 produces the fermenting experiment of castor oil acid

3 bacterium colony PCR of picking identify that correct Rhodotorula marina CGMCC 2.4203 transformant list bacterium colony is connected to 5mL YEPD culture medium In (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Cultivate 24h, with the inoculum concentration of 1:50 It is connected to 50mL and contains the YEPD culture medium of 50ng/ μ L hygromycin, as secondary seed.After secondary seed cultivates 24h, centrifugal collection bacterium Body, is re-seeded into fresh 50mL and contains the YEPD culture medium of 50ng/ μ L hygromycin, after concentration of glucose is reduced to 2g/L, ADH2 Promoter is derepressed by glucose and induces startup CpFAH to be expressed, and then proceedes to cultivate 24h and terminates fermentation.Take 40mL zymocyte liquid to put In 50mL round bottom centrifuge tube, 8000r/min room temperature is centrifuged 5min and collects thalline, is washed with deionized 2 times, and 105 DEG C are dried 24h to permanent Weight.After taking-up, method as shown in embodiment 11 carries out oils and fats extraction and bacterium oil is transesterification.

4. restructuring Rhodotorula marina CGMCC 2.4203 produces the detection of castor oil acid

Transesterification for step 7 sample obtained is dissolved in normal hexane, uses document (Meesapyodsuk, D., and Qiu, X.Plant Physiol., 2008,147,1325-1333.) method in detects, and standard substance are methyl ricinolcic acid (CAS:141-24-2), and negative control is wild The transesterification product of oils and fats of raw type Rhodotorula marina CGMCC 2.4203.Result shows, proceeds in the Rhodotorula marina of CpFAH gene true Having castor oil acid to produce, content is 282 μ g/mL, and total amount accounts for more than the 60% of overall free fatty acid content.

5. CpFAH expression analysis Western blot in restructuring Rhodotorula marina CGMCC 2.4203

Determine that round rhodosporidium toruloides ADH2p promoter can start oleate hydroxylase gene and exist except directly producing phenotype by castor oil acid Outside the expression of Rhodotorula marina CGMCC 2.4203, owing to the C-end of oleate hydroxylase gene expression product carries 6 × His Tag, also can profit With the expression by immunoblotting assay oleate hydroxylase gene of the anti-His Tag antibody.In above-mentioned steps 4, PCR identifies 6 correct conversions Son, random picking 3, accesses galactose inducing culture (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% ferment of 10mL Female extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), cultivate 48h, 4000r/min in 30 DEG C of shaking tables and be centrifuged 10 Min collects bacterial strain.Thalline sterilized water washs after one time, add 400 μ L protein extract buffer (8M carbamide, 65mM DTT, 0.1% Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH are 7.4) resuspended, Carry out SDS-PAGE and Western blot by the step 5 of embodiment 8 to analyze, the expression (not shown) of oleate hydroxylase all be can be observed.

Embodiment 16: inulinase expression in Rhodotorula standing grain this Rhodothece glutinis CGMCC 2.4202

Inulin is polyfructosan, there are about 30000 various plants and all contain Inulin polysaccharide in nature, and world's annual production of inulin is up to 350000 Ton, is the second largest plant carbohydrates being only second to starch.It is in the industry and as the biomass material more product inulin plant of application Herba Cichorii and Jerusalem artichoke.These biomass process through exoinulinase and generate the fructose and a small amount of glucose that can be utilized by multiple-microorganism.This skill Art invention utilizes circle rhodosporidium toruloides ADH2p promoter and Thsp terminator, establishes standing grain this Rhodothece glutinis genetic manipulation system, it is achieved that outer Cut inulinase abduction delivering in this Rhodothece glutinis of standing grain (Rhodotorula graminis) CGMCC 2.4202.

1. inulinase glucose removes to hinder the structure of inducible expression carrier

According to yeast Kluyveromyces marxianus exoinulinase aminoacid sequence in ZL 2007100159198.8 patent, according to circle rhodosporidium toruloides Codon preference is optimized, and entrusts the raw work in Shanghai to carry out full genome synthesis, and sequence is as shown in SEQ ID NO:17 (INU).Design is drawn Thing INU-NcoI-E1:5 '-cggCCATGGACatgcgcttcgcgtactccctcttgctc-3 ' and INU-NcoI-E2: 5 '-CCGACTAGTctaGTGATGGTGATGGTGGTGgaggttgaactgggtgacgttg-3 ', with complete synthesis INU gene as template, Carry out PCR amplification.Pcr amplification product utilizes DNA glue to reclaim purification kit (purchased from raw work) and is purified, and utilize Nco I, Spe I carries out double digestion, and connects into the pZPK-HYG-ADH2p-MCS-Thsp that same Nco I, Spe I process, and is inserted in promoter Between ADH2p and terminator Thsp, the glucose successfully building inulinase goes to hinder inducible expression carrier PZPK-HYG-ADH2p-INU-Thsp, structure is as shown in figure 16.The C end of recombinant expressed fatty acid hydroxylase introduces 6 × His Tag, can Operate for Western blot.

2. contain the structure of the Agrobacterium tumefaciens attachment of pZPK-HYG-ADH2p-INU-Thsp carrier

Constructed pZPK-HYG-ADH2p-INU-Thsp carrier uses electroporated method to convert to Agrobacterium AGL1, in containing 50 Picking transformant on the LB flat board of ng/ μ L kanamycin.Kalamycin resistance Agrobacterium-mediated Transformation is carried out initially with the method for bacterium colony PCR Checking.Verify correct transformant, named AGL1/ZPK-HYG-ADH2p-INU-Thsp, save backup.

3.INU is integrated into standing grain this Rhodothece glutinis CGMCC 2.4202 chromosome through ATMT

Standing grain this Rhodothece glutinis CGMCC 2.4202 is purchased from Japan's Culture Collection (JCM).Take this Rhodothece glutinis of standing grain after a ring activation CGMCC 2.4202, is inoculated in 5mL YEPD (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) In, 25 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulate to OD₆₀₀=1-2, standby.

The recombinational agrobacterium AGL1/ZPK-HYG-PADH2-INU-Thsp that step 2 obtains is inoculated in 5mL and contains kanamycin (100 Ng/ μ L) and the LB liquid of rifampicin (80ng/ μ L) in, 250 DEG C, 200r/min overnight incubation.Washing one time with sterilized water, regulation is extremely OD₆₀₀=1-3, standby.

Take above-mentioned standing grain this Rhodothece glutinis CGMCC 2.4202 and each 200 μ L of Agrobacterium diluent, mixing, carry out ATMT by embodiment 13 step 3 Operation, until transformant occurs.

4. the bacterium colony PCR of the hygromycin resistant transformed son of this Rhodothece glutinis of standing grain CGMCC 2.4202 identifies

Random 6 geneticin resistant standing grain this Rhodothece glutinis CGMCC 2.4202 transformants of picking access 50mL and contain 50ng/ μ L hygromycin Galactose inducing culture (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), bead breaking cellular wall method described in reference example 3 extracts genomic DNA, use INU-NcoI-E1 and INU-NcoI-E2 is primer, carries out PCR qualification.Result proves, ME encoding gene is successfully integrated into standing grain this Rhodothece glutinis CGMCC 2.4202 Genome (not shown).

5. carry out, for carbon source, standing grain this Rhodothece glutinis oil fermentation of recombinating with inulin

3 bacterium colony PCR of picking identify that correct standing grain this Rhodothece glutinis CGMCC 2.4202 transformant list bacterium colony is connected to 5mL YEPD culture medium In (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Cultivate 24h, with the inoculum concentration of 1:50 (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast carry to be connected to the galactose culture medium that 50mL contains 50ng/ μ L hygromycin Take thing, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), as secondary seed.Centrifugal thalline of collecting is re-seeded into 50mL Inulin culture medium (5g/L ammonium sulfate, 0.64g/L potassium sulfate, 0.08g/L disodium hydrogen phosphate dodecahydrate, 0.94g/L sodium sulfate, 1.5g/L Magnesium sulfate heptahydrate, 5% inulin, 2% galactose, PH 6.0) in.Fermentation is terminated after cultivating 96h.Take 40mL zymocyte liquid and be placed in 50mL Round bottom centrifuge tube, 8000r/min room temperature is centrifuged 5min and collects thalline, is washed with deionized 2 times, and 105 DEG C are dried 24h to constant weight.Afterwards Oils and fats extraction is carried out by the step 5 of embodiment 11.Result shows, wild strain standing grain this Rhodothece glutinis CGMCC 2.4202 is only utilizing inulin One carbon source carries out can accumulating during fermentation 96h the intracellular oils and fats of 18%；And restructuring this Rhodothece glutinis of standing grain of process LAN exoinulinase utilizes the inulin to be It is then 52% that sole carbon source carries out intracellular fat content during fermentation 96h, can directly change inulin into intracellular oils and fats.

6. INU expression analysis Western blot in restructuring standing grain this Rhodothece glutinis CGMCC 2.4202

Except directly utilizing phenotype to determine by inulin, round rhodosporidium toruloides PADH2 promoter can start exoinulinase at Rhodotorula Expression outside, due to restructuring INU expression product C-end carry 6 × His Tag, be also with anti-His Tag antibody and divided by immunoblotting The expression of analysis ME.In above-mentioned steps 4, PCR identifies 6 correct transformants, random picking 3, and the galactose accessing 10mL is cultivated Base (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), cultivate 48h, 4000r/min in 30 DEG C of shaking tables and be centrifuged 10min collection bacterial strain.After thalline washs one time with sterilized water, add 400 Protein extract buffer (8M carbamide, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, the 1mM of μ L PMSF, 1mM EGTA, 1mM EDTA, pH are 7.4) resuspended, carry out SDS-PAGE and Western blot by the step 5 of embodiment 8 Analyze, the expression (not shown) of INU all be can be observed.

Embodiment 17:GFP galactose abduction delivering in Rhodotorula rhodotorula glutinis

This technological invention utilizes circle rhodosporidium toruloides ADH2p promoter and Thsp terminator, establishes rhodotorula glutinis (Rhodotorula Glutinis) genetic manipulation system, it is achieved that GFP abduction delivering in rhodotorula glutinis NCYC 2666.

1.GFP is integrated into rhodotorula glutinis NCYC 2666 chromosome through ATMT

The restructuring agriculture bar AGL1/ZPK-HYG-ADH2p-GFP-Thsp that embodiment 13 step 2 obtains is inoculated in 5mL and contains kanamycin In the LB liquid of (100ng/ μ L) and rifampicin (80ng/ μ L), 250 DEG C, 200r/min overnight incubation.Wash one time with sterilized water, Regulate to OD₆₀₀=1-3, standby.

Rhodotorula glutinis NCYC 2666 purchased from United Kingdom National barms preservation center (National Collection of Yeast Cultures, NCYC).Take the rhodotorula glutinis NCYC 2666 after a ring activation, be inoculated in 5mL YEPD (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0) in, 25 DEG C, 200r/min incubated overnight.After washing one time with sterilized water, regulate to OD₆₀₀=1-2, Standby.

Take above-mentioned rhodotorula glutinis the NCYC 2666 and each 200 μ L of Agrobacterium diluent, mixing, carry out ATMT behaviour by embodiment 13 step 3 Make, until transformant occurs.

2. the bacterium colony PCR of the hygromycin resistant transformed son of rhodotorula glutinis NCYC 2666 identifies

Random 6 geneticin resistant rhodotorula glutinis NCYC 2666 transformants of picking access the gala that 50mL contains 50ng/ μ L hygromycin Sugar culture-medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% gala Sugar, PH 6.0), bead breaking cellular wall method described in reference example 3 extracts genomic DNA, uses GFP-NcoI-E1 and GFP-NcoI-E2 For primer, carry out PCR qualification.Result proves, GFP gene is successfully integrated into rhodotorula glutinis NCYC 2666 genome (not shown).

3. the Fluirescence observation of the hygromycin resistant transformed son of rhodotorula glutinis NCYC 2666

3 bacterium colony PCR of picking identify that the correct rhodotorula glutinis NCYC 2666 single bacterium colony of hygromycin resistant transformed son is connected to 5mL YEPD training Support in base (glucose 20.0g/L, yeast extract 10.0g/L, peptone 20.0g/L, pH 6.0).Cultivate 24h, connecing with 1:50 The amount of kind is connected to galactose culture medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% ferment that 50mL contains 50ng/ μ L hygromycin Female extract, 2% peptone, 1% cottonseed sugar, 2% galactose, PH 6.0), as secondary seed.After secondary seed cultivates 24h, take 5mL adds in the galactose culture medium of 45mL.Fermentation is terminated after cultivating 48h.Take bacterium solution 10 μ L point in microscope slide, covered It is placed on fluorescence microscope and carries out green fluorescence observation, excitation wavelength 498nm, launch wavelength 516, GFP recombinant paramyxovirus Rhodothece glutinis NCYC 2666 Green fluorescence be can be observed, compare wild type rhodotorula glutinis NCYC 2666 then unstressed configuration and (not shown) occurs.

4. GFP expression analysis Western blot in restructuring rhodotorula mucilaginosa CGMCC 2.22

Except directly determining that round rhodosporidium toruloides ADH2p promoter can start GFP at the red ferment of Rhodotorula glue by green fluorescence phenotype Outside the expression of female CGMCC 2.22, owing to the C-end of restructuring GFP carries 6 × His Tag, it is also with anti-His Tag antibody by immunity The expression of engram analysis GFP.In above-mentioned steps 4, PCR identifies 6 correct transformants, random picking 3, accesses the half of 10mL Lactose medium (50 μ g/mL hygromycin, 300 μ g/mL cephalosporins, 1% yeast extract, 2% peptone, 1% cottonseed sugar, 2% half Lactose, PH 6.0), cultivate 48h, 4000r/min in 30 DEG C of shaking tables and be centrifuged 10min collection bacterial strain.After thalline washs one time with sterilized water, Add 400 μ L protein extract buffer (8M carbamide, 65mM DTT, 0.1%Triton X-100,100mM NaCl, 50mM Tris-Cl, 1mM PMSF, 1mM EGTA, 1mM EDTA, pH are 7.4) resuspended, by the step 5 of embodiment 8 carry out SDS-PAGE and Western blot analyzes, and the expression (not shown) of GFP all be can be observed.

Claims (10)

1. a glucose derepresses evoked promoter, it is characterised in that: nucleotide sequence such as SEQ ID NO: Shown in 1.

2. the nucleotide sequence of the evoked promoter that derepresses containing glucose described in claim 1 DNA expression cassette.

3. according to the DNA expression cassette described in claim 2, it is characterised in that: possibly together with SEQ ID NO: Nucleotide sequence shown in 2 is as terminator, and wherein the sequence shown in SEQ ID NO:1 is positioned at SEQ ID The upstream of the sequence shown in NO:2, for coding purpose base between SEQ ID NO:1 and SEQ ID NO:2 The open reading frame of cause.

4. according to the DNA expression cassette described in claim 3, it is characterised in that: described coding genes of interest The cDNA sequence of open reading frame there is the nucleotide sequence as shown in SEQ ID NO:4.

5. the recombinant vector of the DNA expression cassette that a kind comprises according to any one of claim 2-4.

6. according to the recombinant vector described in claim 5, it is characterised in that: described carrier be sequestered or Integrating vector.

7. according to the recombinant vector described in claim 6, it is characterised in that: described integrating vector is agriculture bar The binary expression vector of bacterium mediation, or for carrying target gene flank 1500-4000 base homologous recombination arm Homologous recombination vector；Described homologous recombination vector skeleton or described episomal vector are selected from escherichia coli cloning Carrier or yeast shuttle vector, preferably PZPK or pZP2000, pMD18-T, pUC18, pYES2c/t Or pYX212.

8. the host cell of the recombinant vector comprised described in any one of claim 5-7.

9. according to the host cell described in claim 8, it is characterised in that: described host cell is large intestine bar Bacterium cell or yeast cells.

10. the expression system for oleaginous yeast genetic expression, it is characterised in that: described expression system Comprise:

(1) table in Saccharomyces, Sporobolomyces and Rhodotorula bacterial strain can be thrown at Rhodosporidium, lock The improved carrier reached, described improved carrier by can in above-mentioned Saccharomyces integrant expression or free express Plasmid in insert the promoter sequence shown in SEQ ID NO:1 and the termination shown in SEQ ID NO:2 Subsequence builds and obtains, and wherein the promoter sequence shown in SEQ ID NO:1 is positioned at SEQ ID NO:2 Shown in the upstream of shown terminator sequence, the sequence shown in SEQ ID NO:1 and SEQ ID NO:2 Sequence between be multiple clone site, and described carrier also comprises selected marker；With

(2) genes of interest open reading frame sequence, it can be inserted into changing described in (1) operably In good carrier, and described genes of interest is made to meet with the promoter in the improved carrier described in (1) and terminator The connection of reading frame, and

(3) Rhodosporidium, lock throw Saccharomyces, Sporobolomyces and Rhodotorula bacterial strain.