CN106305625A - Application of trialeurodes vaporarionm westwood to separation of tomato chlorosis viruses (ToCVs) - Google Patents
Application of trialeurodes vaporarionm westwood to separation of tomato chlorosis viruses (ToCVs) Download PDFInfo
- Publication number
- CN106305625A CN106305625A CN201610676236.6A CN201610676236A CN106305625A CN 106305625 A CN106305625 A CN 106305625A CN 201610676236 A CN201610676236 A CN 201610676236A CN 106305625 A CN106305625 A CN 106305625A
- Authority
- CN
- China
- Prior art keywords
- trialeurodes vaporariorum
- tomato
- vaporariorum westwood
- westwood
- tocv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000948359 Tomato chlorosis virus Species 0.000 title claims abstract description 54
- 238000000926 separation method Methods 0.000 title abstract description 5
- 241000018135 Trialeurodes Species 0.000 title abstract 6
- 241000702308 Tomato yellow leaf curl virus Species 0.000 claims abstract description 41
- 240000003768 Solanum lycopersicum Species 0.000 claims abstract description 39
- 241000700605 Viruses Species 0.000 claims abstract description 23
- 241000018137 Trialeurodes vaporariorum Species 0.000 claims description 64
- 239000002574 poison Substances 0.000 claims description 37
- 231100000614 poison Toxicity 0.000 claims description 37
- 238000001514 detection method Methods 0.000 claims description 35
- 238000000034 method Methods 0.000 claims description 25
- 241000196324 Embryophyta Species 0.000 claims description 20
- 235000007688 Lycopersicon esculentum Nutrition 0.000 claims description 20
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 claims description 16
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 13
- 102000006382 Ribonucleases Human genes 0.000 claims description 10
- 108010083644 Ribonucleases Proteins 0.000 claims description 10
- 239000002299 complementary DNA Substances 0.000 claims description 9
- 238000011109 contamination Methods 0.000 claims description 9
- 238000000605 extraction Methods 0.000 claims description 9
- 239000007788 liquid Substances 0.000 claims description 8
- 229910052757 nitrogen Inorganic materials 0.000 claims description 8
- 238000000137 annealing Methods 0.000 claims description 6
- 238000006243 chemical reaction Methods 0.000 claims description 6
- 230000007850 degeneration Effects 0.000 claims description 6
- 238000004925 denaturation Methods 0.000 claims description 6
- 230000036425 denaturation Effects 0.000 claims description 6
- 230000008014 freezing Effects 0.000 claims description 6
- 238000007710 freezing Methods 0.000 claims description 6
- 238000000227 grinding Methods 0.000 claims description 6
- 208000015181 infectious disease Diseases 0.000 claims description 6
- 230000004044 response Effects 0.000 claims description 6
- 210000002966 serum Anatomy 0.000 claims description 6
- 239000003153 chemical reaction reagent Substances 0.000 claims description 5
- 239000012154 double-distilled water Substances 0.000 claims description 5
- 239000000203 mixture Substances 0.000 claims description 5
- 238000011144 upstream manufacturing Methods 0.000 claims description 5
- 238000012233 TRIzol extraction Methods 0.000 claims description 4
- 230000015572 biosynthetic process Effects 0.000 claims description 4
- 230000004087 circulation Effects 0.000 claims description 4
- 238000003786 synthesis reaction Methods 0.000 claims description 4
- 238000007400 DNA extraction Methods 0.000 claims description 3
- 230000009385 viral infection Effects 0.000 claims description 3
- 241001465754 Metazoa Species 0.000 claims description 2
- 244000061458 Solanum melongena Species 0.000 claims description 2
- 239000012467 final product Substances 0.000 claims description 2
- 238000010839 reverse transcription Methods 0.000 claims description 2
- 241000227653 Lycopersicon Species 0.000 claims 3
- 230000027772 skotomorphogenesis Effects 0.000 claims 1
- 230000005540 biological transmission Effects 0.000 abstract 1
- 230000009182 swimming Effects 0.000 description 13
- 239000013642 negative control Substances 0.000 description 6
- 239000013641 positive control Substances 0.000 description 6
- 241000254127 Bemisia tabaci Species 0.000 description 5
- 239000012634 fragment Substances 0.000 description 4
- 241000372028 Broad bean wilt virus Species 0.000 description 3
- 201000010099 disease Diseases 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 241000724252 Cucumber mosaic virus Species 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 241000238631 Hexapoda Species 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 230000000052 comparative effect Effects 0.000 description 2
- 239000002917 insecticide Substances 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- 235000013311 vegetables Nutrition 0.000 description 2
- 210000003462 vein Anatomy 0.000 description 2
- 230000003612 virological effect Effects 0.000 description 2
- 108090000565 Capsid Proteins Proteins 0.000 description 1
- 206010023126 Jaundice Diseases 0.000 description 1
- 238000010806 PrimeScriptTM RT Reagent kit Methods 0.000 description 1
- 241000723613 Tomato mosaic virus Species 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 238000009792 diffusion process Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 239000004744 fabric Substances 0.000 description 1
- 230000002458 infectious effect Effects 0.000 description 1
- 238000003801 milling Methods 0.000 description 1
- 239000004570 mortar (masonry) Substances 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000004383 yellowing Methods 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Environmental Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Forests & Forestry (AREA)
- Ecology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Botany (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an application of trialeurodes vaporarionm westwood to separation of tomato chlorosis viruses (ToCVs). The application comprises the following steps: (1) feeding the trialeurodes vaporarionm westwood with diseased tomato plants infected with tomato yellow leaf curl viruses and tomato chlorosis viruses to prepare contaminated trialeurodes vaporarionm westwood; (2) infecting healthy tomato plants with the infected trialeurodes vaporarionm westwood to obtain tomato plants infected with the tomato chlorosis viruses. By the application, the fact that the trialeurodes vaporarionm westwood has the characteristic of only transmitting the tomato chlorosis viruses instead of the tomato yellow leaf curl viruses is found for the first time, so that building of ToCV single strains is performed efficiently on a large scale by using the characteristic, the reliability and stability of virus separation can be ensured, and the building efficiency and success rate of the strains are increased greatly since virus transmission is performed through a medium.
Description
Technical field
The present invention relates to Trialeurodes vaporariorum Westwood and separating the application of Fructus Lycopersici esculenti chlorisis virus, belong to plant protection and biotechnology skill
Art field.
Background technology
Since 2012, a kind of new plant virus-Fructus Lycopersici esculenti chlorisis virus (Tomato chlorosis virus,
ToCV) China inland is successfully invaded and in rapid diffusion tendency, at present in China Shandong, Shanxi, the Inner Mongol, Zhejiang etc. multiplely
Qu Jun detects the existence of this virus, brings serious economic loss to vegetables industry such as Fructus Lycopersici esculenties.
The viral species of harm Fructus Lycopersici esculenti is a lot, such as tomato yellow leaf curl virus (Tomato yellow leaf curl
Virus, TYLCV), TOMV (Tomato masaic virus, ToMV), cucumber mosaic virus (Cucumber
Mosaic virus, CMV), broad bean wilt virus (Broad bean wilt virus, BBWV) etc..Wherein TYLCV is from 2002
Since year incoming China, quickly spread, rapidly become one of main virus of harm China vegetable, equal in multiple tomato planting districts
Detect that it exists.Bemisia tabaci (Bemisia tabaci) is as one of main vegetable-crop pest-insect of China, and diffusivity is strong, is
The primary vehicle of TYLCV and ToCV, it is possible to simultaneously complete two-strain is had effect spread, and researcher also demonstrate that
The two is in the phenomenon of field Combined Infection.Due to ToCV incoming China inland soon, and a kind of main tomato virus has just been risen to,
The features such as its generation, propagation are still known little about it, its specific aim is carried out series of basic and then seems particularly necessary.Right
For researcher, it is thus achieved that stablize the prerequisite that single malicious source is follow-up study.The infectious clone of ToCV at present
Have not yet to see report, and field gathers how to carry TYLCV and ToCV two-strain in sample simultaneously, the most how to invade from existing being combined
Isolating single ToCV in dye sample is the key solving the problems referred to above.
Summary of the invention
The present invention is directed to the deficiencies in the prior art, it is provided that Trialeurodes vaporariorum Westwood is separating the application of Fructus Lycopersici esculenti chlorisis virus.At present
The vacancy of single virus is separated, it is provided that a kind of side quick, separation ToCV reliably from TYLCV and ToCV Combined Infection plant
Method.
Technical scheme is as follows:
Trialeurodes vaporariorum Westwood is separating Fructus Lycopersici esculenti chlorisis from the diseased plant infecting tomato yellow leaf curl virus and Fructus Lycopersici esculenti chlorisis virus
The application of virus.
Above-mentioned application, comprises the steps:
(1) Trialeurodes vaporariorum Westwood is fed with by the Fructus Lycopersici esculenti diseased plant of tomato yellow leaf curl virus and Fructus Lycopersici esculenti chlorisis virus infection,
Prepare contamination Trialeurodes vaporariorum Westwood；
(2) the contamination Trialeurodes vaporariorum Westwood prepared by step (1) infects Fructus Lycopersici esculenti healthy plant, prepares and infects Fructus Lycopersici esculenti chlorisis virus
Tomato plant.
According to currently preferred, the Trialeurodes vaporariorum Westwood in described step (1) is the Trialeurodes vaporariorum Westwood just sprouted wings.
According to currently preferred, the feeding step in described step (1) is as follows:
Trialeurodes vaporariorum Westwood is put in micro-worm cage of diameter 1.5cm, be placed in Fructus Lycopersici esculenti diseased plant from second leaf of few top, treat
Trialeurodes vaporariorum Westwood all flies timing to tomato leaf, feeds more than 24h.
According to currently preferred, in described step (2) to infect step as follows:
The contamination Trialeurodes vaporariorum Westwood that step (1) prepares is placed in micro-worm cage, is then fixed on tomato seedling from few top the
On two leaves, treat that Trialeurodes vaporariorum Westwood all flies on blade, start timing, after 24h, Trialeurodes vaporariorum Westwood is taken out, to obtain final product.
According to currently preferred, also include to step (1) prepare contamination Trialeurodes vaporariorum Westwood carry out internal ToCV and
The step of TYLCV detection, internal ToCV detection specifically comprises the following steps that
Trialeurodes vaporariorum Westwood is placed in liquid nitrogen freezing 5s, then spends after the grinding rod of RNase is fully ground, add
1mL Trizol reagent, and the extraction of Trialeurodes vaporariorum Westwood total serum IgE is completed according to the description of Trizol extraction RNA method, take 1 μ g total
RNA, completes the synthesis of the first chain cDNA by cDNA Reverse Transcription box；
A pair detection primer is designed according to ToCV genome sequence:
Forward primer ToCV-F:GGGGAATGTGCGTTTAAAGA；SEQ ID NO.1
Downstream primer ToCV-R:GAACCAAATCAACGCGATCT；SEQ ID NO.2
ToCV detection reaction system is:
10×PCR Buffer(Mg2+Plus) 2.5 μ L, dNTP Mixture 2 μ L, each 1 μ L of upstream and downstream primer,
CDNA template 1 μ L, r Taq 0.25 μ L, ddH2O 17.25μL；
PCR response procedures is: 94 DEG C of denaturations 3min；94 DEG C of degeneration 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 35
Circulation；After extending 7min after 72 DEG C, sample is carried out agarose gel electrophoresis, according to purpose band with or without judging Trialeurodes vaporariorum Westwood
The most successfully obtain ToCV；
Internal TYLCV detection specifically comprises the following steps that
Trialeurodes vaporariorum Westwood is placed in liquid nitrogen freezing 5s, then spends after the grinding rod of RNase is fully ground, according to dynamic
Fabric texture DNA extraction kit description step completes the extraction of polypide genomic DNA；
TYLCV detection primer is as follows:
Forward primer TYLCV-F:CGCCCGTCTCGAAGGTTC；SEQ ID NO.3
Downstream primer TYLCV-R:GCCATATACAATAACAAGGC；SEQ ID NO.4
TYLCV detects reaction system:
10×PCR Buffer(Mg2+Plus) 2.5 μ L, dNTP Mixture 2 μ L, each 1 μ L of upstream and downstream primer,
CDNA template 1 μ L, r Taq 0.25 μ L, ddH2O 17.25μL；
PCR response procedures: 94 DEG C of denaturations 3min；94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C extend 50s, and 35 are followed
Ring；After extending 7min after 72 DEG C, sample is carried out agarose gel electrophoresis, according to purpose band with or without judging that Trialeurodes vaporariorum Westwood is
No successfully obtain TYLCV.
According to currently preferred, also include that the tomato plant infecting Fructus Lycopersici esculenti chlorisis virus preparing step (2) is carried out
The step of detection, specifically comprises the following steps that
The tomato plant infecting Fructus Lycopersici esculenti chlorisis virus is put into phjytotron, at 27 DEG C, RH 60%, L:D=14:10
Under conditions of cultivate one month, observe incidence.
Beneficial effect
1, present invention firstly discovers that Trialeurodes vaporariorum Westwood only to have and propagate Fructus Lycopersici esculenti chlorisis virus and do not propagate tomato yellowing Qu Ye
The feature of virus, thus utilize These characteristics efficiently batch to carry out the foundation of the single strain of ToCV, it is possible not only to ensure virus point
From reliability and stability, and utilize the medium carry out pass poison improve the most largely strain set up efficiency and success rate；
2, the method for the invention only need to be by processing Trialeurodes vaporariorum Westwood to complete whole process, it is not necessary to preparation infectivity gram
The tedious steps such as grand, viral milling and extracting, are easily mastered, simple and practical, with low cost；
3, the present invention is by optimizing infection condition, and the success rate that infect is greatly improved.
Accompanying drawing explanation
Fig. 1: after obtaining poison 24h, Trialeurodes vaporariorum Westwood takes the agarose gel electrophoresis figure of poison situation PCR detection；
In figure: swimming lane M is DNA Maker DL2000, band represent the most successively 2000bp, 1000bp, 750bp,
500bp、250bp、100bp；Swimming lane 1-4 respectively obtains poison Trialeurodes vaporariorum Westwood, ToCV positive control, negative control (healthy greenhouse
Trialeurodes vaporariorum), blank；Swimming lane 5-8 respectively obtains poison Trialeurodes vaporariorum Westwood, TYLCV positive control, negative control (healthy greenhouse
Trialeurodes vaporariorum), blank；
Fig. 2: pass poison tomato plant and take the agarose gel electrophoresis figure of poison situation PCR detection；
In figure: swimming lane M is DNA Maker DL2000, band represent the most successively 2000bp, 1000bp, 750bp,
500bp、250bp、100bp；Swimming lane 1-4 is respectively and passes poison tomato plant, ToCV positive control, negative control (plant by healthy Fructus Lycopersici esculenti
Strain), blank；Swimming lane 5-8 be respectively pass poison tomato plant, TYLCV positive control, negative control (healthy tomato plant),
Blank.
After Fig. 3: Bemisia tabaci passes poison, tomato plant takes the agarose gel electrophoresis figure of poison situation PCR detection；
In figure: swimming lane M is DNA Maker DL2000, band represent the most successively 2000bp, 1000bp, 750bp,
500bp、250bp、100bp；Swimming lane 1-4 is respectively and passes poison tomato plant, ToCV positive control, negative control (plant by healthy Fructus Lycopersici esculenti
Strain), blank；Swimming lane 5-8 be respectively pass poison tomato plant, TYLCV positive control, negative control (healthy tomato plant),
Blank.
Detailed description of the invention
Below in conjunction with embodiment, principle and the content of the present invention are described in detail, but institute of the present invention protection domain does not limits
In this.
Embodiment 1, Trialeurodes vaporariorum Westwood obtain poison with detection
Prepare the Fructus Lycopersici esculenti of 1 strain TYLCV and ToCV Combined Infection as poison source.
Take the Trialeurodes vaporariorum Westwood sprouted wings at the beginning of 40, put in micro-worm cage of diameter 1.5cm, micro-by with Trialeurodes vaporariorum Westwood
Worm cage is clipped in from second leaf of few top.After waiting that Trialeurodes vaporariorum Westwood all flies to tomato leaf, start timing, after 24h
By insect sucking-off, prepare contamination Trialeurodes vaporariorum Westwood.Take 20 prepare pass poison, remain 20, be respectively intended to extraction RNA (15) and
DNA (5), is used for detecting Trialeurodes vaporariorum Westwood and obtains poison situation.
ToCV detection in Trialeurodes vaporariorum Westwood body: 15 Trialeurodes vaporariorum Westwoods are put into the centrifuge tube of 1.5mL RNase Free
In, and used liquid nitrogen freezing 5s, spend after the grinding rod of RNase is fully ground, add 1mL Trizol, and according to match
The description of the Trizol extraction RNA method of Mo Feishier company completes the extraction of Trialeurodes vaporariorum Westwood total serum IgE.Take 1 μ g total serum IgE, logical
PrimeScript RT reagent Kit (the Perfect Real Time) test kit of Guo Bao biological engineering company limited completes
The synthesis of the first chain cDNA.A pair detection primer is designed according to ToCV genome sequence:
Forward primer ToCV-F:GGGGAATGTGCGTTTAAAGA；SEQ ID NO.1
Downstream primer ToCV-R:GAACCAAATCAACGCGATCT；SEQ ID NO.2
ToCV detection reaction system is:
10×PCR Buffer(Mg2+Plus) 2.5 μ L, dNTP Mixture 2 μ L, each 1 μ L of upstream and downstream primer,
CDNA template 1 μ L, r Taq 0.25 μ L, ddH2O 17.25μL；
PCR response procedures is:
94 DEG C of denaturations 3min；94 DEG C of degeneration 30s, 60 DEG C of annealing 30s, 72 DEG C extend 30s, 35 circulations；72 DEG C of extensions
7min；
The most afterwards sample being carried out agarose gel electrophoresis, result shows that Successful amplification goes out about from Trialeurodes vaporariorum Westwood sample
The fragment band (as shown in Figure 1) of the ToCV mesh of about 250bp, and PCR primer is checked order, by sequencing result on NCBI
Carrying out BLASTn comparison, result confirms that this sequence is ToCV secondary capsid protein gene fragment (as shown in SEQ ID NO.5), card
Bright the method can make Trialeurodes vaporariorum Westwood successfully obtain ToCV.
TYLCV detection in Trialeurodes vaporariorum Westwood body: 5 Trialeurodes vaporariorum Westwoods are put into the centrifuge tube of 1.5mL RNase Free
In, and used liquid nitrogen freezing 5s, spent after the grinding rod of RNase is fully ground, according to animal tissue's DNA extraction reagent
Box description step completes the extraction of polypide genomic DNA.
TYLCV detection primer sequence is as follows:
Forward primer TYLCV-F:CGCCCGTCTCGAAGGTTC；SEQ ID NO.3
Downstream primer TYLCV-R:GCCATATACAATAACAAGGC；SEQ ID NO.4
TYLCV detection reaction system detects with ToCV；PCR response procedures is 94 DEG C of denaturations 3min；94 DEG C of degeneration 30s,
58 DEG C of annealing 30s, 72 DEG C extend 50s, 35 circulations；72 DEG C extend 7min；
Then sample being carried out agarose gel electrophoresis, result shows that Successful amplification goes out from Trialeurodes vaporariorum Westwood sample
The fragment band of TYLCV mesh, about about 600bp (as shown in Figure 1), it was demonstrated that take poison 24h after, in Trialeurodes vaporariorum Westwood body also with
TYLCV。
The single foundation infecting tomato plant of embodiment 2, ToCV
Preparing the tomato seedling of 3-4 leaf period, the Trialeurodes vaporariorum Westwood having obtained poison 24h by 20 is put in micro-worm cage, and fixes
To tomato seedling from second leaf of few top, treat that Trialeurodes vaporariorum Westwood all flies on blade, start timing, after 24h, insect is taken
Go out.Tomato seedling after passing poison is put in phjytotron (27 DEG C, RH 60%, L:D=14:10) and is cultivated, and observes after one month
Incidence, finds that tomato plant lower blade occurs in that chlorisis phenomenon between slight vein, doubtful ToCV disease symptom, but
Whole strain does not find the TYLCV disease symptom such as yellow leaf and curling.Tentatively conclude that tomato plant may only infect ToCV, need
In carrying out Molecular Detection.
The tweezers clip disinfected in alcohol is from bottom number first leaf.Weigh in the mortar that 0.1g puts into RNase, add
It is fully ground after liquid nitrogen, the plant tissue powder ground is transferred to the 1.5mL RNase Free containing 1mL Trizol and is centrifuged
Guan Zhong, completes the extraction of tomato leaf total serum IgE according to the description of Trizol extraction RNA method.Take 1 μ g total serum IgE, anti-by cDNA
Transcript reagent box completes the synthesis of the first chain cDNA.PCR detection primer, system and the method same embodiment (1) of ToCV in Fructus Lycopersici esculenti
ToCV detection method in medium temperature chamber's trialeurodes vaporariorum.Can be seen that from agarose gel electrophoresis result, detection sample occurs at about 250bp
Purpose band (as shown in the swimming lane 1-4 in Fig. 2), illustrates that passing poison plant successfully carries ToCV.
The tweezers clip disinfected in alcohol is from second leaf of bottom number.Weigh that 0.5g puts into that high temperature sterilize processed grinds
In alms bowl, after addition liquid nitrogen is fully ground, complete tomato leaf gene according to the step of plant tissue genome DNA extracting reagent kit
The extraction of group DNA.TYLCV in PCR detection primer, system and method same embodiment (1) the medium temperature chamber trialeurodes vaporariorum of TYLCV in Fructus Lycopersici esculenti
Detection method.Agarose gel electrophoresis is not it was found that detection sample amplifies the fragment band of TYLCV mesh (in Fig. 2
Shown in swimming lane 5-8), illustrate that this plant does not carry TYLCV, it was demonstrated that the method is successfully separated out the single strain of ToCV, practical.
Use the method that the tomato seedling of 30 strain 3-4 leaf periods is passed poison, after 1 month, observe the morbidity feelings of every strain tomato seedling
Condition, and carry out Molecular Detection, result shows have 28 strain tomato seedlings the most successfully to infect ToCV, and all tomato seedlings are all uninfected by TYLCV,
It is 93.33% that this method infects the success rate of single ToCV.
Comparative example 1
Equally, select Bemisia tabaci as insecticide to be tried, carry out obtaining poison according to the method in embodiment 1, and according to embodiment 2
In method carry out passing poison, carry out passing the observation of poison plant after 1 month, find that tomato seedling lower blade occurs in that slight vein
Between chlorisis phenomenon, top vane has slight jaundice crimp.
According to the method in embodiment 2, plant being taken poison situation and carry out Molecular Detection, ToCV detects agarose gel electrophoresis
Result shows, detection sample purpose band (as shown in the swimming lane 1-4 in Fig. 3) occurs at about 250bp, illustrates that passing poison plant takes
Band ToCV；TYLCV detection agarose gel electrophoresis result shows, detection sample purpose band occurs (such as Fig. 3 at about 600bp
In swimming lane 5-8 shown in), illustrate pass poison plant carry TYLCV equally.
Therefore deducing that, Trialeurodes vaporariorum Westwood can be successfully separated out single ToCV virus, and Bemisia tabaci does not possess this spy
Property.
Comparative example 2
The single method for building up infecting tomato plant of ToCV as described in Example 2, difference is, after starting timing
The biography poison time be 12h.Use the method to carry out the tomato seedling of 30 strain 3-4 leaf periods passing poison, after 1 month, observe morbidity disease
Shape.
Use the method in embodiment 2 that tomato plant virus infection situation is detected, it was found that only 12 strain kind
Eggplant plant successfully carries ToCV, and all tomato plants the most do not carry TYLCV, after showing that passing the poison time foreshortens to 12h, separates single
The success rate of ToCV is only 40%.And the separation biography poison success rate in embodiment 2 is 93.33%, the biography poison time is impact biography poison
The key factor of success rate, within the specific limits, relatively extends insecticide and passes the poison time, it is possible to increase it passes the success rate of poison.
Claims (9)
1. Trialeurodes vaporariorum Westwood is separating Fructus Lycopersici esculenti etiolation from the diseased plant infecting tomato yellow leaf curl virus and Fructus Lycopersici esculenti chlorisis virus
The application of poison.
Apply the most as claimed in claim 1, it is characterised in that comprise the steps:
(1) Trialeurodes vaporariorum Westwood is fed with by the Fructus Lycopersici esculenti diseased plant of tomato yellow leaf curl virus and Fructus Lycopersici esculenti chlorisis virus infection, prepare
Contamination Trialeurodes vaporariorum Westwood；
(2) with step (1) prepare contamination Trialeurodes vaporariorum Westwood infect Fructus Lycopersici esculenti healthy plant, prepare infect Fructus Lycopersici esculenti chlorisis virus kind
Eggplant plant.
Apply the most as claimed in claim 2, it is characterised in that the Trialeurodes vaporariorum Westwood in described step (1) is the temperature just sprouted wings
Room trialeurodes vaporariorum.
Apply the most as claimed in claim 2, it is characterised in that the feeding step in described step (1) is as follows:
Trialeurodes vaporariorum Westwood is put in micro-worm cage of diameter 1.5cm, be placed in Fructus Lycopersici esculenti diseased plant from second leaf of few top, treat greenhouse
Trialeurodes vaporariorum all flies timing to tomato leaf, feeds more than 24h.
Apply the most as claimed in claim 2, it is characterised in that in described step (2) to infect step as follows:
The contamination Trialeurodes vaporariorum Westwood that step (1) prepares is placed in micro-worm cage, is then fixed on tomato seedling from few top second
Ye Shang, treats that Trialeurodes vaporariorum Westwood all flies on blade, starts timing, after 24h, is taken out by Trialeurodes vaporariorum Westwood, to obtain final product.
Apply the most as claimed in claim 2, it is characterised in that also include that the contamination Trialeurodes vaporariorum Westwood preparing step (1) enters
The step of row internal ToCV and TYLCV detection.
Apply the most as claimed in claim 6, it is characterised in that described internal ToCV detection specifically comprises the following steps that
Trialeurodes vaporariorum Westwood is placed in liquid nitrogen freezing 5s, then spends after the grinding rod of RNase is fully ground, add
1mLTrizol reagent, and the extraction of Trialeurodes vaporariorum Westwood total serum IgE is completed according to the description of Trizol extraction RNA method, take 1 μ g total
RNA, completes the synthesis of the first chain cDNA by cDNA Reverse Transcription box；
A pair detection primer is designed according to ToCV genome sequence:
Forward primer ToCV-F:GGGGAATGTGCGTTTAAAGA；SEQ ID NO.1
Downstream primer ToCV-R:GAACCAAATCAACGCGATCT；SEQ ID NO.2
ToCV detection reaction system is:
Each 1 μ L, cDNA template 1 μ L, the r of 10 × PCR Buffer 2.5 μ L, dNTP Mixture 2 μ L, upstream and downstream primer
Taq 0.25μL、ddH2O 17.25μL；
PCR response procedures is: 94 DEG C of denaturations 3min；94 DEG C of degeneration 30s, 60 DEG C of annealing 30s, 72 DEG C extend 30s, and 35 are followed
Ring；After extending 7min after 72 DEG C, sample is carried out agarose gel electrophoresis, according to purpose band with or without judging that Trialeurodes vaporariorum Westwood is
No successfully obtain ToCV.
Apply the most as claimed in claim 6, it is characterised in that described internal TYLCV detection specifically comprises the following steps that
Trialeurodes vaporariorum Westwood is placed in liquid nitrogen freezing 5s, then spends after the grinding rod of RNase is fully ground, according to animal groups
Knit DNA extraction kit description step and complete the extraction of polypide genomic DNA；
TYLCV detection primer is as follows:
Forward primer TYLCV-F:CGCCCGTCTCGAAGGTTC；SEQ ID NO.3
Downstream primer TYLCV-R:GCCATATACAATAACAAGGC；SEQ ID NO.4
TYLCV detects reaction system:
Each 1 μ L, cDNA template 1 μ L, the r of 10 × PCR Buffer 2.5 μ L, dNTP Mixture 2 μ L, upstream and downstream primer
Taq 0.25μL、ddH2O 17.25μL；
PCR response procedures: 94 DEG C of denaturations 3min；94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C extend 50s, 35 circulations；
After extending 7min after 72 DEG C, sample is carried out agarose gel electrophoresis, according to purpose band with or without whether judging Trialeurodes vaporariorum Westwood
Success obtains TYLCV.
Apply the most as claimed in claim 2, it is characterised in that also include the infection Fructus Lycopersici esculenti chlorisis virus that step (2) is prepared
Tomato plant carry out the step that detects, specifically comprise the following steps that
The tomato plant infecting Fructus Lycopersici esculenti chlorisis virus is put into phjytotron, at 27 DEG C, the bar of RH 60%, L:D=14:10
Cultivate one month under part, observe incidence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610676236.6A CN106305625B (en) | 2016-08-15 | 2016-08-15 | Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610676236.6A CN106305625B (en) | 2016-08-15 | 2016-08-15 | Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106305625A true CN106305625A (en) | 2017-01-11 |
| CN106305625B CN106305625B (en) | 2019-05-28 |
Family
ID=57740631
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610676236.6A Active CN106305625B (en) | 2016-08-15 | 2016-08-15 | Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106305625B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628947A (en) * | 2019-09-27 | 2019-12-31 | 江苏省农业科学院 | Method for rapidly identifying tomato yellow leaf curl virus and tomato chlorosis virus |
| CN118006623A (en) * | 2024-04-08 | 2024-05-10 | 青岛农业大学 | Gene sequence of neuropeptide CCHamide and preparation method and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102534007A (en) * | 2012-01-14 | 2012-07-04 | 中国农业科学院蔬菜花卉研究所 | Specific sequence characterized amplified region (SCAR) marker for Trialeurodes vaporariorum, specific primers, and quick molecular identification method |
| CN102948336A (en) * | 2012-11-12 | 2013-03-06 | 北京市农林科学院 | Method for inoculating tomatoes with tomato yellow leaf curl viruses |
| CN103667530A (en) * | 2013-12-03 | 2014-03-26 | 山东农业大学 | Reverse transcription loop-mediated isothermal detection method for tomato chlorosis virus |
-
2016
- 2016-08-15 CN CN201610676236.6A patent/CN106305625B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102534007A (en) * | 2012-01-14 | 2012-07-04 | 中国农业科学院蔬菜花卉研究所 | Specific sequence characterized amplified region (SCAR) marker for Trialeurodes vaporariorum, specific primers, and quick molecular identification method |
| CN102534007B (en) * | 2012-01-14 | 2013-10-09 | 中国农业科学院蔬菜花卉研究所 | Specific sequence characterized amplified region (SCAR) marker for Trialeurodes vaporariorum, specific primers, and quick molecular identification method |
| CN102948336A (en) * | 2012-11-12 | 2013-03-06 | 北京市农林科学院 | Method for inoculating tomatoes with tomato yellow leaf curl viruses |
| CN103667530A (en) * | 2013-12-03 | 2014-03-26 | 山东农业大学 | Reverse transcription loop-mediated isothermal detection method for tomato chlorosis virus |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628947A (en) * | 2019-09-27 | 2019-12-31 | 江苏省农业科学院 | Method for rapidly identifying tomato yellow leaf curl virus and tomato chlorosis virus |
| CN118006623A (en) * | 2024-04-08 | 2024-05-10 | 青岛农业大学 | Gene sequence of neuropeptide CCHamide and preparation method and application |
| CN118006623B (en) * | 2024-04-08 | 2024-06-11 | 青岛农业大学 | Gene sequence of neuropeptide CCHamide and preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106305625B (en) | 2019-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Teresani et al. | Association of ‘Candidatus Liberibacter solanacearum’with a vegetative disorder of celery in Spain and development of a real-time PCR method for its detection | |
| CN106636012B (en) | One boar lid his virus stain, vaccine combination and its preparation method and application | |
| CN102816868B (en) | Double-PCR (polymerase chain reaction) method for detecting iridovirus of micropterus salmoides | |
| CN103540681B (en) | Method for detecting five plant viruses synchronously | |
| Islam et al. | Molecular characterization of mungbean yellow mosaic disease and coat protein gene in mungbean varieties of Bangladesh | |
| Abolnik et al. | Characterization of pigeon paramyxoviruses (Newcastle disease virus) isolated in South Africa from 2001 to 2006 | |
| CN102392080B (en) | Method for identifying tomato yellow leaf curl virus resistance | |
| CN104928260B (en) | A kind of infectious bovine rhinotrachetis virus IBRV-JN03 separation strains and its application | |
| CN111363856A (en) | Method for simultaneously detecting four tomato viruses by multiple RT-PCR | |
| CN106305625A (en) | Application of trialeurodes vaporarionm westwood to separation of tomato chlorosis viruses (ToCVs) | |
| CN106929485A (en) | Pseudorabies virus genetic engineering gB recombinates attenuated vaccine strain and application | |
| CN104212912B (en) | Differentiate test kit and the application thereof of duck tembusu virus virulent strain and attenuated vaccine strain | |
| Azhar et al. | Gossypium gossypioides: a source of resistance against cotton leaf curl disease among D genome diploid cotton species | |
| CN103937908A (en) | Real-time fluorescence quantitative PCR detection method of West African strain of sweet potato chlorotic stunt virus and application | |
| CN102586478A (en) | One-step multiplex reverse transcription-polymerase chain reaction (RT-PCR) method for detecting turnip mosaic virus and special primers for method | |
| Barragan et al. | Molecular detection of Potato yellow vein virus in the natural whitefly vector Trialeurodes vaporariorum, Westwood. | |
| Kang et al. | Molecular characterization and detection of a genetically distinct tomato chlorosis virus strain in Taiwan | |
| Meena et al. | Simultaneous detection of potato viruses A and M using CP gene specific primers in an optimized duplex RT-PCR | |
| Saha et al. | Distribution and molecular characterization of begomoviruses infecting tomato in sub-Himalayan Tarai region of West Bengal and Brahmaputra valley of Assam in northeast India | |
| Pandey et al. | Detection and identification of Ageratum enation virus infecting Ageratum conyzoides in India | |
| CN106011087A (en) | Construction method of S1 gene and TM-1 gene recombinant adenovirus as well as recombinant adenovirus and application | |
| Budzanivska et al. | Epidemiology of sharka disease in Ukraine | |
| CN110551696A (en) | Natural low virulent strain of avian infectious bronchitis virus and application thereof | |
| CN102628088B (en) | Polymerase chain reaction (PCR) detection method universal for viruses | |
| Motghare et al. | Use of NCM based DNA extraction method for simultaneous detection of citrus mosaic badnavirus and Candidatus Liberibacter asiaticus by duplex PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |