CN106305625B - Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus - Google Patents
Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus Download PDFInfo
- Publication number
- CN106305625B CN106305625B CN201610676236.6A CN201610676236A CN106305625B CN 106305625 B CN106305625 B CN 106305625B CN 201610676236 A CN201610676236 A CN 201610676236A CN 106305625 B CN106305625 B CN 106305625B
- Authority
- CN
- China
- Prior art keywords
- tomato
- trialeurodes vaporariorum
- vaporariorum westwood
- virus
- tocv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Abstract
The present invention relates to Trialeurodes vaporariorum Westwoods in the application of separation tomato chlorisis virus, includes the following steps: that (1) feeds Trialeurodes vaporariorum Westwood with by the tomato diseased plant of tomato yellow leaf curl virus and tomato chlorisis virus infection, contamination Trialeurodes vaporariorum Westwood is made；(2) tomato healthy plant is infected with contamination Trialeurodes vaporariorum Westwood, the tomato plant of infection tomato chlorisis virus is made.Present invention firstly discovers that Trialeurodes vaporariorum Westwood has the characteristics that only to propagate tomato chlorisis virus without propagating tomato yellow leaf curl virus, to efficiently carry out the foundation of the single strain of ToCV in batches using These characteristics, it can not only guarantee the reliability and stability of virus purification, but also utilize the medium and pass efficiency and success rate that poison also largely improves strain foundation.
Description
Technical field
The present invention relates to method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus, belong to plant protection and biotechnology
Technical field.
Background technique
Since 2012, a kind of new plant virus-tomato chlorisis virus (Tomato chlorosis virus,
ToCV) successfully invade Chinese inland and be in rapid diffusion tendency, at present China Shandong, Shanxi, the Inner Mongol, Zhejiang etc. multiplely
Qu Jun detects the presence of the virus, brings serious economic loss to vegetables industries such as tomatoes.
There are many viral species for endangering tomato, such as tomato yellow leaf curl virus (Tomato yellow leaf curl
Virus, TYLCV), Tomato Mosaic Virus (Tomato masaic virus, ToMV), cucumber mosaic virus (Cucumber
Mosaic virus, CMV), broad bean wilt virus (Broad bean wilt virus, BBWV) etc..Wherein TYLCV is from 2002
Since year is passed to China, quickly spreads, rapidly become and endanger one of main virus of China vegetables, it is equal in multiple tomato species growing areas
Detect its presence.And currently, researcher both also demonstrate it is more universal the Combined Infection of field the phenomenon that.Due to ToCV
The features such as being passed to China inland soon, and just having risen to a kind of main tomato virus, occurred to it, propagate still is known little about it,
Carrying out series of basic to its specific aim then seems particularly necessary.For researcher, acquisition is stablized single
Malicious source is the prerequisite of follow-up study.The infectious clone of ToCV has not yet to see report at present, and mostly same in field acquisition sample
When carry two kinds of viruses of TYLCV and ToCV, therefore how to isolate single ToCV from existing Combined Infection sample is in solution
State the key of problem.
Summary of the invention
In view of the deficiencies of the prior art, the present invention provides method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus.Mesh
The preceding vacancy that single virus is separated from TYLCV and ToCV Combined Infection plant provides one kind and quickly, reliably separates ToCV's
Method.
Technical scheme is as follows:
Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus, from infection tomato yellow leaf curl virus and tomato chlorisis
Separation tomato chlorisis virus in the diseased plant of virus.
Above-mentioned application, includes the following steps:
(1) Trialeurodes vaporariorum Westwood is fed with by the tomato diseased plant of tomato yellow leaf curl virus and tomato chlorisis virus infection,
Contamination Trialeurodes vaporariorum Westwood is made；
(2) tomato healthy plant is infected with step (1) contamination Trialeurodes vaporariorum Westwood obtained, infection tomato chlorisis virus is made
Tomato plant.
Preferred according to the present invention, the Trialeurodes vaporariorum Westwood in the step (1) is the Trialeurodes vaporariorum Westwood just sprouted wings.
Preferred according to the present invention, the feeding step in the step (1) is as follows:
Trialeurodes vaporariorum Westwood is put into micro- worm cage of diameter 1.5cm, is placed in tomato diseased plant from second leaf of few top, to
Trialeurodes vaporariorum Westwood all flies to timing on tomato leaf, feeds more than for 24 hours.
Preferred according to the present invention, steps are as follows for infecting in the step (2):
Step (1) contamination Trialeurodes vaporariorum Westwood obtained is placed in micro- worm cage, is then fixed on tomato seedling from few top the
On two leaves, all flown on blade to Trialeurodes vaporariorum Westwood, start timing, for 24 hours after, by Trialeurodes vaporariorum Westwood take out to get.
It is preferred according to the present invention, further include step (1) contamination Trialeurodes vaporariorum Westwood obtained is carried out internal ToCV and
The step of TYLCV is detected, specific step is as follows for internal ToCV detection:
Trialeurodes vaporariorum Westwood is placed in liquid nitrogen frozen 5s, then spend RNase grinding rod be fully ground after, add
1mL Trizol reagent, and the extraction of the specification completion Trialeurodes vaporariorum Westwood total serum IgE according to Trizol extraction RNA method, take 1 μ g total
RNA completes the synthesis of the first chain cDNA by cDNA reverse transcription reagent box；
A pair of of detection primer is designed according to ToCV genome sequence:
Upstream primer ToCV-F:GGGGAATGTGCGTTTAAAGA；SEQ ID NO.1
Downstream primer ToCV-R:GAACCAAATCAACGCGATCT；SEQ ID NO.2
ToCV detects reaction system are as follows:
10×PCR Buffer(Mg2+Plus) 2.5 μ L, 2 μ L of dNTP Mixture, each 1 μ L of upstream and downstream primer,
1 μ L of cDNA template, 0.25 μ L of r Taq, ddH2O 17.25μL；
PCR response procedures are as follows: 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 35
Circulation；After extending 7min after 72 DEG C, sample is subjected to agarose gel electrophoresis, whether there is or not judge Trialeurodes vaporariorum Westwood according to purpose band
Whether ToCV is successfully obtained；
Specific step is as follows for internal TYLCV detection:
Trialeurodes vaporariorum Westwood is placed in liquid nitrogen frozen 5s, then spend RNase grinding rod be fully ground after, according to dynamic
The extraction of object tissue DNA extracts kit specification step completion polypide genomic DNA；
TYLCV detection primer is as follows:
Upstream primer TYLCV-F:CGCCCGTCTCGAAGGTTC；SEQ ID NO.3
Downstream primer TYLCV-R:GCCATATACAATAACAAGGC；SEQ ID NO.4
TYLCV detects reaction system:
10×PCR Buffer(Mg2+Plus) 2.5 μ L, 2 μ L of dNTP Mixture, each 1 μ L of upstream and downstream primer,
1 μ L of cDNA template, 0.25 μ L of r Taq, ddH2O 17.25μL；
PCR response procedures: 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 50s, 35 are followed
Ring；After extending 7min after 72 DEG C, sample is subjected to agarose gel electrophoresis, whether there is or not judge that Trialeurodes vaporariorum Westwood is according to purpose band
It is no successfully to obtain TYLCV.
It is preferred according to the present invention, it further include being carried out to the tomato plant of step (2) infection tomato chlorisis virus obtained
The step of detection, the specific steps are as follows:
The tomato plant for infecting tomato chlorisis virus is put into phjytotron, at 27 DEG C, RH 60%, L:D=14:10
Under conditions of cultivate one month, observe incidence.
Beneficial effect
1, present invention firstly discovers that Trialeurodes vaporariorum Westwood, which has, only propagates tomato chlorisis virus without propagating tomato yellowing Qu Ye
The feature of virus can not only guarantee virus point to efficiently carry out the foundation of the single strain of ToCV in batches using These characteristics
From reliability and stability, and utilize the medium carry out pass poison also largely improve strain foundation efficiency and success rate；
2, the method for the invention only need to be by processing Trialeurodes vaporariorum Westwood to complete whole process, without preparing infectivity gram
The tedious steps such as grand, viral milling and extracting, are easily mastered, simple and practical, low in cost；
3, the success rate infected greatly improved by optimization infection condition in the present invention.
Detailed description of the invention
Fig. 1: after obtaining poison for 24 hours, Trialeurodes vaporariorum Westwood takes the agarose gel electrophoresis figure of malicious situation PCR detection；
In figure: swimming lane M be DNA Maker DL2000, band successively represent from top to bottom 2000bp, 1000bp, 750bp,
500bp,250bp,100bp；Swimming lane 1-4 is respectively to obtain malicious Trialeurodes vaporariorum Westwood, ToCV positive control, negative control (healthy greenhouse
Trialeurodes vaporariorum), blank control；Swimming lane 5-8 is respectively to obtain malicious Trialeurodes vaporariorum Westwood, TYLCV positive control, negative control (healthy greenhouse
Trialeurodes vaporariorum), blank control；
Fig. 2: the agarose gel electrophoresis figure that malicious tomato plant takes malicious situation PCR detection is passed；
In figure: swimming lane M be DNA Maker DL2000, band successively represent from top to bottom 2000bp, 1000bp, 750bp,
500bp,250bp,100bp；Swimming lane 1-4 is respectively to pass malicious tomato plant, ToCV positive control, negative control (healthy tomato plant
Strain), blank control；Swimming lane 5-8 be respectively pass malicious tomato plant, TYLCV positive control, negative control (healthy tomato plant),
Blank control.
Fig. 3: after Bemisia tabaci passes poison, tomato plant takes the agarose gel electrophoresis figure of malicious situation PCR detection；
In figure: swimming lane M be DNA Maker DL2000, band successively represent from top to bottom 2000bp, 1000bp, 750bp,
500bp,250bp,100bp；Swimming lane 1-4 is respectively to pass malicious tomato plant, ToCV positive control, negative control (healthy tomato plant
Strain), blank control；Swimming lane 5-8 be respectively pass malicious tomato plant, TYLCV positive control, negative control (healthy tomato plant),
Blank control.
Specific embodiment
The principle of the present invention and content are described in detail below with reference to embodiment, but institute's protection scope of the present invention is unlimited
In this.
Embodiment 1, Trialeurodes vaporariorum Westwood obtain poison with detection
Prepare the tomato of 1 plant of TYLCV and ToCV Combined Infection as malicious source.
The Trialeurodes vaporariorum Westwood sprouted wings at the beginning of taking 40 is put into micro- worm cage of diameter 1.5cm, will be micro- with Trialeurodes vaporariorum Westwood
Worm cage is clipped in from second leaf of few top.Wait after Trialeurodes vaporariorum Westwood all flies to tomato leaf, start timing, for 24 hours after
Insect is sucked out, contamination Trialeurodes vaporariorum Westwood is made.Take 20 preparations to pass poison, it is 20 remaining, be respectively intended to extract RNA (15) and
DNA (5) obtains malicious situation for detecting Trialeurodes vaporariorum Westwood.
ToCV is detected in Trialeurodes vaporariorum Westwood body: 15 Trialeurodes vaporariorum Westwoods are put into the centrifuge tube of 1.5mL RNase Free
In, and it is used into liquid nitrogen frozen 5s, spend RNase grinding rod be fully ground after, 1mL Trizol is added, and according to match
The specification that the Trizol of Mo Feishier company extracts RNA method completes the extraction of Trialeurodes vaporariorum Westwood total serum IgE.1 μ g total serum IgE is taken, is led to
PrimeScript RT reagent Kit (the Perfect Real Time) kit of Guo Bao bioengineering Co., Ltd is completed
The synthesis of first chain cDNA.A pair of of detection primer is designed according to ToCV genome sequence:
Upstream primer ToCV-F:GGGGAATGTGCGTTTAAAGA；SEQ ID NO.1
Downstream primer ToCV-R:GAACCAAATCAACGCGATCT；SEQ ID NO.2
ToCV detects reaction system are as follows:
10×PCR Buffer(Mg2+Plus) 2.5 μ L, 2 μ L of dNTP Mixture, each 1 μ L of upstream and downstream primer,
1 μ L of cDNA template, 0.25 μ L of r Taq, ddH2O 17.25μL；
PCR response procedures are as follows:
94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 35 recycle；72 DEG C of extensions
7min；
Then sample is subjected to agarose gel electrophoresis afterwards, the results showed that Successful amplification goes out about from Trialeurodes vaporariorum Westwood sample
The ToCV target fragment band (as shown in Figure 1) of 250bp or so, and PCR product is sequenced, by sequencing result on NCBI
BLASTn comparison is carried out, as a result confirms that the sequence is the secondary capsid protein gene segment of ToCV (as shown in SEQ ID NO.5), card
Bright the method can make Trialeurodes vaporariorum Westwood successfully obtain ToCV.
TYLCV is detected in Trialeurodes vaporariorum Westwood body: 5 Trialeurodes vaporariorum Westwoods are put into the centrifuge tube of 1.5mL RNase Free
In, and by its use liquid nitrogen frozen 5s, spend RNase grinding rod be fully ground after, according to animal tissue DNA extract reagent
The extraction of box specification step completion polypide genomic DNA.
TYLCV detection primer sequence is as follows:
Upstream primer TYLCV-F:CGCCCGTCTCGAAGGTTC；SEQ ID NO.3
Downstream primer TYLCV-R:GCCATATACAATAACAAGGC；SEQ ID NO.4
TYLCV detects reaction system and detects with ToCV；PCR response procedures are 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s,
58 DEG C of annealing 30s, 72 DEG C of extension 50s, 35 recycle；72 DEG C of extension 7min；
Then sample is subjected to agarose gel electrophoresis, the results showed that Successful amplification goes out from Trialeurodes vaporariorum Westwood sample
TYLCV target fragment band, about 600bp or so (as shown in Figure 1), it was demonstrated that take poison for 24 hours after, in Trialeurodes vaporariorum Westwood body with
TYLCV。
The single foundation for infecting tomato plant of embodiment 2, ToCV
The tomato seedling for preparing 3-4 leaf period has obtained the Trialeurodes vaporariorum Westwood of poison for 24 hours for 20 and has been put into micro- worm cage, and fixed
To tomato seedling from second leaf of few top, all flown on blade to Trialeurodes vaporariorum Westwood, start timing, for 24 hours after, insect is taken
Out.Tomato seedling after biography poison is put into culture in phjytotron (27 DEG C, RH 60%, L:D=14:10), is observed after one month
There is chlorisis phenomenon between slight vein in incidence, discovery tomato plant lower blade, doubtful ToCV disease symptom, still
Whole strain does not find the TYLCV disease symptom such as yellow leaf and curling.Tentatively conclude that tomato plant may only infect ToCV, needs
In progress Molecular Detection.
The tweezers clip disinfected in alcohol is from first leaf of lower part number.It weighs 0.1g to be put into the mortar of RNase, be added
It is fully ground after liquid nitrogen, the plant tissue powder ground is transferred to the centrifugation of the 1.5mL RNase Free containing 1mL Trizol
Guan Zhong completes the extraction of tomato leaf total serum IgE according to the specification that Trizol extracts RNA method.1 μ g total serum IgE is taken, it is anti-by cDNA
Transcript reagent box completes the synthesis of the first chain cDNA.The PCR detection primer, system and the same embodiment of method (1) of ToCV in tomato
ToCV detection method in medium temperature chamber's trialeurodes vaporariorum.It can be seen that from agarose gel electrophoresis results, test sample occurs in 250bp or so
Purpose band (as shown in the swimming lane 1-4 in Fig. 2) illustrates that passing malicious plant successfully carries ToCV.
The tweezers clip disinfected in alcohol is from second leaf of lower part number.It weighs 0.5g and is put into that high-temperature sterilization is processed to be ground
In alms bowl, after addition liquid nitrogen is fully ground, according to completion tomato leaf gene the step of plant tissue genome DNA extracting reagent kit
The extraction of group DNA.TYLCV in the PCR detection primer, system of TYLCV and the same embodiment of method (1) medium temperature chamber trialeurodes vaporariorum in tomato
Detection method.Agarose gel electrophoresis results discovery, test sample do not amplify TYLCV target fragment band (in such as Fig. 2
Shown in swimming lane 5-8), illustrate that the plant does not carry TYLCV, it was demonstrated that the method is successfully separated out the single strain of ToCV, practical.
Poison is passed with tomato seedling of this method to 30 plants of 3-4 leaf periods, the morbidity feelings of every plant of tomato seedling are observed after 1 month
Condition, and carry out Molecular Detection, the results showed that there are 28 plants of tomato seedlings successfully to infect ToCV, all tomato seedlings are uninfected by TYLCV,
The success rate that this method infects single ToCV is 93.33%.
Comparative example 1
Equally, it selects Bemisia tabaci as insect to be tried, carries out obtaining poison according to the method in embodiment 1, and according to embodiment 2
In method carry out passing poison, pass the observation of malicious plant after 1 month, slight vein occurs in discovery tomato seedling lower blade
Between chlorisis phenomenon, top vane has slight jaundice crimp.
Malicious situation is taken to plant according to the method in embodiment 2 and carries out Molecular Detection, ToCV detects agarose gel electrophoresis
The results show that test sample purpose band (as shown in the swimming lane 1-4 in Fig. 3) occurs in 250bp or so, illustrate that passing malicious plant takes
Band ToCV；TYLCV detection agarose gel electrophoresis results show that test sample purpose band (such as Fig. 3 occurs in 600bp or so
In swimming lane 5-8 shown in), illustrate that passing malicious plant equally carries TYLCV.
It therefore deduces that, Trialeurodes vaporariorum Westwood can be successfully separated out single ToCV virus, and Bemisia tabaci does not have this spy
Property.
Comparative example 2
The single method for building up for infecting tomato plant of ToCV as described in Example 2, the difference is that, after starting timing
The biography malicious time be 12h.It carries out passing poison with tomato seedling of the method to 30 plants of 3-4 leaf periods, observation morbidity disease after 1 month
Shape.
Tomato plant virus infection situation is detected using the method in embodiment 2, as a result, it has been found that, only 12 plants kinds
Eggplant plant successfully carries ToCV, and all tomato plants do not carry TYLCV, after showing that passing the malicious time foreshortens to 12h, separates single
The success rate of ToCV is only 40%.And it is 93.33% that the separation in embodiment 2, which passes malicious success rate, passing the malicious time is to influence to pass poison
It is an important factor for success rate, in a certain range, opposite to extend the insect biography malicious time, it can be improved its success rate for passing poison.
Claims (9)
1. method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus, which is characterized in that from infection tomato yellow leaf curl virus
It is viral with tomato chlorisis is separated in the diseased plant of tomato chlorisis virus.
2. the method as described in claim 1, which comprises the steps of:
(1) Trialeurodes vaporariorum Westwood is fed with by the tomato diseased plant of tomato yellow leaf curl virus and tomato chlorisis virus infection, is made
Contamination Trialeurodes vaporariorum Westwood；
(2) tomato healthy plant is infected with step (1) contamination Trialeurodes vaporariorum Westwood obtained, kind of infection tomato chlorisis virus is made
Eggplant plant.
3. method according to claim 2, which is characterized in that the Trialeurodes vaporariorum Westwood in the step (1) is the temperature just sprouted wings
Room trialeurodes vaporariorum.
4. method according to claim 2, which is characterized in that the feeding step in the step (1) is as follows:
Trialeurodes vaporariorum Westwood is put into micro- worm cage of diameter 1.5cm, tomato diseased plant is placed in from second leaf of few top, to greenhouse
Trialeurodes vaporariorum all flies to timing on tomato leaf, feeds more than for 24 hours.
5. method according to claim 2, which is characterized in that steps are as follows for infecting in the step (2):
Step (1) contamination Trialeurodes vaporariorum Westwood obtained is placed in micro- worm cage, is then fixed on tomato seedling from few top second
Ye Shang is all flown on blade to Trialeurodes vaporariorum Westwood, start timing, for 24 hours after, by Trialeurodes vaporariorum Westwood take out to get.
6. method according to claim 2, which is characterized in that further include contamination Trialeurodes vaporariorum Westwood obtained to step (1) into
The step of row internal ToCV and TYLCV is detected.
7. method as claimed in claim 6, which is characterized in that specific step is as follows for the internal ToCV detection:
Trialeurodes vaporariorum Westwood is placed in liquid nitrogen frozen 5s, then spend RNase grinding rod be fully ground after, add 1mL
Trizol reagent, and the extraction of the specification completion Trialeurodes vaporariorum Westwood total serum IgE according to Trizol extraction RNA method, take 1 μ g total serum IgE,
The synthesis of the first chain cDNA is completed by cDNA reverse transcription reagent box；
A pair of of detection primer is designed according to ToCV genome sequence:
Upstream primer ToCV-F:GGGGAATGTGCGTTTAAAGA；SEQ ID NO.1
Downstream primer ToCV-R:GAACCAAATCAACGCGATCT；SEQ ID NO.2
ToCV detects reaction system are as follows:
10 × PCR Buffer, 2.5 μ L, 2 μ L of dNTP Mixture, each 1 μ L of upstream and downstream primer, 1 μ L of cDNA template, r
Taq 0.25μL、ddH2O 17.25μL；
PCR response procedures are as follows: 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 35 are followed
Ring；After extending 7min after 72 DEG C, sample is subjected to agarose gel electrophoresis, whether there is or not judge that Trialeurodes vaporariorum Westwood is according to purpose band
It is no successfully to obtain ToCV；
8. method as claimed in claim 6, which is characterized in that specific step is as follows for the internal TYLCV detection:
Trialeurodes vaporariorum Westwood is placed in liquid nitrogen frozen 5s, then spend RNase grinding rod be fully ground after, according to animal groups
Knit the extraction that DNA extraction kit specification step completes polypide genomic DNA；
TYLCV detection primer is as follows:
Upstream primer TYLCV-F:CGCCCGTCTCGAAGGTTC；SEQ ID NO.3
Downstream primer TYLCV-R:GCCATATACAATAACAAGGC；SEQ ID NO.4
TYLCV detects reaction system:
10 × PCR Buffer, 2.5 μ L, 2 μ L of dNTP Mixture, each 1 μ L of upstream and downstream primer, 1 μ L of cDNA template, r
Taq 0.25μL、ddH2O 17.25μL；
PCR response procedures: 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 50s, 35 recycle；
After extending 7min after 72 DEG C, sample is subjected to agarose gel electrophoresis, whether there is or not whether judge Trialeurodes vaporariorum Westwood according to purpose band
Success obtains TYLCV.
9. method according to claim 2, which is characterized in that further include to step (2) infection tomato chlorisis virus obtained
Tomato plant the step of being detected, the specific steps are as follows:
The tomato plant for infecting tomato chlorisis virus is put into phjytotron, at 27 DEG C, the item of RH 60%, L:D=14:10
It is cultivated one month under part, observes incidence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610676236.6A CN106305625B (en) | 2016-08-15 | 2016-08-15 | Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610676236.6A CN106305625B (en) | 2016-08-15 | 2016-08-15 | Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106305625A CN106305625A (en) | 2017-01-11 |
| CN106305625B true CN106305625B (en) | 2019-05-28 |
Family
ID=57740631
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610676236.6A Active CN106305625B (en) | 2016-08-15 | 2016-08-15 | Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106305625B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628947A (en) * | 2019-09-27 | 2019-12-31 | 江苏省农业科学院 | Method for rapidly identifying tomato yellow leaf curl virus and tomato chlorosis virus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102534007A (en) * | 2012-01-14 | 2012-07-04 | 中国农业科学院蔬菜花卉研究所 | Specific sequence characterized amplified region (SCAR) marker for Trialeurodes vaporariorum, specific primers, and quick molecular identification method |
| CN102948336A (en) * | 2012-11-12 | 2013-03-06 | 北京市农林科学院 | Method for inoculating tomatoes with tomato yellow leaf curl viruses |
| CN103667530A (en) * | 2013-12-03 | 2014-03-26 | 山东农业大学 | Reverse transcription loop-mediated isothermal detection method for tomato chlorosis virus |
-
2016
- 2016-08-15 CN CN201610676236.6A patent/CN106305625B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102534007A (en) * | 2012-01-14 | 2012-07-04 | 中国农业科学院蔬菜花卉研究所 | Specific sequence characterized amplified region (SCAR) marker for Trialeurodes vaporariorum, specific primers, and quick molecular identification method |
| CN102534007B (en) * | 2012-01-14 | 2013-10-09 | 中国农业科学院蔬菜花卉研究所 | Specific sequence characterized amplified region (SCAR) marker for Trialeurodes vaporariorum, specific primers, and quick molecular identification method |
| CN102948336A (en) * | 2012-11-12 | 2013-03-06 | 北京市农林科学院 | Method for inoculating tomatoes with tomato yellow leaf curl viruses |
| CN103667530A (en) * | 2013-12-03 | 2014-03-26 | 山东农业大学 | Reverse transcription loop-mediated isothermal detection method for tomato chlorosis virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106305625A (en) | 2017-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gómez et al. | Transient expression of VP2 in Nicotiana benthamiana and its use as a plant-based vaccine against infectious bursal disease virus | |
| CN102816868B (en) | Double-PCR (polymerase chain reaction) method for detecting iridovirus of micropterus salmoides | |
| CN103540681B (en) | Method for detecting five plant viruses synchronously | |
| CN102392080B (en) | Method for identifying tomato yellow leaf curl virus resistance | |
| Islam et al. | Molecular characterization of mungbean yellow mosaic disease and coat protein gene in mungbean varieties of Bangladesh | |
| CN104928260B (en) | A kind of infectious bovine rhinotrachetis virus IBRV-JN03 separation strains and its application | |
| CN103911461A (en) | A method of simultaneously detecting a plurality of garlic viruses by quadruple RT-PCR and a primer composition thereof | |
| CN106305625B (en) | Method of the Trialeurodes vaporariorum Westwood in separation tomato chlorisis virus | |
| CN111363856A (en) | Method for simultaneously detecting four tomato viruses by multiple RT-PCR | |
| CN106929485A (en) | Pseudorabies virus genetic engineering gB recombinates attenuated vaccine strain and application | |
| CN107385108B (en) | Detection kit and detection method for new potyviridae virus in lotus roots | |
| CN104212912B (en) | Differentiate test kit and the application thereof of duck tembusu virus virulent strain and attenuated vaccine strain | |
| CN101954075B (en) | Method for preparing oral avian influenza vaccine from transgenic dunaliella | |
| CN107794311A (en) | A kind of kit and detection method that apple stem grooving virus is detected in lotus rhizome | |
| Roy et al. | Extraction of high quality DNA from mucilaginous plants with a new improved method, suitable for detection of geminiviruses and downstream applications | |
| CN106011087A (en) | Construction method of S1 gene and TM-1 gene recombinant adenovirus as well as recombinant adenovirus and application | |
| CN102628088B (en) | Polymerase chain reaction (PCR) detection method universal for viruses | |
| Pandey et al. | Detection and identification of Ageratum enation virus infecting Ageratum conyzoides in India | |
| CN110551696A (en) | Natural low virulent strain of avian infectious bronchitis virus and application thereof | |
| CN110760485B (en) | Avian reovirus strain and application thereof | |
| CN104328220B (en) | RT-LAMP primer sets, detection method and the kit of citrus yellow vein virus | |
| CN103290143B (en) | PCR composite reference object for detecting fowl tumour disease and preparation method thereof | |
| TWI488971B (en) | Primer kit and method for detecting if cucurbitaceae plant is infected by zucchini yellow mosaic virus | |
| CN102140555A (en) | Degenerate primers for universal reverse transcription-polymerase chain reaction (RT-PCR) detection of cowpea mosaic virus and fabavirus, detection method and application thereof | |
| Razali et al. | Isolation and characterisation of microfungi isolated from rubber tree |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |