CN1062907C - Method for preparation of antibody materials - Google Patents

Abstract

Disclosed are novel polypeptides possessing part or all of the primary structural conformation and one or more of the biological properties of mammalian erythropoietin which are characterized in preferred forms by being the product of procaryotic or eucaryotic host expression of exogenous DNA sequence.

Description

Produce the method for antibody materials

The present invention is related to the operation of genetic material, introduces the DNA reorganization operation steps that a kind of people of making might produce one or more bioactive artificial ground of the part or all of primary structure of the hemopoietin polypeptide of natural formation and/or this peptide species more specifically.

The operation of A genetic material

Genetic material can be broadly defined as such class chemical substance, be that they can Codocyte and the component of virus, and arrange the manufacturing processed of these components, but also can instruct replying of cell and virus.A kind of long chain polymer matter that is called thymus nucleic acid (DNA) is to remove some by the coded virus genetic material that comprises all viable cell and virus in addition of Yeast Nucleic Acid (RNA).Repeating unit in the DNA polymkeric substance is 4 kinds of different Nucleotide, and each nucleotide unit all is that (thymus pyrimidine or cytosine(Cyt) are linked the ribodesose top that has a phosphate group for purine (VITAMIN B4 or black purine) or pyrimidine.Nucleotide is with the linear mode polymerization: 5 ' phosphoric acid of a Nucleotide and 3 ' hydroxyl of another Nucleotide in conjunction with and be connected mutually.Functional DNA is combined into stable double chain form with strand Nucleotide (being called oligodeoxynucleotide) and exists, and this combination is because there is hydrogen bond between purine and the pyrimidine bases to exist (promptly between VITAMIN B4 (A) and the thymus pyrimidine (T) or the complementary pairing of existence between black purine (G) and the cytosine(Cyt) (C).Routinely, Nucleotide is called with the title of its purine or pyrimidine bases composition, and the Nucleotide complementary pairing in the double-stranded DNA (being A-T and G-C) then is called as " base pair ".Yeast Nucleic Acid be one by VITAMIN B4, black purine, cytosine(Cyt) and uridylic (U) (not containing thymus pyrimidine) and ribose and-polynucleotide that individual phosphate is connected.

Say that briefly the encoding function of DNA works by a process, in this process, special dna nucleotide sequence (gene) " is transcribed " in the corresponding unsettled messenger RNA(mRNA) (mRNA).Then, mRNA is as the template that forms structural protein by each seed amino acid, regulates albumen and catalysis egg.Also have little RNA chain (tRNA) to participate in this mRNA " translation " process, tRNA transports amino acid, and makes amino acid one by one be arranged in the polypeptide that formation together has correct aminoacid sequence one by one along the mRNA chain.The mRNA " information " that is derived out by DNA exists with the form of triplet " codon " codon, and triplet is meant which type of tRNA the trinucleotide group codon of a definite sequence need to point out and should carry any amino acid in 20 seed amino acids for the specific polypeptide one of " expressions " generation.In other words, proteinic formation is final " expression " form of the coded genetic information of the nucleotide sequence of gene.

DNA " promotor " sequence normally is in " front " of a gene in the DNA polymkeric substance and provides a special site for initial the transcribing of mRNA.DNA " adjusting " sequence also is " top " of a gene of given DNA polymkeric substance (being the front) usually, the protein of those decision transcription initiation speed.Be attached on " adjusting " sequence.This regulates sequence by the part that is called " promotor/regulon " altogether, and it is in the functional DNA polymkeric substance, also is positioned at usually before (or a series of) selecteed gene.The DNA preface of this part is determining synergistically whether this (or these are a series of) gene transcription (and final expression) can take place.Gene " back " in the DNA polymkeric substance then also has one to being transcribed into the dna sequence dna that plays termination signal of mRNA, and it is called as transcribes " terminator " sequence.

In the past in 10 years, a focus of microbiology process is to attempt to carry out industrialness is made remarkable effect on the pharmacology material with organism, these are biological neither beginning just has the genetic code information about required product in their DNA, (cells of mamma animals in cultivation in this case, perhaps neither just can on suitable level, express chromogene originally) in brief, specific the gene of required polypeptide product structure, from " donor " biology, separate, it is exactly chemosynthesis, and stably be induced in another biology afterwards, this biology be preferably can self-replacation unicellular organism, as bacterium, the cells of mamma animals of yeast or tissue culture.After finishing this step, be present in " " or " this new machine part of the genetic expression in " transfection " microbial host cell; just operate producing required product: transcribe new mRNA as template; then, this mRNA changes into the continuous sequence of amino-acid residue again of conversion with foreign DNA.

The separation of relevant " purpose " genetic material, synthesize, purify, amplify and be introduced into this a whole set of operation that is transformed in the host cell of selecting for use, be called as " recombinant DNA " method.The patent of relevant this technology and document are very abundant.For example people's such as cohen United States Patent (USP) 4237244 relates to the conversion to the unicellular host biology of viral DNA or cyclic plasmid DNA crossbred, and these crossbreds DNA includes selected exogenous dna sequence dna.Process in people's such as cohen the patent, thus at first introduced cut virus with Enzymology method or the cyclic plasmid DNA select the operation of conversion carrier to form the linear DNA chain.External (" external source " or " allogenic ") DNA chain of selecting generally includes the sequence of the required product of coding, and they are to make linear dna segment with similar enzyme after cutting.Under the condition that has ligase enzyme to exist, be cut into the virus or the plasmid DNA carrier of wire, carry out incubation with the foreign DNA fragment, thereby this ligase enzyme can carry out Jie's recuperation and form " hybridization " hybrid carrier: selecteed foreign DNA segment " splicing " to virus or cyclic DNA plasmid in, so formed hybrid vector.

With the result that hybrid vector and affine unicellular host biology transform, be in host cell population, to form multiple copied, a large amount of exogenous dna segment.In some instances, only wish external dna segment is amplified and " product " gathered in the crops is DNA.But more be, the purpose of conversion is to wish that exogenous DNA can express so-called the expression in host cell, and exogenous exactly DNA is by transcribing, translating, the needed protein of finally encoding out.People wish to synthesize some commercial very valuable protein, and, wish that its resultant quantity is bigger, make people obtain it by isolation technique.Referring to for example No. 4264731, United States Patent (USP) (Shine), 4273875 (Manis) 4293652 (cohen), and european patent application 093619, open November 9 nineteen eighty-three.

Specific DNA sequence is spliced to the progress of this step operation in the dna vector, various technology are arranged, as for select any technology for use actually, then depend on to a great extent " donor " at the host " external source degree " and will be in the host size of polypeptide expressed.Take the liberty and say, consideration can be expressed as people can according to circumstances select to adopt any scheme that designs with three kinds of different principle:

(1) " separation " goes out double-stranded DNA from the genomic dna of donor;

(2) dna segment of the dna sequence dna of a coding of the chemosynthesis polypeptide of wanting;

(3) utilize isolating mRNA from donorcells, by the effect of " reversed transcriptive enzyme ", at the external double chain DNA sequence that synthesizes.The method of " complementation " DNA of the formation mRNA that addresses at last is commonly referred to as " cDNA " method.

When whole amino acid residue sequences of desired polypeptides product when being known, then usually select the method for preparation (synthesizing) or dna sequence dna for use.For example, total, the United States Patent (USP) sequence number mat woven of fine bamboo strips 483451 that awaits the reply jointly, (apply for by the application that Elton people such as (ALton) submits to April 15 nineteen eighty-three, corresponding PCTus83/00605, open in November 24 nineteen eighty-three with wo83/04053 number) in the DNA manufacture method, the superior method that is used to finish such height desired result is provided, comprise: a codon in the several codons that can express same seed amino acid is provided, and this codon is (codon of yeast or intestinal bacteria institute " preference " promptly is provided) that can highly be expressed in the host cell of selecting for expression; Avoid having " intron " sequence (being common in mammals genomic dna sequence and mRNA transcription thereof) that to translate, in prokaryotic host cell, do not have such sequence; Avoid giving expression to " guide " peptide sequence of non-purpose, this guide's polypeptide usually can be by genomic dna and cDNA sequence encoding, but it is usually very difficultly cut from the desired polypeptides that their form by bacterium or yeast host cell; DNA can be inserted into have in the carrier that can express easily between promotor/regulon and the terminator sequence; And the gene order that coding desired polypeptides or similar required polypeptide are provided.

When whole amino acid residue sequences of want polypeptide are also ignorant, directly the synthetic DNA sequence is impossible, therefore can't resemble consider above remove to assemble out the expression vector that the height expression level is arranged in microorganism, can only do some concessions aspect the digit rate expressing.Like this, the method with CDNA method separation coded polypeptide dna sequence dna has just become selected scheme.In the standard procedure of separating purpose cDNA sequence, promptly derive cDNA by mRNA reverse transcription abundant in the donorcells earlier, refabrication goes out " gene library " Library of the plasmid that load these cDNA, should select for use the cell that can make highly the reaction of expressing to special genes be donorcells for example, the pituicyte that can express quite a large amount of tethelin products can select the donorcells that is used as preparing the growth hormone cDNA storehouse.When the integral part in whole aminoacid sequences of only knowing polypeptide, elder generation manually synthesizes the single stranded DNA with the corresponding dna fragmentation of that part of known aminoacid sequence, infers that this part DNA is present among " target " cDNA.Carry out isotopic labeling again.The DNA that this mark is crossed is called as probe Probe.Desired cDNA during this probe can angle promptly can be used for the hybridization step of DNA/DNA when being become the cDNA copy of single stranded form to clone by sex change; Dna probe can be hybridized with the some parts among the cDNA, thereby detects out " target " sequence relevant with amino acid sequence corresponding among the cDNA.(discussion and the announcement of relevant this technology that provides referring to United States Patent (USP) the 4394443rd by people such as Weissman, and by the demonstration of the long oligonucleotide hybridization probe of the nearest use reported of people such as Wallace, see Nuc.Acids.Res.6,3543～3557 pages (1979), and people P.N.A.S. (U.S.A) 79 phases of the mat woven of fine bamboo strips such as Reyos, 3270～3274 pages (1982), with people such as Jaye, NuC.ACids Res., o. 11th, 2325～2335 pages (1983).Also can be referring to No. the 4358535th, people's such as Falkow United States Patent (USP), about the DNA/DNA hybridization in efficient diagnosis; Touch upon slight radio-labeling on strand polymerized nucleoside acid probe of Europe publication the 0070685th and 0070687; People such as Davis " genetic engineering procedure, higher bacteria genetics "; Cold spring harbor laboratory, the cold spring port, New York (1980), have then introduced bacterium colony and benton-Davis technique by the 55th～58 page and 174～176 pages; The brochure of New England's nuclear (Boston, Massachusetts) " genescreen " hybridization transfer film material is an experiment instruction handbook about hybridization and the transfer of DNA and RNA, catalog number (Cat.No.): NEF-972).

In the crossover operation of screening recombinant clone, recent the most significant progress be to use mark, blended, the oligonucleotide probe of synthetic, each probe all might go and sample to be hybridized in some specific DNAs partly carry out complementaryly completely, these samples are exactly the inhomogenous mixture of various single stranded DNAs or RNA.Think that at present these methods are detecting some special DNA, when promptly only producing the cDNA clone that the analyte derivative of the mRNA of trace extremely goes out, useful especially for desired polypeptides.In brief, instruction is intended to avoid the hybridization conditions of the strictness control of non-specific binding, can allow for example radioactive automatic developing imaging of specific cDNA clone, and this is based on the result of target DNA single probe hybridization of complementary complete with it in mixture.Referring to people Nuc.Acids Res. such as Wallace, the 879th～897 page of the 9th phase (1981); People such as Suggs, the 78th phase the 6613rd～6617 (1981) of P.N.A.S (U.S.A); People Nature such as Choo, the 229th phase 178-180 page or leaf (1982); People P.N.A.S. (U.S.A.) the 79th phase 6461-6464 (1982) such as Kurachi; People such as Ohkubo, the 2196th～2200 page of the 80th phase of P.N.A.S (U.S.A.) (1983); People such as Kornblihtt, the 3218th～3222 page of the 80th phase of P.N.A.S. (U.S.A) (1983).Generally speaking, people's such as above-mentioned Wallace (1981) mixed probe method, given to have expanded by many colleagues, promptly report has been arranged in reliable this point as a result, the result derives from cDNA clone's separation, and one 32 Yuans mixing " storehouse " that are the oligonucleotide probe of 16 bases long (16 aggressiveness) have been used in this separation.Various dna sequence dnas and 11 independent aggressiveness are put together, influenced " just " configuration that is present in two sites among the purpose cDNA.Referring to people such as Sinyer～Sam, P.N.A.S. (U.S.A.), the 802nd～806 page of the 80th phase (1983).

Using the genomic dna isolate, is to produce in the method for specific DNA sequences used in the regrouping process at above-mentioned three kinds, is rarely found.This point is all the more so in the field that guarantees the recombination method that the mammals polypeptide is expressed in microorganism, because the mammals genomic dna is too complicated.And still there is reliable method to prepare storehouse by bacteriophage supported people or other mammals genomic dnas.(referring to people such as Lawn, cell, the 1157th～1174 page of the 15th phase (1978), the method that produces the human genomic library introduced in article, and this library is called " Maniatis library " usually; People such as Karn, P.N.A.S. (U.S.A), the 5172nd～5176 page of the 77th phase (1980), article introduced the operation steps of selecting for use different restriction enzymes same dna molecular to be produced the human genomic library of different dna fragmentations; And people such as BLattner; the 161st～169 page of the 196th phase of Science (1977); the work of setting up cow genome group library has been described), in the work success of the sequence of amino acid or DNA being understood use crossover process isolation of genomic DNA under very few situation seldom.An example is arranged earlier, see people such as Fiddes, in " molecular genetics and applied genetics magazine " the 3rd～18 page of (J.Mol.and App.Generus) first phase (1981), reported from the Maniatis library, successfully carried out separating the work of gene of the α-subunit of the human hypophysis glycoprotein hormones of coding by the probe that uses " total length ", this probe be comprise the cDNA sequence of giving isolating earlier, α-subunit, the fragment complete, that 621 base pairs are arranged.Another example is, people such as Das, and the 1531st～1535 page of the 80th phase of P.N.A.S (U.S.A) (1983), reported the oligonucleotide that uses one 175 base pair of artificial synthetic, isolate the human genome clone of people HLA-DR.At last, people such as Anderson, P.N.A.S. (U.S.A) the 80th phase, the 6838th～6842 page (1983) have been reported and have been isolated the work that bovine trypsin suppresses the genomic clone of son (BPTI), and a length has been used in this work to be 86 base pairs and to be the single probe of making by the BPTI known amino acid sequence.The authors of article are for separating in the initial cheek and the lung tissue, being suitable for the prospect of the mRNA in synthetic cDNA library, made pessimistic final conclusion, because the mRNA contents level in this source obviously is too low, afterwards, they have emphasized that also the successful prospect of detecting genomic library with the mixed mark probe has certain limitation, they state: " say that more generally the oligodeoxynucleotide probe of mixed sequence has been used to separate those and has not known the protein gene of its sequence from the cDNA library.These probes are mixtures of typical 8～32 oligonucleotides.Length is that (5～6 residues, this little stretching, extension is in conjunction with each possible codon for each the little stretching, extension of representing aminoacid sequence of the segment of 14～17 Nucleotide.Under the hybridization conditions of strictness control, just can the specific gene sequence positions by using this mixed probe to the clone library of moderate complexity in minuent when promptly those probes that can not correctly carry out base pairing being treated with a certain discrimination.Yet,, resemble the mammals genome desired singularity of sequence of complexity so the blended probe usually lacks to detect because the length of these probes is short and heterogeneity.So just make this method when not having corresponding mRNA, remove to separate the mammals protein gene and become very unpractiaca thing ".

Like this, in this field, also still exist the requirement of improving one's methods, promptly to know hardly the aminoacid sequence of want encoded polypeptides, and in the sort of biological tissue that can't obtain being rich in mRNA at an easy rate, under the situation of building the cDNA library, find out the way that to carry out rapid efficient cDNA clone and separate.When people will separate those mammals genomic clones of knowing little for the proteinic aminoacid sequence of the mammals of coded by said gene, it then was useful especially that such some are improved one's methods.

B. as the hemopoietin (Erythropoietin) of desired polypeptides

Hemopoietin is the product of red blood cell, produces continuously to overcome the damage of cell in the life-span in all one's life the mankind.The generation of short erythrocyte is accurately to be controlled by physiological mechanism, is used for normal tissue oxygenation so that have the red corpuscle of sufficient amount in the blood, but can not be too many, so that these cells will hinder circulation.Red corpuscle be in marrow, generate and be at hormone, promptly carry out under the control of hemopoietin.

Hemopoietin is a kind of acid glycoprotein, and molecular weight is about 34000 dalton, and three kinds of form: α, β and asialo type can be arranged.The carbohydrate of α type and β type partly has small difference, but they have identical usefulness, biologic activity and molecular weight.The asialo type is exactly the protein molecule that α type or β type have removed the carbohydrate (sialic acid) of terminal.When health is under the state of health, the concentration that short erythrocyte generates rope in the blood plasma is very low, wherein organizes to obtain enough oxygenation in the existing red corpuscle.This normal lower concentration is exactly the red blood cell that replaces those normal losses in the astogeny schedule to stimulate.

Under the anoxia condition that the minimizing of oxygen causes in being in owing to hemocyte transportation oxygen cycle, the concentration of the hemopoietin in the circulation just raises.The massive blood loss that causes owing to profuse bleeding, excessively be subjected to the breaking-up that radiation causes red blood cell, because the high height above sea level or the senseless oxygen uptake that causes of having dragged for a long time reduce, and various anemias all may cause anoxic.Tissue is subjected to the reaction that anoxic pressure done, and short erythrocyte generates the generation of Suo Zengjia red blood cell.This increase is to be converted to former red blood cell by the original precursor cell in the stimulation marrow to realize.This former red blood cell subsequently can be ripe, the meeting synthetic hemoglobin, and can be discharged in the circulation as red blood cell, thereby will improve the content of erythrocyte in blood circulation.When the number of the red blood cell in the circulation during greater than the demand of healthy tissues oxygen part, then the hemopoietin in the circulation just reduces.

Referring to people such as Testa, (Exp, Hematol) the 8th phase (Supp, 8), the 144th～152 page (1980); People such as Tong, (J, Biol, chen.), the 256th (24) phase, the 12666th～12672 page (1981); Goldwasser J.Cell.Physiiol, the 110th (Supp.1) phase, the 133rd～135 page (1982); Finch (Blood), the 60th (6) phase, the 1241st～1246 page of people such as (1982) sytowski, Expt.Hematol., the mat woven of fine bamboo strips 8 (Supp 8) phase, the 52nd～64 page (1980), Naughton Ann.Clin Lab.Sci., the 13rd (5) phase, the 432nd～433 page (1983); People such as Weis, Am.J.Vet.Res., the 44th (10) phase, the 1832nd～1835 (1983); People such as Lappin, Exp.Hematol, the 11st (7) phase, the 661st～666 page (1983); People such as Baciu, Ann.N.Y.Acad.Sci., the 414th phase, the 66th～72 page (nineteen eighty-three); People such as Murphy, Acta, Haematologica.Japonica, the 46th (7) phase, the 1380th～1396 page (1983); People such as Dessypris, Brit.J.Haematol, the 56th phase, the 295th～306 page (1984); And people such as Emmanouel, Am.J.Physiol., 247 ((1 Pt2), F168～176 (1984).

Because hemopoietin is absolutely necessary in the forming process of erythrocyte, so this hormone is that the lower or insufficient hemopathy of generation of erythrocyte has the potential purposes for diagnosis or treatment symptom. referring to people such as Pennathur-Das, Blood, the the 63rd (5) phase, the 1168th～1171 page (1984) and Haddy, Am.Jour.Ped.Hematol/Oncol., the fourth phase, the 191st～196 page (1982), but relate to hemopoietin may diagnosis and treatment the anemia of sickle shaped cell, and people such as Eschbach, J.Clin.Invest., the the 74th (2) phase, the 434th～441 page (1984) produce certain body internal reaction to suffering from a kind of blood plasma that is rich in hemopoietin of uremic sheep input.Based on such situation, consider the effect of treatment, and suggestion is 10 unit EPO/ kilogram skies to the exsanguine therapeutic dose with chronic type, medication 15～40 days.Referring to Krane, Henry Ford Hosp.Med, J., the 31st (3) phase, the 177th～181 page (1983).

Nearest estimation is, only in the quantity of the obtainable hemopoietin of the U.S., and the annual anaemia that just can treat 1,600,000 people.Referring to Morrison, " Bioprocessing in Space ... an Overview, " the 557th～571 page sees world's biotechnology report in 1984, the 2nd volume, the U.S., (Niu Yuezhou in 1984, New York printing).Nearest research provides a kind of basic forecast that hemopoietin is renderd a service the treatment of various disease states, obstacle confusion and blood imbalance state: people such as Vedovato, Acta, Haematol, the 71st phase, the 211st～213 page of (1984) (β-thalassemia); People such as Vichinsky, J.Pediatr., the 105th (1) phase, the 15th～21 page (1984) (cystic fibrosis Cystvc fibrosis); People such as Cotes, Brit.J.obstet.Gyneacol.The the 90th (4) phase, the 304th～311 page (1983) (gestation, menoxenia); People such as Haga, Acta.Pediat rScand., the 72nd phase, the 827th～831 page (1983) (precocial early stage anaemia); People such as Clauswalker, Arch, Phys, Med, the 65th phase of Rehabil, the 370th～374 page of (1984) (spinal injury); People such as Dunn, Eur.J.Appl.Physiol, the 52nd phase, the 178th～182 page of (1984) (interstellar flight), people such as Miller, the 52nd phase of Brit.J.H-aematol, the 545th～590 page of (1982) (acute bleeding); People such as Udupa, J.Lab.Clin, Med., the 103rd (4) phase, the 574th～580 and 581～588 page (1984); And people such as Lipschitz, BLood, the 63rd (3) phase, the 502nd～509 page of (1983) (aging); People such as Dainiak, Cancer, the 51st (6) phase, people such as the 1101st～1106 page (1983) and Schwartz, the 109th phase of Otolaryngol., the 269th～272 page (1983) (with various knurl venereal disease attitudes of unusual hemopoietin).

The trial of obtaining the hemopoietin of high yield from blood plasma or urine in the past has been proved to be to not too successful.Complexity must be arranged and most advanced and sophisticated experimental technique, and generally only collect very a spot of neither pure unsettled again extract that contains hemopoietin.

United States Patent (USP) has been described a kind of method of the hemopoietin of partly purifying for No. 3033753 from sheep plasma, obtain the very low solid crude product that contains hemopoietin of output with this method.

The test that separates hemopoietin from urine at initial stage has obtained the preparation of the active this hormone of unsettled lifeless matter.United States Patent (USP) introduced for No. 3865801 a kind of hemopoietin that from urine, obtains to contain stable in properties crude product method.This crude preparation by using that obtains is declared to be one that and contains 90% hemopoietin activity, and this activity is stable.

Another kind of method of purifying human hemopoietin from reproducibility anaemia patient's urine is people such as Miyake, and J.Biol.Chem. the 252nd volume was described in No. 15 (on August 10th, 1977) the 5558th～5564 page.This has the process of 7 steps to comprise ion exchange chromatography, ethanol sedimentation, and gel-filtration and absorption chromatogram have obtained pure hemopoietin preparation, and its effectiveness is 70400 unit/milligrams, and protein output is 21%.

No. the 4397840th, people's such as Takezawa United States Patent (USP), described the certain methods that from healthy human urine's sample, prepares a kind of " hemopoietin product " with weak base type ion exchanger, and the low-molecular-weight product that proposes to be obtained " there is not retarding effect to hemopoietin ".

No. the 2085887th, the people's such as Sugimoto that announce May 6 nineteen eighty-two English Patent, described a kind of mankind's from hybridization the production method of lymphoblastomatous cell, report says that the level of production is that 3～420 units hemopoietin/ml cells suspension is bred up to 10 the mammals host ⁷Individual cells/ml, be distributed in the nutrient solution of tissue culture and obtained to be asserted as the highest production level, after transferring to the cell of tissue culture the in-vitro culture medium in body, the productivity of hemopoietin can be calculated and is about 40 to 4000 unit/10 ⁶Individual cell/48 hour.(referring to No. the 4377513rd, corresponding US).Existing people has proposed to separate a large amount of suggestion of hemopoietin from tissue-derived, comprise the knurl sexual cell ((neoplastic cell), but output is all quite low, referring to people such as Jelkman, Expt.Hematol. the 11st (7) phase, the 581st～588 page (1983); People such as Tambourin, p.N.A.S. (U.S.A), the 80th phase, the 6269th～6273 page (1983); People such as Katsuoka, the 74th phase of Gann., the 534th～541 page (1983); People such as Hagiwara, Blood, (4) phase the 63rd phase, 828～835 pages (1984); And people such as Choppin, Blood, the 64th (2) phase, the 341st～347 page (1984).

Other the isolation technique in order to obtain purified hemopoietin comprises immunological method.

A kind of polyclonal, the serum deutero-instructs the antibody of opposing hemopoietin to obtain, and this is that people's hemopoietin is expelled to generation in the animal body, animal with rat or rabbit for well.The short erythrocyte of the people that injection is entered generates rope, is the exotic antigen material by the immune system recognition in the animal body, and causes that generation antibody is to resist this antigen.Different can producing antibody to the cell that the antigenicity material incentive is reacted and be discharged in the circulation gone, and they are with slightly different by the antibody that other reacting cells produced.When animal is extracted blood out on one's body, the antibody activity in the serum is still keeping.When the serum or the antibody preparation of not purification are purified as a kind of immune globulin G part (IgG), and then this IgG preparation is used for detecting and whether analyzes with human hemopoietin phase compound tense, such preparation is subjected to bad evaluation because of it has a kind of main defective.This by

The serum antibody that individual cells produced is made up of all different antibodies, its be in the nature polyclonal, can be mutually compound, rather than only mutually compound with hemopoietin with the various compositions in the crude extract.

A kind of so nearest progress of technology meaningfully in the background of the present invention promptly can produce single cell of planting antibody and carries out tissue culture a kind of, and this antibody has specific immunocompetence for a selected antigenic single antigenicity factor.Referring to Chisholm, HighTechnology.The 3 volume first phases of the mat woven of fine bamboo strips, the 57th～63 page (1983).Attempted with cytogamy and hybridization technique selecting antibody, and such antibody has been used for separating human hemopoietin and the detection by quantitative human erythropoietin goes " mono-clonal " of short erythrocyte.For example, successfully prepare mouse---the report of mouse hybridoma cell strain of the monoclonal antibody of the human hemopoietin of secretion, see the digest of Lee-Huang, Fed.Proc, No. the 1463rd, digest, the 41st phase, the 520th page (1982).The another one example is that for preparation and use mono-clonal, the detailed description of anti-hemopoietin antibody sees people such as Weiss, P.N.A.S. (U.S.A.), the 79th phase, the 5465th～5469 page (1982).Also can be referring to Sasaki, Biomed, Biochem.Acta., 42 (11/12), S202～S206 (1983); People such as Yanagawa, BLood, the 64th (2) phase, the 357th～364 page (1984); People such as Yanagawa, the 259th (5) phase of J.Biol.Chem., the 2707th～2710 page (1984); With No. the 4465624th, United States Patent (USP).

Another significant background of the present invention in addition is the report about the immunologic competence of synthetic peptide, and this synthetic peptide has duplicated the part and parcel of aminoacid sequence in the natural protein, the aminoacid sequence of glycoprotein and nucleoprotein basically.More special is, the relatively low polypeptide of molecular weight demonstrates has also participated in immune response, and its on action time and the scope with physiology on important protein matter such as virus antigen, the immune response of polypeptide hormone and analogue is similar.Be included among the immune response of this class polypeptide is the excitation that specific antibody forms in immunocompetent animal.Referring to people such as Lerner, Cell, the 23rd phase, the 309th～310 page (1981); People such as Ross, the 294th phase of Nature, the 654th～656 page (1981); People such as Walter, P.N.A.S. (U.S.A.), the 77th phase, the 5197th～5200 page of people such as (1980) Lerner, P.N.A.S. (U.S.A), the 78th phase, the 3403rd～3407 page (1981); People such as Walter, P.N.A.S., (U.S.A.), the 78th phase, 4882-4886 page or leaf (1981); People such as Wong, the 78th phase of P.N.A.S. (U.S.A), the 7412nd～7416 page (1981); People such as Green, Cell, the 28th phase, the 477th～487 page (1982); People such as Nigg, P.N.A.S. (U.S.A.), the 79th phase, the 5322nd～5326 page (1982); People such as Baron, Cell, the 28th phase, the 395th～404 page (1982); People such as Dreesman, Nature, the 295th phase, the 158th～160 page (1982); And Lerner, Scientific American, the 248th phase, No. 2, the 66th～74 page (1983).Also can be referring to people such as Kaiser, Science, the 223rd phase, the 249th～255 page (1984), and the biology and the immunologic competence of synthetic peptide introduced in these articles, and this synthetic peptide approximately has the secondary structure of peptide hormone and does not have their primary structure configuration.Yes relates to proteinic aminoacid sequence rather than relate to hemopoietin in above research, at present, the integral part of hemopoietin since aminoacid sequence still do not deliver.Submitting to February 4 nineteen eighty-three by J.Egrie, and in jointly await the reply total on August 22nd, 1984 as No. the 463724th, No. 0116446 laid-open U.S. Patents of European patent, a kind of mouse has been described---mouse hybridoma cell strain (A.T.C.C store number for HB8209), its produces the antibody of monoclonal, the anti-hemopoietin of high degree of specificity, it has specific immune response active for a following polypeptide, and this polypeptide contains following aminoacid sequence: NH ₂-Ala-Pro-Pro-Arg-Leu-Ile-Cys-Asp-Ser-Arg-Val-Leu-Glu-Arg-Tyr-Leu-Leu-Glu-Ala-Lys-COOH.

Peptide sequence refer to according to people such as Miyake at " biochemical magazine " (J.Biol.chern.), the 252nd phase, preceding 20 amino-acid residues of the 5558th～5564 page of isolating sophisticated people's hemopoietin of (1977) the above method, to its amino acid whose analysis is to be with people such as Hewick.M. with (Biosys Corp. provides (Biosysteps.Inc.)) on the gas phase sequence analyser, the 256th phase of J.Biol Chem., the 7990th～7997 page of (1981) described method carried out.Also can be referring to people such as Sue, Proc.Nat.Acad.Sci. (USA), the 80th phase, the 3651st～3655 page (1983), article has been discussed and has been produced for the polyclonal antibody by the polypeptide that the form different aminoacids sequence, 26 amino-acid residues of synthetic, also see people such as Sytowski, the 69th phase of J.Immunol.Methods., the 181st～186 page (1984).

Above-mentioned polyclone and monoclonal antibody can be for carrying out qualitative detect and content analysis provides highly useful material with immunochemical method to hemopoietin, and can be with the affinity chromatography hemopoietin of purifying, seem also to be not likely the mass production that can carry out large-scale hemopoietin at present from the mammals source, make it be enough to further analyze, clinical experiment reaches and utilize this material potential in treatment, diagnosis and treatment purposes widely, for example chronic ephrosis, its pathological tissues can't continue to produce hemopoietin.Final design in this field is so best prospect, the mammals hemopoietin that abundant characterization promptly will be arranged, and provide a large amount of this materials, be used for diagnosis and clinical use, comprise that successfully using regrouping process synthesizes effectively this compound is carried out large scale microbial.

Though done a large amount of trials for separating coding dna sequence dna human and other mammals hemopoietins, it seems does not have success.This is mainly due to the weary tissue substance of marrow source, and particularly human enrichment specificity mRNA is tissue-derived, and is still not enough.Only there are enough mRNA can set up the cDNA library, only had the method that makes things convenient for of the available routine of cDNA library ability to isolate the dna sequence dna of coding hemopoietin.Moreover, because of the continuous sequence to the amino-acid residue of hemopoietin is known little, therefore can not set up a long polynucleotide probes, and if this class probe arranged, such probe can be used for DNA/DNA hybridization reliably so, filters out cDNA and special genome dna library.Obviously, provide by A.T.C.C.HB8209 in order to production, by 20 amino acid whose monoclonal antibodies of above-mentioned name, can not produce in the method described in the Supra according to people such as Anderso a kind of definite, by the oligonucleotide probe of 60 based compositions.According to estimates, human hemopoietin gene, may be in the people's gene group, to exist as " single copy gene ", and in any situation, encode human hemopoietin genetic stew as if occupy less than 0.00005% of human full gene group DNA, this genomic dna can exist with the form of genomic library.

Up to now, about the report of the most successful trial of dna sequence dna that the separable mammals hemopoietin that is suitable for being used in the microbial expression a great deal of is provided with relevant recombination method, still far apart from purpose.People such as Farber for example, Exp Hematol.O. 11th Supp.14, summary 101 (1983), reported from the baboon nephridial tissue of handling with phenylhydrazine and extracted mRNA, and with mRNA be injected into Xenopus laevis (: Xenopus laevis) in the ovocyte, obtained in produced in vitro " translation product " mixture, comprising the material that demonstrates the hemopoietin biologic activity.More recently, people such as Farber, BLood, the 62nd phase No. 5, No. the 1st, Supp, summary 392 has been reported on 122a page or leaf (1983) and has been translated human kidney mRNA at external use toad ovocyte and can obtain the blended translation product.Estimate that every milligram of mRNA generation of injection is approximately 220 milliunits and has the active translation product of hemopoietin.Though that the external translation of the exogenous mRNA of the coding hemopoietin of this level is considered to is low-level (even with former baboon mRNA is translated the level of going in the product of being asked compare), but think that it is the expression site of a hemopoietin that this result has proved conclusively the human kidney, thereby may set up the gene library of the human kidney cDNA of enrichment with human kidney cells, perhaps desired gene just can be separated from this library.(referring to Farber, the 31st (4) phase of Clin.Res, 769A page or leaf (1983)).

Since having submitted United States Patent (USP) the 561024th and No. 582185 to, have only one piece about the clone that is called as the intestinal bacteria (E.coli) that contain human hemopoietin and the report of expression, the cDNA that expresses worksheet person of good sense erythropoietin is in and is cloned in the intestinal bacteria the sixth of the twelve Earthly Branches.In brief, the cDNA clone of some amount is inserted in the escherichia coli plasmid, and (fusion product of β-Lactamase) is considered to a monoclonal antibody non-specific " epitope " of human hemopoietin to be had immunocompetence to β---lactamase.Referring to Lee-Huang, the 81st phase of Proc.Nat.Acad.Sci. (U.S.A)) the 2708th～2712 page (1984).

The present invention provides a kind of separation of polypeptide product of novelty and the method for purification first.This polypeptide product has natural hemopoietin, comprises part or all primary structure conformation (being the continuous sequence of amino-acid residue) and one or more biological characteristicses (for example immunological properties and body in and extracorporeal biology activity) of its homotopic mutation.These polypeptide are products of specificity exogenous DNA array (as the tissue culture cells of bacterium, yeast and mammal) genetic expression in protokaryon or eukaryotic host cell, therefore have unique characteristic.And this exogenous DNA array or obtain from genomic dna cloning or obtain from cDNA clone is perhaps obtained by synthetic.The expression product that produces in microorganism is put in vertebrates (as mammals and the birds) cell, also can be owing to removing in its environment of cells of mamma animals of sky combustion or extracellular fluid is to link in blood plasma or the urine at human protein or other and pollutent in the generation of short erythrocyte to obtain further characterization.Typical yeast is cereuisiae fermentum (Saccharomyces cerevisiae) for example) or the host cell of prokaryotic cell prokaryocyte (for example intestinal bacteria, (E.Coli)) in product, be that not to be attended by any mammals proteinic.Because employed host's difference, the polypeptide that the present invention generates may be glycosylated by the carbohydrate of mammals or other eucaryons, also may be nonglycosylated.Polypeptide of the present invention also may comprise an initial methionine residue (on-1).

Neoglycoprotein product of the present invention be a kind of have those through fully duplicate with natural (for example human) hemopoietin be similar primary structure configuration, thereby have its a kind of or various biological character, and on average carbohydrate ingredient with natural (for example human) the different glycoprotein of hemopoietin.

The invention provides vertebrates (for example COS-1 and CHO.) cell.The cell that provides for the first time is provided, these cells can be in external breeding continuously, and with regard to its growth on substratum, they can be within 48 hours, and per 10 ⁶Individual cell produces the above hemopoietin of 100U (better be more than the 500U, best is 1,000 to 5, the above representation unit of 000U) in the substratum of its growth, this output is determined with radioimmunoassay.

Synthetic polypeptide provided by the invention is the synthetic polypeptide of the continuous sequence of the hemopoietin amino-acid residue that duplicated fully or partly.These polypeptide are illustrated at this for the first time.These sequences, because it has the one-level of natural hemopoietin in essence, feature structure or conformation of secondary or three grades, so they can have biologic activity the same with natural product and/or immunological properties, they can be made the substituent of the hemopoietin on biologic activity or the immunology and be used for diagnosis and treatment and immunologic process like this.Corresponding therewith, provide the mono-clonal or the polyclonal antibody that produce by standard method, they have immunocompetence for above-mentioned this peptide species, for natural hemopoietin better immunocompetence are arranged then.

Explanation of the invention is, monkey or people's clone dna sequence dna and dna sequence dna and on behalf of the short erythrocyte that derives from monkey and people, the polypeptide of representing monkey or people's heredity message of inferring aptly respectively generate the primary structure conformation of rope thus.

The invention provides out portability and mix viral DNA carrier and cyclic plasmid dna vector that the present invention is set up, that dna sequence dna has the neontology function.And provide and stably to transform or the host living beings of the microorganism of this carrier of transfection (for example bacterium, yeast and cells of mamma animals).Corresponding to the present invention, the novel method of producing useful polypeptide also is provided, it is included in exogenous good, under the condition that the entrained dna sequence dna of carrier is easy to express on a large scale, tissue culture transforms like this or the microorganism host of transfection, the molten born of the same parents' thing of cell or cytolemma are partly isolated desired polypeptide from growth medium.Or the like method.

The method of the polypeptide of separation provided by the present invention and purification microbial expression can be conventional method, comprises for example preparation property chromatographic separation and the immunology separation method that comprises the preparation of mono-clonal and/or polyclonal antibody.

After the amino acid residue sequence of having described hemopoietin, the invention provides the full sequence of DNA of synthetic coding erythropoietin and/or the method for partial sequence, the method that provides has the feature of some such superiority, as in the same amino acid whose possible several codons of coding, which selects for use is that selected non-mammals host " is ready preferentially " that the codon of expressing forms dna sequence dna, the point of contact of restriction endonuclease is provided, the initiate dna that adds sequence is provided, stop dna sequence dna and middle portion dna sequence dna, these parts are convenient to set up a carrier that is easy to express.Correspondingly, the invention provides cDNA and the specificity on the genomic dna making and produce and lure the friendship site; By the method for dna sequence dna microbial expression, the coding derivative of hemopoietin or polypeptide analog, these derivatives or analogue originally are different (be delation analogs: contain incomplete to specific residue of EPO and/or replacement analogue: wherein one or more specific residues are replaced by other residue and/or add analogue: one or more amino-acid residues are added in the terminal or the middle portion of polypeptide) with natural polypeptides at the location or the amino acid of one or more amino-acid residues on one's body; And above-mentionedly be changed all or part of active integral part that the amino-acid residue position or that be replaced is being born natural polypeptides just.

New dna sequence dna of the present invention comprises that all those carry out safely expressed useful sequence to polypeptide product at protokaryon or eukaryotic host cell.This polypeptide product has the primary structure conformation of at least a portion hemopoietin, and one or more biologic activity are arranged, can obtain understanding by following four aspects about these: (a) dna sequence dna that in table V and table VI, provides or their complementary strand, (b) with dna sequence dna or its fragment (hybridizing under hybridization conditions or the condition as described herein) of the dna sequence dna hybridization that (a) is limited in more tight control; And (c) can with point out above a), the hybridization of the dna sequence dna that b) limited, but annex the dna sequence dna of property (degeneracy) corresponding to genetic code.The special understanding that is obtained by (b) part is that the genomic dna sequence of coding equipotential mutation produces monkey or people's hemopoietin and/or other mammiferous hemopoietins of encoding.The special understanding that is obtained by (c) part is may be mixed with the codon that is easy to translation mRNA in non-vertebrate host in those dna sequence dnas of manufacturing coding EPO, EPO fragment and EPO analogue.

The present invention includes this a series of encoded polypeptides of wanting, a top chain that is complementary to human genome DNA's sequence of listing in the table VI by part DNA forms, i.e. " complementary top turning egg(s) white matter ", as by people such as Tramontano at Nucleic AcidsResearch, the 12nd phase, the 5049th～5059 page (1984) are described the same.

The present invention also comprises the pharmacology component: comprise as the due effective dose of medicine polypeptide product of the present invention, suitable thinner, assistant agent and/or carrier, this hemopoietin medicine can be used to treat disease, is specially adapted to the treatment of anemia and is suitable for treating the anemia that chronic nephropathy causes the most.

Polypeptide product of the present invention can be by the marker that can detect of covalent attachment by " mark (is for example used ¹²⁵The I radio-labeling), thus just provide a very useful reagent for the hemopoietin in calibrating and quantitative assay solid tissue and the liquid sample (as blood or urine).DNA product of the present invention also can be with the marker that can detect (for example radio isotope and non isotopic mark, as vitamin H) carry out mark, the crossover process that it is used for DNA generates the position of sok gene and/or any relevant gene family the mankind to determine short erythrocyte, in monkey and other Mammals maps the position.They can also be used to the disorder of the hemopoietin gene on the identification of dna level, and can be used as a kind of gene marker and be used to identify contiguous gene and their disorder.

Can see that by after so describing in detail the present invention has proposed some further very important improvement on methodology, it has improved method for surveying widely.Promptly can be in inhomogenous cell or viral sample to the specificity strand polynucleotide of a known array, and a plurality of strand polynucleotide detect, wherein:

(a) mixture of the strand polynucleotide probes of a kind of mark of preparation.It has the base sequence of even variation, and it is unique that each described probe all might be assumed to for the polynucleotide that will detect with another base sequence complementation, this base sequence specifically.

(b) sample is fixed on a kind of solid substrate,

(c) solid substrate that is fixed with sample is handled, with polynucleotide a little less than the alkali thereon further combined with, but thisly weaken combining of the polynucleotide sequence that do not comprise in the above-mentioned sample and probe.

(d) matrix that is fixed with sample and treated mistake contacts with the mixture of the probe of described mark only being easy under the condition of hybridizing between the whole complementary polynucleotide momently, and

(a) detect the specificity polynucleotide sequence, be by monitoring be present between the complete complementary probe in this specific specificity polynucleotide sequence and the above-mentioned label probe mixture hybridization and roughly.Label probe also has non-specificity to a certain degree to combine with matrix, and probe combines with complementation attached to the specificity polynucleotide on the matrix, radioactive substance is accumulated on the specificity polynucleotide, the radiation density here is more than the former height, thus, can prove and visited the specificity polynucleotide sequence.

This operation steps is using 64,128,256,512,1024 or more a plurality of mixing polynucleotide probes with 17 to 20 bases, carries out under the situation of DNA/DNA or RNA/RNA or DNA/RNA hybridization effective especially.

As described below, above mentioned improving one's methods illustrated the cDNA clone of the hemopoietin that can identify encodes originates from monkey in the gene library by exsanguine monkey-kidney cells mRNA preparation.Specifically, the probe mixture of the 20 different aggressiveness of 128 kinds of homogeneous that will prepare with the message of human hemopoietin sequence part is used in colony hybridization (the i.e. location hybridization) step.In 200,000 clones, identify 7 " positives " short erythrocyte with this way and generate rope cDNA clone.Be more significantly, use of the present invention improving one's methods, can in the plaque of 1,500,000 phage of forming the human genomic library, screen, promptly isolate 3 positive colonies.The finishing through further improvement and finish of this work: will above-mentionedly mention, 28 20 aggressiveness probe mixture and prepare by the amino acid analysis of the different continuous sequences of human hemopoietin second overlap 128 17 aggressiveness probes and use together and finish.

The process of above-mentioned explanation has been formed first known example: use in the multiple blended oligonucleotide probe DNA/DNA hybridization.So, can directly isolate mammiferous genomic clone.Said process has also been formed another known first example: the example that has used the mixture of the probe of being longer than 32 oligonucleotides in separating the cDNA clone.

After the detailed introduction of having read the back, professionals will clearly see the present invention on skill, relate to many aspect and much more extremely advantages are arranged.Following detailed description has been explained and put into practice situation of the present invention in present preferred example.

According to the present invention, isolated and qualitative encoding part or whole dna sequence dnas of hemopoietin (the being sometimes referred to as EPO in addition) peptide sequence of people and monkey.Furthermore, middle separation by the mankind or monkey obtains the theme that DNA has been used as eucaryon or prokaryotic expression, this expression provides the polypeptide of separable amount, this polypeptide show biology (for example immunology) character of natural EPO and in vivo with external EPO biologic activity.

The dna segment of monkey is to separate from the cDNA library of setting up with mRNA, and this mRNA obtains from the anemia monkey nephridial tissue that forms through chemical induction.And, the serum of suffering from this exsanguine monkey with immune analysis after, being considered to really include for normal monkey serum is high-caliber EPO.Contain the desired cDNA clone's of EPO coding DNA separation, by using the DNA/DNA clone hybridization to finish, 128 blended, radiolabeled have wherein been used, the oligonucleotide probe storehouse of 20 aggressiveness, and 200,000 clonal populations have promptly been screened.The design of oligonucleotide probe is that people EPO a small amount of sample is cut out fragment with enzyme earlier, measures its aminoacid sequence to the back.Last prepare probe according to the aminoacid sequence message that draws again.

People's dna segment is separated from the human genome DNA library.Separation to the clone that contains the EPO coding DNA, be to finish by the hybridization of DNA/DNA plaque, oligonucleotide probe storehouse and 128 radiolabeled 17 aggressiveness probe libraries of another group of one group 128 above-mentioned blended 20 aggressiveness have been used in work, and the nucleotide sequence of probe is to set up according to the message of the aminoacid sequence that is obtained from the different enzymatic fragments of people EPO.

Positive colony bacterium colony and plaque go check with the dideoxy sequence analysis (dideoxy Sequencing) of cloned DNA.The subgroup impurity elimination that is used in 16 sequences in the storehouse of 20 aggressiveness probes is earlier handed over, and again the clone who selects through hybridization is carried out nucleotide sequence analysis, the last primary structure conformation of again this result being selected to reason out its coded EPO polypeptide.The peptide sequence of being inferred has demonstrated high homology each other.And, this peptide species and by between the amino acid whose partial sequence of people EPO fragment high homology being arranged also.

A male monkey cdna clone who selects and a male people's gene group clone who selects are inserted into respectively in " a shuttling back and forth " dna vector, and amplification in intestinal bacteria (E.coli), are used for the cells of mamma animals of transfection tissue culture again.Transfection host cell under conditions of tissue culture, grow.At last, measure the medium supernatant preparation of tissue culture, estimated output is to contain the 3000 milliunit EPO that have an appointment in every milliliter of cultivation liquid.

Following example be used to illustrate of the present invention, particularly be used for being devoted to illustrating method therefor before the evaluation of coding monkey EPOcDNA clone and people EPO genomic clone, the result is such authentication method, sequence analysis, the method for the immunological test that the method for the foundation of expression system and the EPO in such system express etc.

Specifically, the embodiment I is about segmental amino acid sequence analysis of people EPO and the mixture of setting up the radiolabeled probe on the basis of this sequence results.Embodiment 2 usually is presented in the related process among the positive monkey cdna clone of identifying, thereby and provides the message of relevant treatment of animals and animal serum radioimmunoassay (RIA).Embodiment 3 has introduced about preparation cDNA library, colony hybridization screening, the message of the evaluation of positive colony, the dna sequence analysis of positive cDNA clone and generation monkey EPO polypeptide primary structure conformation aspect methods such as (aminoacid sequences).Embodiment 4 introduces the process pointing out to relate to, certain message, the process of plaque hybridization and the confirmation method of positive colony thereof or the like in relevant source about genomic library therewith in identifying the positive human genomic clone.Embodiment 5 instructs people that positive gene group clone is carried out sequential analysis, provides information, people EPO and the monkey EPO sequence message relatively of producing people EPO polypeptid acid sequence.Embodiment 6 has introduced the method for setting up a kind of carrier.Cut out from positive monkey cdna clone, the dna segment of coding EPO can be inserted in this carrier.Also introduced the concrete practice of the tissue culture growth of this carrier transfection COS-1 cell and transfectional cell.Embodiment 7 has introduced the method for setting up another kind of carrier.This carrier can allow the dna fragmentation of the coding EPO that cuts out from the positive human genomic clone to insert.And introduced cell, and the tissue culture growth process of transfectional cell with this carrier transfection COS-1.Embodiment 8 is the methods of carrying out immunoassay at the grown cultures supernatant liquor about to the transfectional cell from nuclear embodiment 6 and 7 tissue culture gained.Embodiment 9 is about embodiment 6 and 7 EPO through the microbial expression generation, the biologic activity of in vivo in external invitro and body.

Embodiment 10 is about being built in for monkey EPO cDNA and human gene group DNA, (CHO) that comprises Chinese hamster ovary cell, expression system in the mammals host is about the immunology of the product of these expression systems and biologic activity and to the description of the characteristic of these products.Embodiment 11 is the manufacture method about the gene of human EPO of the coding of manufacturing and EPO analogue, and it is codon preferably to expressing in intestinal bacteria (E.coli) and yeast host cell that this gene comprises some, and the expression system of setting up thereon.Embodiment 12 is about the immunology of the expressed product of embodiment 11 systems and the profile of biologic activity.

The embodiment I

A. the segmental amino acid sequencing of human EPO

Human EPO separates from urine, and through trypsin digestion, the result produces and isolate 17 separation fragments that are about 100～150 pmols.

Fragment is with specified number numbering and carry out sequential analysis with gas phase order instrument (Biosys Corp. provides) one by one, thereby draw their aminoacid sequence, the message of the relevant sequence that is provided is listed among the following table 1, wherein used single character, and with the residue that can't very clearly determine of " X " expression.

See Table I

The sequence analysis of table 1 fragment is T4a A-P-D-RT4b G-K-L-KT9 A-L-G-A-Q-KT13 V-L-E-RT16 A-V-S-G-L-RT18 L-F-RT21 K-L-F-RT25 Y-L-L-E-A-KT26a L-I-C-D-S-RT26b L-Y-T-G-E-A-C-RT27 T-I-T-A-D-T-F-RT28 E-A-I-S-P-P-D-A-A-M-A-A-P-L-RT30 E-A-E-X-I-T-T-G-X-A-E-H-X-S-L-N-E-X-I-T-V-PT31 V-Y-S-N-F-L-RT33 S-L-T-T-L-L-RT35 V-N-F-Y-A-W-KT38 G-Q-A-L-L-V-X-S-S-Q-P-W-E-P-L-Q-L-H-V-D-K as a result

B. the design of oligonucleotide probe mixture and manufacturing

Listed aminoacid sequence is checked by the upper and lower relation with the merger of genetic code in the table 1, and purpose is whether the method that will determine mixed probe can be used for the DNA/DNA crossover process on cDNA and/or genome dna library.This analysis has disclosed and existed a series of sequences (Val-Asn-Phe-Tyr-Ala-Trp-Lys) with 7 amino-acid residues in the T35 fragment, and this may be a kind of feature.Promptly by have 20 base pairs, with the coded product of a kind of sequence in 128 kinds of probe complementary, the possible dna sequence dna exclusive a kind of feature.128 20 monomer oligonucleotides of first cover are with standard phosphoamide method synthetic.(for example seeing people such as Beaucage, Tetrahedron Letters, the 20th phase, the 1859th～1862 (1981)) more concrete slightly say, then be by sequence listed in the table 2, synthetic on solid support.

Table 2 residue-Val-Ash Phe Tyr Ala TrP Lys3 ' CAA TTG AAG ATG CGA ACC TT-5 '

T A A A T

G G

C C

Further analyze and disclose in the T38 fragment, exist a series of 6 amino-acid residues (Gln-Pro-Trp-Glu-Pro-Leu).Based on this message, people might prepare one and be with 128 mixing oligonucleotide 17 monomeric probe libraries by listed aminoacid sequence in the table 3.

Table 3 residue-Gln Pro TrP Glu Pro Leu3 ' GTT GGA ACC CTT GGA GA-5 '

C T C T A

G G

C C

Oligonucleotide probe under T4 polynucleotide kinase (NEN) catalysis in 5 ' end r- ³²P-ATP, (7500-8000 residence/mmole) (ICN) carry out mark.

Embodiment 2

A. treating processes of monkey and radioimmunoassay (RIA) are analyzed

Female cynomolgus monkey (Macaca fascicu larias) (2.5～3 kilograms, 1.5～2 years old) carries out on the 1st, 3 and 5 with the phenylhydrazine hydrochloride solution of pH7.0.Subcutaneous treatment, used dosage are 125 milligrams/kilogram.Before per injection, all to measure hematocrit.The 7th day or when hematocrit levels drop to original level 25% below whenever, inject ketamine hydrochloride (Kete mine hydro chloride) by 25 milligrams/kilogram dosage, gather in the crops blood plasma and kidney then.Cutting is freezing and be stored in-70 ℃ with liquid nitrogen immediately.

The radioimmunoassay of B.EPO

The radioimmunoassay that is used for quantitatively detecting sample EPO is to be undertaken by following process:

A kind of standard or unknown hemopoietin sample is incubated 2 hours with antiserum(antisera) at 37 ℃.After 2 hours insulation, sample hose is placed on cooled on ice, add and use ¹²⁵The short blood red born of the same parents of I mark generate element, and pipe was being placed 15 hours at 0 ℃ at least.The reaction mixture that 500 microlitres are arranged in each analyzer tube, the consisting of of reaction mixture: the immune serum of 50 microlitres dilution, 10000 cpm ¹²⁵The hemopoietin of I mark, the standard EPO of 5 microlitre Trypsin inhibitor,Trasylols (trasylol) and 0～250 microlitre or unknown EPO sample, and adding contains 0.1% bovine serum; It all is 500 microlitres that the phosphate buffer solution (PBS) of albumen (BSA) adds to reaction volume.Used antiserum(antisera) be from and 1% pure people urinate the immunity of hemopoietin preparation rabbit emit the serum that is separated to the blood for the second time.The initial antiserum(antisera) diluent that is used to analyze is through adjusting like this: promptly link to each other with antibody ¹²⁵The EPO of I mark is no more than 10～20% of total admixture.Generally speaking, this just is equivalent to 1: 50000 to 1: 100000 final antiserum(antisera) diluent.

Link to each other with antiserum(antisera) ¹²⁵The hemopoietin of I mark is sedimentary with adding 150 microlitre Staph A, after cultivating in 40 minutes, carry out centrifugal to sample, the bead that centrifugation is come out contains 0.15 mole of NaCl with 0.75 milliliter again, and the Tris-Hcl of the pH8.2 of 2 mmole ethylenediamine tetraacetic acid (EDTA)s (EDTA) and 0.05% trotyl (Triton) X-100 washes twice.Bead after the cleaning is counted in r (an ancient woman's ornament agate) counter, combines determining ¹²⁵I-the percentage ratio of hemopoietin.To before counting deduct immunity the total value, be attached on the serum counting with nuclear just, remove the radiocounting that those nonspecific precipitations cause, the content of the hemopoietin of unknown sample is by comparing with typical curve and determine measuring data.

Above process is used for the monkey serum that obtained with above-mentioned A, equally also can be used on the untreated monkey serum.Normal serum level generally contains by analysis and is approximately 36 milliunit/milliliters, and the monkey serum of handling contains 1000 to 1700 milliunit/milliliters.

Example 3

A. the foundation in monkey cdna library

Messenger RNA(mRNA) is separated from normal and exsanguine monkey kidney, usefulness be people such as Chirgwin, Biochemistry, the 18th phase, the method for the sulphur cyanoguanidine of the 5294th page (1979), and polyadenylic acid (A) ⁺MRNA separates with twice oligomerization (dT)-Mierocrystalline cellulose chromatography, as people such as Maniatis in that " molecular cloning, it is described like that to test the 197th～198 page of (" Molecular cloning, ALaboratoryManual ") in chamber handbook one book (cold spring harbor laboratory; cold spring port; New York, 1982, (coldSprings Harbor Laboratory; Cold Springs; Harbor, N.Y., 1982)).The cDNA library is according to people such as Okayama, and in molecule and cytobiology (mol andcell Biol) the 2nd phase, the 161st～170 page (1982) are gone up the method for the general process of the modification of introducing and set up.Now the key characteristic of optimal process is for down: (1) puc 8 is used as unique carrier, shears with Pst I enzyme, the oligomerization dT tail end that to connect a length then be the 60-80 base; (2) use Hinc II enzymolysis, oligomerization dT tail is gone from an end-grain cutting of carrier; (3) tail end synthetic and connection oligomerization dG of article one chain is to remove according to the end that the process of having delivered is carried out; (4) remove oligomerization dG tail with Bam H I enzymolysis from an end of this carrier; And (5) to replace the RNA chain with DNA be to carry out under the excessive situation that is three times in those carriers that have oligomerization dG afterbody of the content of two kinds of connexons (GATCTAAAGACCGTCCCCCCCCC and ACGGTCTTTA).

B. screen the crossover process of clone's bacterium colony in monkey cdna library,

It is to have on the culture medium flat plate of 9000 bacterium colonies on per 10 * 10 centimetres that the intestinal bacteria (E.Coli) that transformed are coated density, and this flat board is cultivated and is paved into by containing the nutraceutical agar of 50 micrograms penbritin/milliliter.Genescreen filter membrane (NewEngland Nuclear catalog No.NEF-972) is in advance prior to BH I-CAM plate (Bacto brain heart leach liquor 37 grams per liters, casamino acids (Casamino acid) 2 grams per liters and agar 15 grams per liters, contain 500 micrograms paraxin/milliliter) upward wetting, be used to then bacterium colony is taken off on flat board.Bacterium colony earlier in same substratum again continued growth 12 hours or longer time with the quantity of amplification plasmid.The bacterium colony (bacterium colony top) that has increased is then handled with a series of filter membranes that are placed on 3 millimeters filter paper of two Wha tman again, and paper soaked into one by one with following each solution:

(1) 50 mmole glucose---25 mmole Tris-Hcl (pH8.0)-10 mmole ethylenediamine tetraacetic acid (EDTA)s (EDTA) (pH8.0) 5 minutes;

(2) 0.5 moles of NaOH, 10 minutes; And

(3) 10 moles of Tris-Hcl (pH7.5) three minutes.

Then filter membrane is placed in the vacuum drier, carried out drying in 2 hours in 80 ℃ of bakings.

Then, filter membrane is used Proteinase K (Proteinase K) digestion again, to remove the protein in the bacterium colony.This digestive process is that the concentration of carrying out in damping fluid K is that (Pro tease enzyme solution is in 0.1 mole of Tris-Hcl (pH8.0)-0.15 mole of Nacl-10 mmole EDTA (pH8.2)-0.2%SDS for the proteolytic enzyme of 50 mcg/ml.Should be specifically noted that: on each filter membrane, add 5 milliliters solution, enzymolysis was carried out 30 minutes at 55 ℃, remove solution after the enzymolysis.

Then, the filter membrane pre-treatment of hybridizing with 4 milliliters of prehybridization damping fluids (5 * SSPE-0.5%SDS-100 microgram SS e. coli dna/milliliter).Processing before the hybridization is carried out at 55 ℃, is generally 4 hours or longer, after this removes the damping fluid that removes prehybridization.

Crossover process is carried out in the following manner: add 3 milliliters of hybridization buffers (5 * SSPE-0.5%SDS-100 microgram yeast tRNA/ milliliter) on each filter membrane, 128 portions of above-mentioned damping fluids, wherein each part contains a kind of sequence of 128 probes in the table 2, the content of probe in above-mentioned damping fluid is 0.025 pmol (whole mixtures is named the mixture for EPV), then filter membrane is placed on 48 ℃ and keeps 20 hours.This temperature is also to hang down 2 ℃ than the minimum dissociation temperature (Td) that calculates that any probe is determined.

After hybridization, filter membrane is at room temperature washed 3 times with 6 * SSC-0.1%SDS in the vibration water bath with thermostatic control, and each 10 minutes, and again under hybridization temperature (48 ℃), wash 2 to 3 times with 6 * SSC-1%SDS.

Filter membrane is carried out radioactive automatic developing, and autoradiographic result points out in 200,000 screened bacterium colonies 7 positive bacterium colonies are arranged.In order further to examine push away one (naming to cloning 83) thinking in 7 positive bacterium colonies that contain monkey cdna that two aspects are found carried out people such as homing sequence analysis employing Wallace, Gene, the improved method of the 16th phase, the 21st～26 page (1981).In brief, become linear molecule with the hybrid plasmid DNA that obtains among the monkey cdna clone 83 with EcoR I enzymolysis, heating two strands that become separately that dissociate are published in the 74th phase of P.N.A.S. (U.S.A.) with people such as Sanger again in boiling water bath again, and the dideoxy methods analyst of the 5463rd～5467 page (1977) determines that the nucleotide sequence of homing sequence uses a subgroup (SUbset) in the EPV mixture of the probe of being made up of 16 sequences as the introduction of serial response.

C. the sequential analysis of monkey EPOcDNA

Clone 83 nucleotide sequence analysis is to use Messing, Methoel inEnzymology, and the 101st phase, the method for the 20th～78 page (1983) is carried out.Table provides in the IV is EcoR I/Hind III clone's of about 1600 base pairs of clone 83 the preliminary restriction enzyme enzymolysis analysis chart spectrum of fragment.The zone of estimating the recognition site place of restriction endonuclease is the ECOR I site from some fragment 3 ' base to 5 ' end.The sequential analysis of the Nucleotide of cDNA is to finish by the sequential analysis of overlapped restriction enzyme enzymatic fragment being carried out one by one fragment respectively.For example, by to being defined as C ₁₁₃(Sau3A～111/Sma I～324), segment analyze, and one named be C ₇₃The fragment of (ALu I～424/BstE II～203) carries out the sequential analysis of reverse preface, and comprehensive above two results have drawn the sequential analysis message about an eclipsed nucleotide sequence.

The position Alu I 1072Alu I 1115Alu I 1223Pst I 1301Rsa I 1343Alu I 1384Hind III 1449Alu I 1450Hind III 1585 that the recognition site of the position EcoR I 1Sau3A 111Sma I 180BstE II 203Sma I 324Kpn I 371Rsa I 372Alu I 424pst I 426Alu I 430Hpa I 466Alu I 546Pst I 601Pvu II 604Alu I 605Alu I 782Alu I 788Rsa I 792pst I 807Alu I 841Alu I 927Nco I 946Sau3A 1014 continuous upper table restriction enzymes that the recognition site of table IV restriction enzyme is estimated is estimated

The sequence (within 3 ' site to the EoR I site and Hind III site of Sau 3A) of nearly 1342 base pairs is carried out sequential analysis and to the analysis of all possible deciphering framework, the message of DNA and aminoacid sequence can have been listed in the table V.In the table V, the position of the initial amino acid of the identification of the amino terminal of ripe EPO (being determined by the mutual relationship of the sequential analysis of itself and foregoing 20 amino terminal residues) is decided to be+1 place, single-minded in the ATG of methionine(Met) codon (27).Be positioned at " top " of initial amino-terminal end alanine residue, the 1st residue of determining as the aminoacid sequence of mature protein, its existence shows to have such a case, be that EPO is expressed as a kind of precursor forms at the beginning in tenuigenin, comprise one 27 amino acid " guide " district, this leading peptide part is when EPO is ripe, and ripe EPO is sheared before entering circulation.In polypeptide, the potential glycosylation site is specified by asterisk.The molecular weight of estimating the translation district is 21117 dalton, and the molecular weight of 165 residues of the sophisticated EPO polypeptide of composition monkey is 18236 dalton.

See Table V

The translation Sau3AGATCCCGCGCCCCCTGGACAGCCGCCCTCTCCTCCAGGCCCGTGGGGCTGG CCCTGCCCCGCTGAACTTCCCGGGATGAGGACTCCCGGTGTGGTCACCGCGCGCCT AGGTCGCTGAG of table V monkey EPO CDNA

-27 -20

Met?Gly?Val?His?Glu?Cys?Pro?Ala?TrpGGACCCCGGCCAGGCGCGGAGATG?GGG?GTG?CAC?GAA?TGT?CCT?GCC?TGG

-10Leu?Trp?Leu?Leu?Leu?Ser?Leu?Val?Ser?Leu?Pro?Leu?Gly?Leu?ProCTG?TGG?CTT?CTC?CTG?TCT?CTC?GTG?TCG?CTC?CCT?CTG?GGC?CTC?CCA

-1 +1 10Val?Pro?Gly?Ala?Pro?Pro?Arg?Leu?Ile?Cys?Asp?Ser?Arg?Val?LeuGTC?CCG?GGC?GCC?CCA?CCA?CGC?CTC?ATC?TGT?GAC?AGC?CGA?GTC?CTG

20 *Glu?Arg?Tyr?Leu?Leu?Glu?Ala?Lys?Glu?Ala?Glu?Asn?Val?Thr?MetGAG?AGG?TAC?CTC?TTG?GAG?GCC?AAG?GAG?GCC?GAG?AAT?GTC?ACG?ATG

30 * 40Gly Cys Ser Glu Ser Cys Ser Leu Asn Glu Asn Ile Thr Val ProGGC TGT TCC GAA AGC TGC AGC TTG AAT GAG AAT ATC ACC GTC CCA show V (continuing)

50Asp?Thr?Lys?Val?Asn?Phe?Tyr?Ala?Trp?Lys?Arg?Met?Glu?Val?GlyGAC?ACC?AAA?GTT?AAC?TTC?TAT?GCC?TGG?AAG?AGG?ATG?GAG?GTC?GGG

60 70Gln?Gln?Ala?Val?Glu?Val?Trp?Gln?Gly?Leu?Ala?Leu?Leu?Ser?GluCAG?CAG?GCT?GTA?GAA?GTC?TGG?CAG?GGC?CTG?GCC?CTG?CTC?TCA?GAA

80 *Ala?Val?Leu?Arg?Gly?Gln?Ala?Val?Leu?Ala?Asn?Ser?Ser?Gln?ProGCT?GTC?CTG?CGG?GGC?CAG?GCC?GTG?TTG?GCC?AAC?TCT?TCC?CAG?CCT

90 100Phe?Glu?Pro?Leu?Gln?Leu?His?Met?Asp?Lys?Ala?Ile?Ser?Gly?LeuTTC?GAG?CCC?CTG?CAG?CTG?CAC?ATG?GAT?AAA?GCC?ATC?AGT?GGC?CTT

110Arg?Ser?Ile?Thr?Thr?Leu?Leu?Arg?Ala?Leu?Gly?Ala?Gln?Glu?AlaCGC?AGC?ATC?ACC?ACT?CTG?CTT?CGG?GCG?CTG?GGA?GCC?CAG?GAA?GCC

120 130Ile?Ser?Leu?Pro?Asp?Ala?Ala?Ser?Ala?Ala?Pro?Leu?Arg?Thr?IleATC?TCC?CTC?CCA?GAT?GCG?GCC?TCG?GCT?GCT?CCA?CTC?CGA?ACC?ATC

140Thr Ala Asp Thr Phe Cys Lys Leu Phe Arg Val Tyr Ser Ash PheACT GCT GAC ACT TTC TGC AAA CTC TTC CGA GTC TAC TCC AAT TTC shows V (continuing)

150 160Leu?Arg?Gly?Lys?Leu?Lys?Leu?Tyr?Thr?Gly?Glu?Ala?Cys?Arg?ArgCTC?CGG?GGA?AAG?CTG?AAG?CTG?TAC?ACG?GGG?GAG?GCC?TGC?AGG?AGA

165Gly?Asp?Arg?OPGGG?GAC?AGA?TGA?CCAGGTGCGTCCAGCTGGGCACATCCACCACCTCCCTCACCAACACTGCCTGTGCCACACCCTCCCTCACCACTCCCGAACCCCATCGAGGGGCTCTCAGCTAAGCGCCAGCCTGTCCCATGGACACTCCAGTGCCAGCAATGACATCTCAGGGGCCAGAGGAACTGTCCAGAGCACAACTCTGAGATCTAAGGATGTCGCAGGGCCAACTTGAGGGCCCAGAGCAGGAAGCATTCAGAGAGCAGCTTTAAACTCAGGAGCAGAGACAATGCAGGGAAAACACCTGAGCTCACTCGGCCACCTGCAAAATTTGATGCAGGACACGCTTTGGAGGCAATTTACCTGTTTTTGCACCTACCATCAGGGACAGGATGACTGGAGAACTTAGGTGGCAAGCTGTGACTTCTCAAGGCCTCACGGGCACTCCCTTGGTGGCAAGAGCCCCCTTGACACTGAGAGAATATTTTGCAATCTGCAGCAGGAAAAATTACGGACAGGTTTTGGAGGTTGGAGGGTACTTGACAGGTGTGTGGGGAAGCAGGGCGGTAGGGGTGGAGCTGGGATGCGAGTGAGAACCGTGAAGACAGGATGGGGGCTGGCCTCTGGTTCTCGTGGGGTCCAAGCTT

HindⅢ

The peptide sequence of table V can be used to analyze at an easy rate to be had the highly-hydrophilic district and secondary conformational characteristic district is arranged for the potential height causes immune zone.Used method is, people such as Hopp for example, P.N.A.S (U.S.A), the 78th phase, the 3824th～3828 page (1981), people such as Kyte, J, Mol.Biol., the 157th phase, people such as the 105th～132 page (1982) and/or Chou, Biochem, the 13rd phase, the 222nd～245 page (1974) and AdVances in Ensymology, the 47th phase, the 45th～47 page (1978).Computer-aided analysis according to people's methods such as Hopp is an available, has used a program of being appointed as PEP the 6.7th reference section (Reference Secton), and it is by California, Palo, Alto, No. 124, university street, Intelligenetcs, Inc provides.

Embodiment 4

A. human genomic library

According to people such as Lawn, Cell, the 18th phase, the method for the 533rd～543 page (1979) has obtained the phage Ch4A gene library that carries human foetus's liver gene group of preparation, and in store to be used for the plaque hybridization analysis.

B. for screening human genomic library's plaque hybridization step.

If the solution phage particle is not used in the Gene Screen Plus (New England NuclearCatolog No NEF-976) and NZYAM plate (Nacl 5 grams of genescreen; Mgcl ₂-6H ₂O ₂Gram; Nz-amine A (Nz-Amine) 10 grams; Yeast extract, 5 grams; Casein hydrolysate Casamjno acids, 2 grams; Maltose, 2 grams; Agar 15 grams/every liter).According to Woo, Methool InEncymolegy, the way of the 68th phase the 389th～395 page (1979), some DNA are fixed on the filter membrane (has 50000 plaques) on each filter membrane

Again in 80 ℃ of bakings 1 hour, press embodiment 3 at the filter membrane of air drying then, the described way of B part is carried out enzymolysis with Proteinase K (PsoteinaseK).Hybridization pre-treatment (promptly giving processing, down together) is with 1 mole of NaCl, and the 1%SDS damping fluid carried out 4 hours or the longer time at 55 ℃, removed damping fluid then.Situation after hybridization and the hybridization is undertaken by the described step of embodiment 3B part.128 the 17 monomer probe mixture that quilt is named to the mixture of 128 the 20 monomer probes of EPV and (by naming the mixture for EPQ) table III all are used for hybridizing.Carry out at 48 ℃ with EPV probe mixture hybridization.Hybridization with the EPO probe mixture is to carry out at 46 ℃, and this temperature is the temperature of also hanging down 4 degree than the minimum calculated value of each member Td in the EPQ mixture.Can preserve the probe of hybridizing in order to hybridize once more, it is placed on seethes with excitement among 1 * SSC-0.1%SDS next time promptly can reuse in 2 minutes.The radioactive automatic developing of filter membrane has disclosed 1,500, in the phage plaque of 000 screening, 3 positive colonies (all reacting with two kinds of probe mixture) is arranged.To the proof of positive colony of coding EPO, be by to the monkey cdna of embodiment 3 electron microscopy observation to inhomogenous duplex structure arranged and carry out dna sequence analysis and obtain.This process gives the evidence that multiple intron is arranged in genomic dna sequence.

Embodiment 5

A positive colony (naming the hEl for λ) has been carried out nucleotide sequence analysis, present obtain the results are shown in the table VI.

See Table VI

Table VI AAGCTTCTGGGCTTCCAGACCCAGCTACTTTGCGGAACTCAGCAACCCAGGCATCT CTGAGTCTCCGCCCAAGACCGGGATGCCCCCCAGGGGAGGTGTCCGGGAGCCCAGC CTTTCCCAGATAGCACGCTCCGCCAGTCCCAAGGGTGCGCAACCGGCTGCACTCCC CTCCCGCGACCCAGGGCCCGGGAGCAGCCCCCATGACCCACACGCACGTCTGCAGC AGCCCCGCTCACGCCCCGGCGAGCCTCAACCCAGGCGTCCTGCCCCTGCTCTGACC CCGGGTGGCCCCTACCCCTGGCGACCCCTCACGCACACAGCCTCTCCCCCACCCCC ACCCGCGCACGCACACATGCAGATAACAGCCCCGACCCCCGGCCAGAGCCGXAGAG TCCCTGGGCCACCCCGGCCGCTCGCCTGCCGCTGCGCCGCACCGCGCTGTCCTCCC GGAGCCGGACCGGGGCCACCGCGCCCXGCTCTGCTCCGACACCGCGCCCCTTGGAC AGCCGCCCTCTCCTCTAGGCCCGTGGGGCTGGCCCTGCACCGCCGAGCTTCCCGGG ATGAGGXX

-27 -24

Met Gly Val HisCCCGGTGACCGGCGCGCCCCAAGTCGCTGAGGGACCCCGGCCAAGCGCGGAG ATG GGG GTG CAC GGTGAGTACTCGCGGGCTGGGCGCTCCCGGCGGCCGGGTTCCTGTTTGAGCGGGGA TTTAGCGCCCCGGCT table VI (continuing) ATTGGCCAAGAGGTGGCTGGGTTCAAGGACCGGCGACTTGTCAAGGACCCCGGAAG GGGGAGGGGGGTGGGGCAGCCTCCACGTGCCGCGGGGACTTGGGGGAGTTCTTGGG GATGGCAAAAACCTGGCCTGTTGAGGGGCACAGTTTGGGGTTGGGGAGGAGGTTTG GGGTTCTGCTGTGCAGTTGTGTCGTTGTCAGTGTCTCG[I.S.] TTGCACACGCACAGATCAATAAGCCAGAGGCAGCACCTGAGTGCTTGCATGGTTGG GACAGGAAGGACGAGCTGGGGCAGAGACGTGGGGATGAAGGAAGCTGTCCTTCCAC AGCCACCCTTCTCCCCCCCCGCCTGACTCT

-23 -20

Glu?Cys?Pro?Ala?Trp?Leu?Trp?Leu?Leu?Leu?Ser?LeuCAGCCTGGCTATCTGTTCTAG AA?TGT?CCT?GCC?TGG?CTG?TGG?CTT?CTC?CTG?TCC?CTG

-10 -1 +1Leu?Ser?Leu?Pro?Leu?Gly?Leu?Pro?Val?Leu?Gly?Ala?Pro?Pro?Arg?Leu?Ile?CysCTG?TCG?CTC?CCT?CTG?GGC?CTC?CCA?GTC?CTG?GGC?GCC?CCA?CCA?CGC?CTC?ATC?TGT

10 20 * Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu Ala Glu Asn IleGAC AGC CGA GTC CTG GAG AGG TAC CTC TTG GAG GCC AAG GAG GCC GAG AAT ATC26ThrACG GTGAGACCCCTTCCCCAGCACATTCCACAGAACTCACGCTCAGGGCTTCAGGGAAC TCCTCCCAGATCCAGGAACCTGGCACTTGGTTTGGGGTGGAGTTGGGAAGCTAGAC ACTGCCCCCCTACATAAGAATAAGTC table VI (continuing) TGGTGGCCCCAAACCATACCTGAAACTAGGCAAGGAGCAAAGCCAGCAGATCCTAC GCCTGTGGGCCAGGG

27 30

Thr?Gly?Cys?Ala?GluCCAGAGCCTTCAGGGACCCTTGACTCCCCGGGCTGTGTGCATTTCAG ACG?GGC?TGT?GCT?GAA

* 40His Cys Ser Leu Ash Glu Ash Ile Thr Val Pro Asp Thr Lys Val Ash Phe TyrCAC TGC AGC TTG AAT GAG AAT ATC ACT GTC CCA GAC ACC AAA GTT AAT TTC TAT50 55Ala Trp Lys Arg Met GluGCC TGG AAG AGG ATG GAG GTGAGTTCCTTTTTTTTTTTTTTTCCTTTCTTTTGGAGAATCTCATTTGCGAGCCTGATTTTGGATGAAAGGGAGAATGATCGGGGGAAAGGTAAAATGGAGCAGCAGAGATGAGGCTGCCTGGGCGCAGAGGCTCACGTCTATAATCCCAGGCTGAGATGGCCGAGATGGGAGAATTGCTTGAGCCCTGGAGTTTCAGACCAACCTAGGCAGCATAGTGAGATCCCCCATCTCTACAAACATTTAAAAAAATTAGTCAGGTGAAGTGGTGCATGGTGGTAGTCCCAGATATTTGGAAGGCTGAGGCGGGAGGATCGCTTGAGCCCAGGAATTTGAGGCTGCAGTGAGCTGTGATCACACCACTGCACTCCAGCCTCAGTGACAGAGTGAGGCCCTGTCTCAⅥ ( ) AAAAAGAAAAGAAAAAAGAAAAATAATGAGGGCTGTATGGAATACATTCATTATTCATTCACTCACTCACTCACTCATTCATTCATTCATTCATTCAACAAGTCTTATTGCATACCTTCTGTTTGCTCAGCTTGGTGCTTGGGGCTGCTGAGGGGCAGGAGGGAGAGGGTGACATGGGTCAGCTCGACTCCCAGAGTCCACTCCCTGTAG56 60 70Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu Leu Ser Glu AlaGTC GGG CAG CAG GCC GTA GAA GTC TGG CAG GGC CTG GCC CTG CTG TCG GAA GCT

80 * 90Val?Leu?Arg?Gly?Gln?Ala?Leu?Leu?Val?Ash?Ser?Ser?Gln?Pro?Trp?Glu?Pro?LeuGTC?CTG?CGG?GGC?CAG?GCC?CTG?TTG?GTC?AAC?TCT?TCC?CAG?CCG?TGG?GAG?CCC?CTG

100Gln?Leu?His?Val?Asp?Lys?Ala?Val?Ser?Gly?Leu?Arg?Ser?Leu?Thr?Thr?Leu?LeuCAG?CTG?CAT?GTG?GAT?AAA?GCC?GTC?AGT?GGC?CTT?CGC?AGC?CTC?ACC?ACT?CTG?CTT110 115Arg?Ala?Leu?Gly?Ala?GlnCGG?GCT?CTG?GGA?GCC?CAG?GTGAGTAGGAGCGGACACTTCTGCTTGCCCTTTCTGTAAGAAGGGGAGAAGGGTCTTGCTAAGGAGTACAGGAACTGTCCGTATTCCTTCCCTTTCTGTGGCACTGCAGCGACCTCCT

116 120

Lys Glu Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala AlaGTTTTCTCCTTGGCAG AAG GAA GCC ATC TCC CCT CCA GAT GCG GCC TCA GCT GCT shows VI (continuing)

130 140Pro?Leu?Arg?Thr?Ile?Thr?Ala?Asp?Thr?Phe?Arg?Lys?Leu?Phe?Arg?Val?Tyr?SerCCA?CTC?CGA?ACA?ATC?ACT?GCT?GAC?ACT?TTC?CGC?AAA?CTC?TTC?CGA?GTC?TAC?TCC

150 160Asn?Phe?Leu?Arg?Gly?Lys?Leu?Lys?Leu?Tyr?Thr?Gly?Glu?Ala?Cys?Arg?Thr?GlyAAT?TTC?CTC?CGG?GGA?AAG?CTG?AAG?CTG?TAC?ACA?GGG?GAG?GCC?TGC?AGG?ACA?GGG

166Asp?Arg?OPGAC?AGA?TGA?CCAGGTGTGTCCACCTGGGCATATCCACCACCTCCCTCACCAACATTGCTTGTGCCACACCCTCCCCCGCCACTCCTGAACCCCGTCGAGGGGCTCTCAGCTCAGCGCCAGCCTGTCCCATGGACACTCCAGTGCCAGCAATGACATCTCAGGGGCCAGAGGAACTGTCCAGAGAGCAACTCTGAGATCTAAGGATGTCACAGGGCCAACTTGAAGGGCCCAGAGCAGGAAGCATTCAGAGAGCAGCTTTAAACTCAGGGACAGAGCCATGCTGGGAAGACGCCTGAGCTCACTCGGCACCCTGCAAAATTTGATGCCAGGACACGCTTTGGAGGCGATTTACCTGTTTTCGCACCTACCATCAGGGACAGGATGACCTGGAGAACTTAGGTGGCAAGCTGTGACTTCTCCAGGTCTCACGGGCATGGGCACTCCCTTGGTGGCAAGAGCCCCCTTGACACCGGGGTGGTGGGAACCATGAAGACAXGATXGGGGCTGGCCTCTGGCTCTCATGGGGTCCAAGTTTTGTGTATTCTCAACCTATTGACAGACTGAAACACAATATGAC

In the table VI, beginning, continuous DNA sequence shown the top strand part of one 620 base, is that before the translation district that abuts against people EPO gene obviously is the sequence that is not translated.Specifically, this sequence occurs, 5 ' end of constitutive gene, this section sequence causes forming the interpretable DNA district of a kind of leading peptide of being made up of four amino acid (27 to-24) (" Presequeuce " presequence), 4 base pairs in the sequence before coding is guided in top are not also determined like clockwork, thereby are represented with " X ".Then then about 639 base pairs in be contained in that (its 439 base pairs have been measured nucleotide sequence, 200 remaining base pairs are called as " I.S. "), it just before the codon of a glutamine ,-23 residues of the polypeptide that this glutamine is considered to translate.And then first exon is arranged, it be considered to from an alanine residue (be appointed as sophisticated people EPO aminoacid sequence+the I residue) codon to single-minded on+26 this section of Threonine codon sequence, the back connects second intron by 256 based compositions again.Behind second intron, 2 exons are arranged, its 55th amino-acid residue of 27-of encoding.Subsequently, again by the 3rd intron of forming by 612 base pairs.From 56 to 115 the amino-acid residue of the 3rd exons coding people EPO after the 3rd intron.And begun the 4th intron that contains 134 base pairs.Following after the 4th intron, is the 4th exon and " stopping " codon (TGA) of 116 to No. 166 amino-acid residues of a coding.At last, the table VI has been pointed out the sequence of 568 base pairs, and being shown as this section sequence is the 3 ＇ districts that do not translate at people EPO gene, and what Nucleotide its two base pair of (" X ") is not also determined to be like clockwork.

Like this, the table VI has pointed out to include the primary structure conformation (amino-acid sequence) (estimate its molecular weight be 18399) of 166 specificity amino-acid residues at interior sophisticated people HPO.In this table, also disclosed a dna sequence dna, it one have 5 ' and the leader of 27 amino-acid residues of coding of 3 ' dna sequence dna, this section sequence may be very important for the function of the promoter/regulon in the operon of people's gene.The possible glycosylation position of sophisticated people EPO polypeptide is indicated by asterisk in table.It should be noted that the specificity aminoacid sequence in the table VI, very similar to the natural equipotential form of forming people's hemopoietin.Support the fact of this point, be from by persistence isolated people's hemopoietin the urine being carried out finding among the result of sequential analysis, it is found that the molecule that a large number of hemopoietin is wherein arranged all has a methionine(Met) No. 126 residue position, as the table described in relative with Serine.

Below the table VII, the homology degree of the EPO peptide sequence of people's EPO peptide sequence and monkey has been described.In the continuous lines of table middle and upper part, single letter is the representative that is used for the inferring sequence since the translation polypeptide of the people EPO of 27 residues, and the continuous lines of bottom shows the sequence since the monkey EPO polypeptide of 27 residues of deduction.With the important homology sequence of asterisk representative.Should be noted in the discussion above that the comparison of the EPO sequence of people that inference is come out and monkey, having exposed has " extra " Methionin (K) residue on 116 (mankind).Mutually with reference to indicating, this residue is to be on the edge that awaits montage junction (SPlice junction) in the sequence that pushes away the coding MRNA that recognizes in the genome with the table VI.In the human polypeptides sequence, exist a lysine residue, again by the sequential analysis of people's C DNA cloning is further confirmed, this clone uses that isolated MRNA prepares from the COS-I cell that the human gene group DNA the following embodiment 7 has been transformed.

See Table 7

Embodiment 6

Choosing is used to begin to attempt the expression system by the EPO peptide material that separable amount is arranged of the monkey CDNA that process the provided coding of the synthetic embodiment 3 of microorganism, it is a kind of expression system that is related to mammals host cell (be COS-I cell, U.S.'s culture model is collected center (A.T.C.C) CRL-1650 number).This cell adopt can (by existing the PBR322-derived dna) and mammals host (by existing the viral derived dna of SV40) duplicate automatically in escherichia coli host " shuttling back and forth " carrier carry out transfection.

The comparison of the EPO polypeptide of the table VII mankind and monkey

Specifically, this expression vector is by following process preparation.Clone's 83 plasmids that embodiment 3 provides are exaggerated in intestinal bacteria (E.COli), and via ECOR I and Hind III enzymolysis, are separated to the monkey EPO coding DNA that is approximately 1.4Kb.Be separated to Hind III/Sal I fragment of the PBR322 that is approximately 4.0Kb in addition.From M13mp10RFDNA (P and L laboratory), isolate (LinKer) fragment of ECOR I/Sal I " connexon " that is approximately 30bP.This connexon comprises, says in order, and an ECOR I sticky end then is the Sst I, Sma I, BamH I and Xba I recognition site and a Sal I sticky end.Above-mentioned 3 fragments are coupled together, obtain a plasmid intermediate (" pERS ") that is approximately 5.4Kb, the side of EPODNA wherein is against a useful restriction endonuclease recognition site " storehouse ".With Hind III and Sal I pERS is carried out enzymolysis then, the connexon that obtains EPO DNA and arrive Sal I (M13mP10) with the ECOR I.The fragment of 1.4Kb is gone to interconnect with the sequence of BamH I/Sal I of about 40Kb of PBR322 and rf (RF) the fragment connexon of M13mP10Hind III/BamH I that another also contains the 30bP that has an appointment.The segmental characteristics of M13 connexon are that a Hind III sticky end is arranged.The Pst I is then arranged, Sal I, Xba I recognition site and a BamH I sticky end.The product of this connection is a useful plasmid intermediate (" pBR-EPO ") once again: in the storehouse, all restricted property site, both sides of EPODNA.

Selection is used for carrying out the carrier (" PDSVLI ") that EPO DNA expresses and builds up in advance in the COS-1 cell, it can duplicate and artificial selection in intestinal bacteria (E COli) automatically.These features are owing to replication orgin is arranged and have the ampicillin resistance gene dna sequence dna that exists the Nucleotide zone from 2448 to 4362 of pBR322 to provide.This sequence has been owing to inserted a connexon and modified on the structure, this connexon provide one before it merges to carrier with regard to existing, as to be close to 2448 Nucleotide Hind III recognition site.In the useful quality that also has of selected carrier, promptly be in COS-I cell, the ability of duplicating automatically to be arranged, and it exist the function of the initiating sequence of a virus in mammiferous cell.These features are owing to there is the promoter sequence of the replication orgin of DNA and virulent late gene (Late gene ") just can possess.This promotor is the dna sequence dna of 342 SP of genomic leap 5171 to 270 Nucleotide of animal virus SV40 (SPanning nucleo tide numbers 5171through270).A unique restriction site (BbmH I) is arranged in carrier, and by using a commercial available connexon sequence.(COlla bora twe Research) is immediately following by a viral promoter subsequence.Also inserted the sequence (is that 2553 to 2770 general sequence is come to deriving by the Nucleotide sequence number by SV40) of 237 base pairs in carrier, this section sequence contains the polyadenylic acid signal (being considered to transcription terminator usually) of the MRNA of the late genes of encoding.This fragment is positioned in the carrier with the correct orientation that faces virus " late gene " promotor by the BamH I site of uniqueness.In carrier, between the promotor and terminator sequence of virus, also exist another mammals gene, its position is transcribed for the gene that inserts on unique BamH I site potential and is not that vital (the mammals gene also comprises the minigene of Tetrahydrofolate dehydrogenase (DHFR) of the mouse of nearly 2500 base pairs of separating from plasmid pMG-I, as people such as Gasser, P.N.A.S. (U.S.A) the 79th phase, the 6522nd～6526 page (1982).) moreover, the main active principle of plasmid pDSVLI comprises the Nucleotide with from 2553 to 2770 (237bp) of from 2448 to 4362 Nucleotide of the pBR322 of Nucleotide 5171 to 270 (342 base pairs) and SV40DNA.

Following process for example people such as Maniatis, in the article of SuPra, has been described the EPO-coding DNA, separates from plasmid pBR-EPO with BamH I fragment, and is connected in the pDSVL I plasmid that cuts with the BamH I.Used the Restriction Enzyme spectrum analysis, determined that the EPO gene is insert with correct direction in two clones' that hybridized carrier (replicability carrier H and L).Fig. 2 referring to explanation pDSVL-MKE plasmid.The carrier that has the EPO gene of mistake direction of insertion at the opposite way round is retained, and is used as the negative contrast in the transfection experiment, and designing this experiment is to transform the EPO expression level of back in the host for the carrier of measuring the EPO DNA that has correct direction.

With carrier H, L, F, X and G carrier (Carrier) DNA (DNA of Mouse Liver or spleen) combination, and with the duplicating flat board of 60 millimeters of calcium phosphate microdeposit method transfections.60 millimeters Copying plates are also used the carrier DNA transfection, and this is a transformation, and " simulation " bears control group.After five days, all cultures are measured, detected and exist polypeptide in the culture with natural EPO immunologic competence.

Embodiment 7

A, comprise the initial expression system of the EPO of COS-I cell

For rise the microorganism of at first selecting synthesize have separable amount, by the system of the coded people EPO peptide material that comes out of human gene group DNA EPO clone, be also included within the i.e. expression in (COS-I cell, U.S. culture sample collection center (A.T.C.C.) CRL-1650 number) of mammals host cell.Human EPO gene " is shuttled back and forth " by subclone (Sub-Cloned) for the first time, in the carrier.This carrier is (owing to existing the DNA of pBR322) also can (owing to existing SV40 virus derived dna) duplicate automatically in cells of mamma animals strain COS-I in intestinal bacteria (E.COli) host.The shuttle vectors that then contains the EPO gene, transfected in COS-I cell.In cells transfected, produce the EPO peptide material, and be secreted in the cell culture fluid.

Specifically, expression vector is to make according to following process.Isolate DNA from λ clone λ hE1, λ hE1 contains the EPO gene of human genome, carries out enzymolysis with BamH I and Hind III restriction endonuclease, isolates the DNA fragment of the 5.6Kb that contains known universe EPO gene.(Bethesda Research Laboratoris Inc.) mixes mutually and connects, and this PUC8 plasmid similarly carries out enzymolysis, and both are connected to is just to have formed a plasmid intermediate " PUC8-HuE " for this fragment and bacterial plasmid PUC8.This plasmid intermediate provides source easily for top that restricted fragment.

Selection is used in COS-I cell expressing the carrier (pSV4SEt) of EPO DNA and makes in advance.The pSV4SEt plasmid contains and can duplicate automatically in intestinal bacteria (E.COli) and by the dna sequence dna of artificial selection.These features are because the dna sequence dna that replication orgin is arranged and the anti-penbritin gene on the 2448-4362 Nucleotide of PBR322 plasmid is arranged.This sequence has structurally been modified owing to add a connexon, and this connexon provides a Hind III discrimination bit that is being close to Nucleotide～2448.Plasmid pSV4SEt also can duplicate in the COS-1 cell automatically.This feature is because the fragment (Nucleotide number 5171 is through 270) of 342 base pairs of a replication orgin that contains the SV40 viral DNA is arranged.This fragment is owing to added one and provide adjacent to the connexon of an ECOR1 recognition site of Nucleotide 270 and one and the connexon of a Sal1 recognition site is provided and has been modified at Nucleotide 5171 adjacents.In this carrier, also exist a SV40 (fragment of 106lbp) (Nucleotide adds a connexon that the recognition site of a Sal1 is provided at contiguous No. 2772 Nucleotide place for the 1711st to No. 2772).Within this fragment, a unique BamH1 recognition sequence is arranged.In a word, plasmid pSV4SEt contains the recognition site of a unique BamH1 and Hind III, and people EPO gene can be inserted, and can duplicate in the intestinal bacteria by this plasmid and select and duplicate in the COS-1 cell.

For the EPO gene is inserted among the pSV4SEt, plasmid pUC8-HuE is carried out enzymolysis with BamH I and Hind III restriction endonuclease, and isolated the dna fragmentation of the coding EPO of 5.6Kb.PSV4SEt is also carried out enzymolysis with BamH1 and Hind III, and, isolated main 2513bp fragment (having protected all necessary function).Isolated these two kinds of fragments are mixed and carry out ligation, made this carrier of final carrier " PSVgHUEPO " (see figure 3) and in intestinal bacteria, bred, and carrier DNA can have been separated.Use Restriction Enzyme to carry out the insertion of enzyme spectrum analysis with conclusive evidence EPO gene.

Plasmid pSVgHuEPO is used to expressing human EPO peptide material in the COS-1 cell.Specifically, pSVgHuEPO DNA combines with carrier DNA, and transfection is in triplicate 60 millimeters culture plates that the COS-1 cell arranged.In contrast, with the independent transfection of carrier DNA in the COS-1 cell.Cell culture medium was taken a sample after 5 days and 7 days, and the polypeptide that whether has natural human EPO immunological properties with check exists.

B, comprise the 2nd kind of EPO expression system of COS-1 cell,

For the improvement production method of human EPO peptide material is provided, also designed another system, these materials are coded by the clone of the human gene group DNA EPO in the COS-1 cell and (A.T.C.C.NO.CRL-1650) that produce.

In that system in front, EPO be with it self in the COS-1 cell, express to the promotor in the restricted fragment of Hind III in 5.6 KbBamH I.In following manufacturing, conversion the EPO gene, so it is expressed with the SV40 late promoter.

Specifically, the 5.6Kb BamH I of having cloned is to modify with following process to the genomic restricted fragment of Hind III people EPO.As mentioned above, plasmid pUC8-Hu E shears with BamH I and BStE II restriction endonuclease.In the EPO of 5.6Kb gene, the BStE II is to shear in such position: promptly the initial ATG of 5 ' direction range coding polypeptide precursor be 44 base pair places and _PUC8-H _uE shears with BamH I and BstE II restriction endonuclease.In the EPO of 5.6kb gene, the BstE II is to shear in such position: promptly the initial ATG of 5 ' direction range coding polypeptide precursor be 44 base pair places and 3 ' apart from about 680 the base pair places of Hind III restriction site.Be separated to the fragment of about 4900 base pairs.The connexon DNA fragment that contains Sal I and a BstE II sticky end and an inner BamH I recognition site of a synthetic is synthesized and has purified.Produced the plasmid intermediate by Sal I and the shearing of BamH I with these two kinds of fragments mixing and with one _PBRgHE's _PThe BE322 plasmid is connected.People's gene group EPO gene can be from wherein separating, and as a kind of BamH I enzymolysis fragment of 4900 base pairs, this fragment band one the ATG44 base pair.By 3 ' the complete structure gene of pressing close to the BamH I site of amino terminal coding region.

This fragment is separated as a BamH I fragment and is inserted into the expression vector plasmid that the BamH I is sheared _PAmong the DSVLI (as described in embodiment 6).The result has obtained plasmid _PSVL _gH _uEPO, as shown in Figure 4, this plasmid is used to express the EPO peptide material from COS-I cell, as described in embodiment 6 and 7A.

Embodiment 8

The culture of the COS-1 cell growth of 6 kinds of transfections of embodiment 6 is analyzed according to the program of the B part of embodiment 2 with radioactive automatic developing.Every kind of sample is with 250,152, and the five equilibrium level of 50 and 25 microlitres is measured.The supernatant liquor that comes in the grown cell of preparation earlier with carrier transfection that has the EPO gene that inserts with incorrect direction or simulation transfection is decided to be feminine gender to this class supernatant liquor to the immunocompetence of EPO.Two kinds of supernatant liquors that refabrication uses the COS-I grown cell of carrier (H and L) the institute transfection that has the EPO DNA that inserts with correct direction to draw in every kind sample, are attached on the antibody ¹²⁵Inhibiting percentage ratio (%) scope of I-EPO is 72～88%, and it all fixes on whole numerical value the top of typical curve.The definite content of EPO can not be measured out reliably in the culture supernatants.Yet the quite conservative estimation that the numerical value that calculates from the duplicate samples (250 microlitre) of maximum is done is 300 milliunits.

To a kind of representational nutrient solution that is equipped with according to embodiment 6 and 5 days and the 7 days nutrient solutions that obtains according to embodiment 7A, use radioimmunoassay (RIA) to detect respectively, the monkey EPO material of reorganization and the people's of reorganization EPO material and the activity of the natural human EPO of standard are compared.The result lists in Fig. 1 with the form of scheming.In brief, the result who discloses as desired ground like that: the EPO material of the monkey of reorganization significantly with the antibody competition of anti-people EPO, although it can't fully suppress combination under test condition.Yet the standard value that suppresses percentage value and people EPO for recombinant human epo's maximum is very approaching.Dose response curve character parallel to each other hints out that the immunological properties of common sequence (anti-source decision position epitopes) is identical.Previously to the mensuration of monkey EPO in the tissue culture medium, under these higher dilution levels, assess again, find that its scope is 2.91 to 3.12u/ml (units per ml).The production level of the people EPO of Gu Jiing is 392 milliunit/milliliters in the sample of growth in 5 days again, and 7 days growth samples are 567 milliunit/milliliters.In the expression system of embodiment 7B, the production level of the EPO of the monkey that estimates is the same order of magnitude or higher.

Embodiment 9

According to embodiment 6 and 7 the preparation nutrient solutions, to the EPO activity according to people such as GOldwasser, Endocrinology, the 97th, 2 phase, the method for the 315th～323 page (1975) is carried out analyzed in vitro.The scope of EPO estimated value of being tried the monkey of nutrient solution is by 3.2 to 4.3 units per ml.In this analyzed in vitro, people's EPO nutrient solution also is activated, and further, this activity can make it neutralization with the antibody of anti-EPO.To the EPO nutrient solution according to the monkey of the reorganization of embodiment 6 preparation, carried out biologic activity test in the body again, the method for institute's foundation is people such as COtes, the 191st phase of Nature, people such as the 1065th～1067 page (1961) and Hammond, Ann.N.Y.ACad.Sci.The 149th phase, the general method of the 516th～527 page (1968), the scope of its activity level is between 0.94 to 1.24 units per ml.

Embodiment 10

Among the embodiment in front, the EPO material monkey of reorganization or the people is to produce from the carrier that is used for transfection COS-1 cell.These carriers duplicate in the COS-1 cell, because in cell, exist SV40T antigen, and the replication orgin that SV40 is arranged on carrier.Though these carriers can produce the EPO of use value quantity in the COS-1 cell, this expression also is temporary transient (7 to 14 days), because carrier has still lost at last.In addition, behind the COS-1 with the carrier transfection, having only seldom, the COS-1 of percentage ratio becomes productive cell.Present embodiment has been described the expression system that uses Chinese hamster ovary (CHO) DHFR cell and selectable marker: DHFR.(,, open on August 29th, 1984 entirely referring to No. 4399216, United States Patent (USP) and european patent application 117058,117059 and No. 117060 for the discussion of relevant expression system.)

People such as Urlaub are at Proc.Nat.ACad.SCi (U.S.A.), the 77th volume, the 4461st page (1980), on point out, DHFR cell (DuX-B11) the CHOK1 cell of CHO lacks Tetrahydrofolate dehydrogenase (DHFR), because this sudden change has taken place structure gene, therefore will add glycine in substratum, xanthoglobulin, and thymus pyrimidine.Plasmid pDSVL-MKE (embodiment 6) or pDSVL-gHuEPO (embodiment 7B) are transfected in CHO DHFR-cell with carrier DNA, and this cell grows in and contains xanthoglobulin, thymus pyrimidine, and on 60 millimeters culture plates of glycine.Again plasmid pSVgHuEPO (embodiment 7A) is mixed mutually with plasmid PMG2, plasmid PMG2 contains and is cloned in bacterial plasmid vector _PLittle mouse dhfr gene (, above-mentioned) among the BR322 according to people such as Gasser.This plasmid mixture and carrier DNA are transfected together in CHO DHFR-cell.(those cells that obtained a plasmid generally also will obtain second plasmid.) after three days, cell is spread on several culture plates that lack xanthoglobulin and thymus pyrimidine of 100 millimeters with trysinization again, in this substratum, have only those by the DHFR gene, then the cell that has been transformed by the EPO stable gene can survive.After 7 to 21 days, the cell bacterium colony of surviving becomes obviously.The bacterium colony of these conversions still just can be bred in the substratum that lacks xanthoglobulin and thymus pyrimidine after being disperseed by trysinization, and the clone that manufacturing makes new advances (CHOPDSVL-MKEPO for example, CHOPSVgHu-EPO, CHO-PDSVLgHuEPO).

The existence of the monkey of the nutrient solution usefulness radioactive automatic developing assay method inspection reorganization in above-mentioned clone or people's EPO.The substratum of CHOPDSVL-MKEPO system contains EPO, and the immunological properties of this EPO is identical with the immunological properties that is obtained from the COS-1 cell with plasmid pDSVL-MKEPO transfection.One representational, and the EPO concentration of the monkey that 65 hours tissue culture medium is contained is 0.60 units per ml.

From CHOPSVgHuEPO and the next nutrient solution of CEOPDSVL-gHuEPO, contain the people's of reorganization EPO, the immunological properties of this EPO is identical with the immunological properties that is obtained from the COS-1 cell with plasmid pSVgHuEPO or pDSVL-gHuEPO transfection.Measure with radioactive automatic developing, the concentration that contains somebody's EPO in a kind of representational tissue culture medium of 3 days by CHOpSVgHuEPO is 2.99 units per ml, and the people's that 5.5 days sample from CHOPDSVL-gHuEPO is contained EPO then is 18.2 units per ml.The amount of the EPO that is produced by above-mentioned clone can improve by gene magnification, obtains having the new clone of bigger throughput.Tetrahydrofolate dehydrogenase (DHFR) is by the DHFR genes encoding, and it can be suppressed by methotrexate medicine (MTX).Specifically, the cell of breeding in the substratum that lacks xanthoglobulin and thymus pyrimidine can be suppressed by MTX or kill.(for example MTX for time) very in a small amount can obtain in MTX growth and MTX be had the cell of resistance under suitable condition.These that find have the cell of resistance to MTX, because amplification has taken place their some DHFR genes, the result has just improved the generation of DHFR enzyme.Then, use the MTX of greater concn to handle to the cell of survival again, consequently in clone, contain the DHFR gene of bigger quantity.Also often find those have on the DHFR expression carrier with some " passerby's gene " (" Passen-gergenes ") or by on the carrier of DHFR gene transformation with the gene copy number of some " passerby's genes " phenomenon that increases is arranged.

As the embodiment that puts into practice this amplification system, clone CHOpDSVL-MKE is subjected to raising the good experimental subjects of MTX concentration (0nM, 30nM, and 100nM).The representational 65 hours culture samples of being taken out from each step of amplification are subjected to the detection of radioimmunoassay, and it is 060,2.45 and 6.10 units per ml that its content is determined respectively.Clone CHOpDSVL-gHuEPO is through the MTX of a series of rising concentration solution-treated, and promptly concentration is 30nM, 50nM, 100nM, 200nM, 1 μ M and 5 μ M, MTX.The representational three days culture samples of being got from this step of 100nMMTX judge that with radioimmunoassay the EPO that it contains the somebody is 3089 ± 129 units per ml.The representational 48 hours culture samples of being taken out from 100nm and 1umMTX step are measured with radioimmunoassay, and the people's that they are contained separately EPO amount is 466 and 1352 units per ml (in triplicate mean values).In these processes, with 1 * 10 ⁶Individual cell is put in 5 milliliters of nutrient solutions on 60 millimeters culture plates.After 24 hours, remove substratum, and replace (high concentration glucose DMEM replenishes with nonessential amino acid of 0.1 mmole and L-glutamine) with 5 milliliters of substratum that do not contain serum.EPO was accumulated 48 hours in the substratum that does not contain serum.Collect culture to carry out the radioimmunoassay analysis, cell is through trysinization and counting.Be grown in the mean value of the radioimmunoassay of the sample among 100nm and the uMMTX, be respectively 467 units per ml and 1352 units per ml, the actual output that provides is 2335 units/plate and 6750 units/plate.The average cell number of every plate is respectively 1.94 * 10 ⁶With 3.12 * 10 ⁶The useful efficiency of these culture condition promptly is 1264 and 2167 unit/10 ⁶Individual cell/48 hour.

Cell in the substratum of just having described in the above is that inhomogenous colony is gone up in heredity.On for the heredity of isolating maximum capacity, in the trial of the bacterium colony of homogeneous, used the screening process of standard.Referring to " to the characterization of the cell strain of considering to be used to produce biological products time a main points " literary composition, part 2, the A joint, (" POintsto Considerinthe Characterizationof CellLines Used toProduce Biologies ") on June 1st, 1984, biological study comment office, medicine and biological products center, the U.S.'s grain and the medication management council.

The ability of the production EPO of above-mentioned Chinese hamster ovary celI strain can adopt suitable tissue culture technique and be improved.The breeding of cells of mamma animals in substratum, general requirement contains serum in growth medium.A kind of method is arranged again, and it can produce hemopoietin with the Chinese hamster ovary celI of those growths in the substratum that never contains serum.In this way, be easy to the hemopoietin of from culture, purifying.Described below be can very economical the ground method that adopts the substratum that do not contain serum to produce hemopoietin, the output of the erythropoietin of Xing Chenging is bigger in this way, even as big as producing.

The cell of CHOpDSVL-gHuEPO strain is grown under the cell culture condition of standard, is used for being inoculated in the rotation cell cultures flask again.This cell is bred in the rotation Tissue Culture Flask with the form of cell suspending liquid, substratum wherein is to contain the mixture of 50～50 high concentration glucose DMEM and Ham ' SF12 and replenished 5% fetal bovine serum, L-glutaminate, penicillin and Streptomycin sulphate, the methotrexate of 0.05 mmole non-essential amino acid and proper concn.Suspended cell culture can make the Chinese hamster ovary celI that produces EPO be expanded into bigger volume at an easy rate.The Chinese hamster ovary celI of growing in suspension can be used to the shaking in the bottle and inoculate of rotation, and is containing the shaking in the bottle of 200 milliliters of substratum, and initial inoculum density is to have 1.5 * 10 on per 850 square centimeters ⁷Individual cell.After the cell growth three days, accumulate coherent cell strain, at the used substratum of this growth phase with used identical in suspension is grown.At the end in three days vegetative period, remove the substratum that contains serum, replace with 100 milliliters of substratum that do not contain serum; The mixture of 50～50 the high concentration glucose DMEM and Ham ' the s F12 of non-essential amino acid that is supplemented with 0.05 mmole and L glutamine.Bottle is shaken in rotation be put back into and shake in bottle warmer rotation again and shake 1 to 3 hour, and remove substratum once more, replace with 100 milliliters the fresh substratum that does not contain serum again.Carry out this insulation of 1 to 3 hour with the substratum that does not contain serum, reduced the concentration of contaminative serum protein.To shake bottle and be put back into to shake and cultivated again in the warmer 7 days, during this period in, in the above-mentioned substratum that does not contain serum, constantly accumulate hemopoietin.The above-mentioned substratum improved is removed at end production phase at 7 days, and gets to replace with the fresh substratum that does not contain serum again and circulate the second time of producing.As the above this production system of practice, as representational examples of implementation that do not contain blood serum medium, to the sample of this example after 7 days, detect with radioimmunoassay, measuring contained human hemopoietin is 3892 ± 409 units per ml.Based on estimated cell concn is 0.9-1.8 * 10 ⁵Individual cells/square cm, then each floorage is that 850 square centimeters shake contains 0.75～1.5 * 10 in the bottle ⁸Individual cell like this, is grown after 7 days, EPO with 100 milliliters of substratum in productivity be 750-1470 unit/10 ⁶Individual cell/48 hour.

For in 10nM MTX, the nutrient solution that CHOPDSVL-MK EPO clone is come should adopt radioimmunoassay to detect EPO biological activity in vitro and in vivo.Measure through radioimmunoassay, the media samples of having improved contains the MKEPO of 41.2 ± 1.4 units per ml, the activity of measuring with the extracorporeal biology activity detection is 41.2 ± 0.064 units per ml, and the biologic activity of measuring with biologic activity detection method in the body is 425 ± 5 units per ml.The amino acid sequence analysis that polypeptide product is carried out has disclosed and has had the EPO product, but " guide " sequence that three amino-acid residues are arranged near the aminoterminal L-Ala place band of inferring.About these characteristics, order not clear actually it be earlier since the film in the Chinese hamster ovary celI for due to the incorrect processing of polypeptide or the EPO that has reflected the people compares EPO with monkey in the structural difference of N-terminal.

Nutrient solution from CHO pDSVL-gHu EPO clone three kinds of detections have been carried out.For a sample of 5.5 days, detect with radioimmunoassay.First kind is detected recombinant human epo contained in the substratum, and its level is 18.2 units per ml; Second kind is detected external, and its result is 15.8 ± 4.6 units per ml; The third is to detect in vivo, and its result is 16.8 ± 3.0 units per ml.

Amplify for progressively adding 100nM MTX, thereby the nutrient solution that is obtained in the CHOpDSVL-gHu EPO cell of preparation has also carried out three kinds of detections.With the radioimmunoassay method sample of 3.0 days is measured, the level of the recombinant human EPO that nutrient solution is contained is 3089 ± 129 units per ml, and vitro detection is 2589 ± 71.5 units per ml, and detecting in the body is 2040 ± 160 units per ml.Amino acid to this product carries out sequential analysis, has recorded one corresponding to designed amino-terminal end in the table VI.

In 10nM MTX by plasmid pDSVL-MKE transfection Chinese hamster ovary celI in and the improvement that comes cell culture medium collect and come together, and the time through several days is dialysed away MTX, and the activity of result EPO in substratum is 221 ± 5.1 units per ml (EPO-CCM).In order to determine in normal Balb/c mouse EPO-CCM experiment to the vivo effect of hematocrit, below having carried out.Never transfected Chinese hamster ovary celI (CCM) and the improvement that from EPO-CCM, comes cell culture medium, adjusted with PBS.CCM is used for control group (3 mouse), and to experimental group (2 mouse/groups), has used the EPO-CCM of 2 kinds of dosage levels, i.e. per injection 4 units and per injection 44 units.Last 5 weeks during in, 7 mouse are carried out peritoneal injection, 3 times weekly.After the 8th injection, the average hematocrit of control group is confirmed as 50.4%; For 4 unit groups, be 55.1%; For 44 unit groups, be 67.9%.

The sublimed in fact expression product of cells of mamma animals can be used high performance liquid chromatography HPLC (C at an easy rate from the substratum of tissue culture ₄) obtain.Used the ethanolic soln of gradient concentration in the chromatography, and served as better to equal at 7 o'clock in the pH value.

To the recombinant glycoprotein product that the EPO of different sources source is produced, use Westevn hybridization engram analysis method and SDS-PAGE electrophoretic method to analyze, so that contrast and the preliminary characteristic of determining them.The EPO that is separated in the recombinant glycoprotein product that produces in the substratum of the improvement that people EPO gene is expressed in COS-1 cell and Chinese hamster ovary celI and the people's urine compares.These researchs indicate, and the Epo material that CHO produces is higher than the molecular weight of the expression product of cos-1, and the latter than from collector's urine to the molecular weight of extract big.All materials are some unhomogeneity all.Handle with neuraminidase, remove the sialic acid residues in the above-mentioned glycoprotein, the result is that the recombinant products of cos-1 and CHO has equal molecular weight, obviously they all the molecular weight than the asialo human urine extract who is obtained is big.Urinate extraction product (to remove carbohydrate fully from both) with endo-glycosidase F (EC3,2,1) processing recombinant C HO product and people, the result has obtained the product of the essentially identical homogeneous in fact of molecular weight characteristics.

The method that purified people is urinated EPO and carried out carbohydrate analysis, institute's foundation according to the present invention by the recombinant epo of Chinese hamster ovary celI production is people such as Ledeen are at Methed inEnzymology, the 83rd phase (D part), method conduct on the 139th～191 page (1982), people such as Nesser, the 142nd phase of Anal Biochem., the modification of the hydrolytic process of the 58th～67 page (1984) is analyzed.Result to the component value (molecular ratio with carbohydrate in the product is represented) of the experimental mensuration carbohydrate that carries out of urine isolate is as follows: sugar, 1.73; N-acetyl-glucosamine, I; The N-n acetylneuraminic acid n, 0.93; Fucose, O; N-acetylgalactosamine, O.Corresponding recombinant products: the numerical value of (by the product that forms in 100 mmole MTX in three days the culture of CHO pDSVL-gHuEPO cell strain growth) is then as follows: hexose, 15.09, N-acetylglucosamine, 1; N-n acetylneuraminic acid n 0.998; Fucose, O; N-acetylgalactosamine, O.These are found and above-mentioned Western engram analysis and SDS ... PAGE analyzes consistent.

Glycoprotein product provided by the present invention, can be understood as so a kind of comprehensive product, the proteinic primary structure conformation that it had just likes the duplicate of the primary structure conformation of natural hemopoietin, thereby make product also can have the biologic activity of one or more kinds, but it has a kind of composition different with the carbohydrate ingredient of natural hemopoietin of saying on an average again.

Embodiment 11

The present embodiment introduction through the complete synthesis process of artificial, is prepared the method that two kinds of EPO introduce the structure gene of encoding out by Nucleotide, and the synthetic gene is the structure gene that is coded in the people's epo protein matter product in the table VI.The codon of selecting the biology (referring to intestinal bacteria or cereuisiae fermentum S.Cerevisiae) at genetic expression place that a plurality of amino acid of encoding is had a preference for according to the aminoacid sequence of EPO when synthetic constitutes two kinds of EPO structure genes.In addition, also introduced the process of the gene of building coding people EPO analogue.In brief, used scheme is cited in the application that people (Wo83/04053) such as front Alton are mentioned.Designed gene is to be assembled into a plurality of duplexs for the oligonucleotide parts that when beginning formed.And then they are assembled into three separated portions, and the design of these parts is to prepare amplification, and when taking out from amplification system, they can assemble according to priority or be a suitable expression vector by segmental being formed by connecting more than.

Following table VIII has been explained a kind of artificial gene's design and assembling to the XI V.The translation product of a kind of human EPO of this genes encoding, this product are provided with leader or presequence (Presequence), but an initial methionine residues is arranged on 1.Yet this gene is incorporated into the substantive part of the codon that intestinal bacteria have a preference for, thereby this construction is called as " ECEPO " gene.

See Table VIII to table XI V

The table III

ECEPO part 1 oligonucleotide 1. AATTCTAGAAACCATGAGGGTAATAAAATA 2. CCATTATTTTATTACCCTCATGGTTTCTAG 3. ATGGCTCCGCCGCGTCTGATCTGCGAC 4. CTCGAGTCGCAGATCAGACGCGGCGGAG 5. TCGAGAGTTCTGGAACGTTACCTGCTG 6. CTTCCAGCAGGTAACGTTCCAGAACT 7. GAAGCTAAAGAAGCTGAAAACATC 8. GTGGTGATGTTTTCAGCTTCTTTAG 9. ACCACTGGTTGTGCTGAACACTGTTC10. CAAAGAACAGTGTTCAGCACAACCA11. TTTGAACGAAAACATTACGGTACCG12. GATCCGGTACCGTAATGTTTTCGTT

Table IX ECEPO part 1

The table X

ECEPO part 2 oligonucleotides 1. AATTCGGTACCAGACACCAAGGT 2. GTTAACCTTGGTGTCTGGTACCG 3. TAACTTCTACGCTTGGAAACGTAT 4. TTCCATACGTTTCCAAGCGTAGAA 5. GGAAGTTGGTCAACAAGCAGTTGAAGT 6. CCAAACTTCAACTGCTTGTTGACCAAC 7. TTGGCAGGGTCTGGCACTGCTGAGCG 8. GCCTCGCTCAGCAGTGCCAGACCCTG 9. AGGCTGTACTGCGTGGCCAGGCA10. GCAGTGCCTGGCCACGCAGTACA11. CTGCTGGTAAACTCCTCTCAGCCGT12. TTCCCACGGCTGAGAGGAGTTTACCA13. GGGAACCGCTGCAGCTGCATGTTGAC14. GCTTTGTCAACATGCAGCTGCAGCGG15. AAAGCAGTATCTGGCCTGAGATCTG16. GATCCAGATCTCAGGCCAGATACT

The table XI

ECEPO part 2

The table XII

ECEPO part 3 1. GATCCAGATCTCTGACTACTCTGC 2. ACGCAGCAGAGTAGTCAGAGATCTG 3. TGCGTGCTCTGGGTGCACAGAAAGAGG 4. GATAGCCTCTTTCTGTGCACCCAGAGC 5. CTATCTCTCCGCCGGATGCTGCATCT 6. CAGCAGATGCAGCATCCGGCGGAGA 7. GCTGCACCGCTGCGTACCATCACTG 8. ATCAGCAGTGATGGTACGCAGCGGTG 9. CTGATACCTTCCGCAAACTGTTTCG10. ATACACGAAACAGTTTGCGGAAGGT11. TGTATACTCTAACTTCCTGCGTGGTA12. CAGTTTACCACGCAGGAAGTTAGAGT13. AACTGAAACTGTATACTGGCGAAGC14. GGCATGCTTCGCCAGTATACAGTTT15. ATGCCGTACTGGTGACCGCTAATAG16. TCGACTATTAGCGGTCACCAGTAC

Table XII I

ECEPO part 3

Table XI V ECEPO gene

-1 1

XbaⅠ Met?Ala

CTAG?AAACCATGAG?GGTAATAAAA?TAATGGCTCC?GCCGCGTCTG

TTTGGTACTC?CCATTATTTT?ATTACCGAGG?CGGCGCAGACATCTGCGACT?CGAGAGTTCT?GGAACGTTAC?CTGCTGGAAG?CTAAAGAAGCTAGACGCTGA?GCTCTCAAGA?CCTTGCAATG?GACGACCTTC?GATTTCTTCGTGAAAACATC?ACCACTGGTT?GTGCTGAACA?CTGTTCTTTG?AACGAAAACAACTTTTGTAG?TGGTGACCAA?CACGACTTGT?GACAAGAAAC?TTGCTTTTGTTTACGGTACC?AGACACCAAG?GTTAACTTCT?ACGCTTGGAA?ACGTATGGAAAATGCCATGG?TCTGTGGTTC?CAATTGAAGA?TGCGAACCTT?TGCATACCTTGTTGGTCAAC?AAGCAGTTGA?AGTTTGGCAG?GGTCTGGCAC?TGCTGAGCGACAACCAGTTG?TTCGTCAACT?TCAAACCGTC?CCAGACCGTG?ACGACTCGCTGGCTGTACTG?CGTGGCCAGG?CACTGCTGGT?AAACTCCTCT?CAGCCGTGGGCCGACATGAC?GCACCGGTCC?GTGACGACCA?TTTGAGGAGA?GTCGGCACCCAACCGCTGCA?GCTGCATGTT?GACAAAGCAG?TATCTGGCCT?GAGATCTCTGTTGGCGACGT?CGACGTACAA?CTGTTTCGTC?ATAGACCGGA?CTCTAGAGACACTACTCTGC?TGCGTGCTCT?GGGTGCACAG?AAAGAGGCTA?TCTCTCCGCCTGATGAGACG?ACGCACGAGA?CCCACGTGTC?TTTCTCCGAT?AGAGAGGCGGGGATGCTGCA?TCTGCTGCAC?CGCTGCGTAC?CATCACTGCT?GATACCTTCCCCTACGACGT?AGACGACGTG?GCGACGCATG?GTAGTGACGA?CTATGGAAGGGCAAACTGTT?TCGTGTATAC?TCTAACTTCC?TGCGTGGTAA?ACTGAAACTGCGTTTGACAA?AGCACATATG?AGATTGAAGG?ACGCACCATT?TGACTTTGAC

SalⅠTATACTGGCG?AAGCATGCCG?TACTGGTGAC?CGCTAATAGATATGACCGC?TTCGTACGGC?ATGACCACTG?GCGATTATCA?GCT

More specifically, the part 1 oligonucleotide of ECEPO gene that is used to produce the amino terminal residue of the human polypeptide of coding of table VIII explanation.Oligonucleotide is assembled into duplex (1 and 2,3 and 4 or the like), then duplex is coupled together, and obtains as the ECEPO part 1 in the table IX.Should be noted that the part that is assembled into, comprise the EcoR I and the BamH I sticky end of each self terminal, enzyme recognition site in " below " of EcoR I sticky end is an Xba I limit; And the recognition site in " top " of BamH I sticky end is Kpn I limit.Can at an easy rate part 1 be amplified with the M13 phage vector, to prove the sequence of this part.When the Xba of the rf RFDNA that this part is produced in intestinal bacteria I/when Kpn I fragment separates, run into some difficulties, this may since among the host Kpn I recognition site base methylated.Therefore separated single stranded phage DNA, and made it become double chain form, just can isolate desired double-stranded fragment at an easy rate then at replication in vitro with the primer prolongation.

The the 2nd and the 3rd portion C of ECEPO gene (table XI and XII I) is to be made in similar mode by the oligonucleotide of table X and XII respectively.Each part all is to be exaggerated in can be used as the M13 carrier that confirms its sequence, and separates from phage DNA.Shown in the table XI, the part 2 of ECEPO is with the manufacturing of ECoR I and BamH I sticky end, and can be used as Kpn I/Bgl II fragment and separate.Similar with it, the 3rd part of ECEPO with the preparation of BamH I and Sal I sticky end, and can be used as Bgl II/Sal I fragment and separates from phage RFDNA.3 parts that are prepared into like this can be assembled into a successive dna sequence dna (table XI V) the whole human EPO polypeptide of coding at an easy rate.It is that the intestinal bacteria translation initiation is necessary that this polypeptide has this codon of an aminoterminal methionine(Met) codon (ATG).Should also be noted that in initial ATG " top " be a series of base pair, they duplicate the sequence of the ribosome bind site of the OMP-f gene that colibacillary height expresses in fact.

Any suitable expression vector can be used for carrying ECEPO.For expressing the carrier of the special selection of ECEPO gene institute, be the plasmid PCFM536 of " temperature sensitivity ", it is a derivative at plasmid PCFM414 (U.S. culture sample collection center, 40076), described in the common pending U.S. Patent Application sequence number of submitting on August 6th, 1984 as Charles F.Morris 636727.More specifically, PCFM536 is the enzymolysis that the action site of Xba I and Hind III is arranged, and isolates big fragment, is used for being connected with two portions of ECEPO gene.I part (Xba I/Kpn I), part 2 (Kpn I/Bgl II) and the 3rd part Bgl II/Sal I) formerly correct order is assemblied among the M13, and therefrom isolated EPO gene is a single Xba I/Hind III fragment.This fragment comprises the poly junctor PolyLinker of a leap Sal I in M13mp9 to Eind III site.The control of expressing in final expression plasmid P536 is to be the PL promotor of λ saliva thalline by what adopt, and this PL promotor itself then may be subjected to the C1857 resistance that the control of gene (as being provided by intestinal bacteria strain K12AHtrp bacterial strain) is provided.

The ECEPO gene of top manufacturing can carry out different modifications, with the analogue of the various hemopoietins of encoding out, and (Asn as described below ², des-Pro ²To Ile ⁶) hEPo and (His ⁷) hEPO

A, (Asn ², des-Pro ²To Ile ⁶) hEPO

Plasmid 536 has from Xba I site and to insert to Hind III site, and the ECEPO artificial gene in the table is with plasmid 536 usefulness Hind III and Xho I enzymolysis.A kind of endonuclease in back is cut on the recognition site of 6 base pairs of a uniqueness on the ECEPO gene, and it has been crossed over from coding ASP ⁸, codon last base to the coding Arg ¹⁰Second base of codon.Made " junctor " Linker sequence that Xba I/Xho I site is arranged, the sequence of this junctor is as follows: Xba I+1 2789

Met?Ala?Ash?Cys?Asp XhoⅠ5?′-CTAG?ATG?GCT?AAT?TOC?GAC-3＇

3′-TAC?CGA?TTA?ACG?CTG?AGCT-5′

The fragment of Xba I/Xho I junctor and Xho I/Hind III ECEPO gene order is inserted into this big fragment in the big fragment from the plasmid PCFM526 with Xba I and Hine II enzymolysis, it is the derivative (A.T.C.C.40076) of plasmid PCFM414, as described in the common pending U.S. Patent Application sequence number of submitting on August 6th, 1984 by CharlesF.Morris 636727, to produce a plasmid that carries specific dna sequence dna.Can encode out the analogue of desired erythropoietin of this specific sequence has the Met-to form expression product formula, colibacillary.

B、〔HS ⁷〕hEPO

As above-mentioned A part, with Hind III and Xho I enzyme enzymolysis plasmid 536.Produce an Xba I/Xho I junctor, it has following sequence:

XbaⅠ +1 2 3 4 5 6 7 8 9?XhoⅠ

Met?Ala?Pro?Pro?Arg?Leu?Ile?His?Asp5′-CTAG?ATG?GCT?CCG?CCA?CGT?CTG?ATC?CAT?GAC-3′

3＇-TAC?CGA?GGC?GGT?GCA?GAC?TAG?GTA?CTG?AGCT-5′

Then this junctor and Xho I/Hind III ECEPO sequence fragment are inserted among the PCFM526, to produce a kind of encode e. coli expression product of Met-form of needed analogue of specific dna sequence that carries.

Set up one mix codon that the enzyme mother had a preference for, artificial gene (" SCEPO ") as following table X V to show the X XI described.With identical to the situation of ECEPO gene, its whole building works comprise forming 3 cover oligonucleotides (they are formed the duplex product to this three covers oligonucleotide again and are assembled on the each several part for table X V, X VII and XI X) earlier

Table X V

SCEPO part 1 oligonucleotide 1. AATTCAAGCTTGGATAAAAGAGCT 2. GTGGAGCTCTTTTATCCAAGCTTG 3. CCACCAAGATTGATCTGTGACTC 4. TCTCGAGTCACAGATCAATCTTG 5. GAGAGTTTTGGAAAGATACTTGTTG 6. CTTCCAACAAGTATCTTTCCAAAAC 7. GAAGCTAAAGAAGCTGAAAACATC 8. GTGGTGATGTTTTCAGCTTCTTTAG 9. ACCACTGGTTGTGCTGAACACTGTTC10. CAAAGAACAGTGTTCAGCACAACCA11. TTTGAACGAAAACATTACGGTACCG12. GATCCGGTACCGTAATGTTTTCGTT

Table X VI SCEPO part 1

Table X VII

SCEPO part 2 oligonucleotides 1. AATTCGGTACCAGACACCAAGGT 2. GTTAACCTTGGTGTCTGGTACCG 3. TAACTTCTACGCTTGGAAACGTAT 4. TTCCATACGTTTCCAAGCGTAGAA 5. GGAAGTTGGTCAACAAGCAGTTGAAGT 6. CCAAACTTCAACTGCTTGTTGACCAAC 7. TTGGCAAGGTTTGGCCTTGTTATCTG 8. GCTTCAGATAACAAGGCCAAACCTTG 9. AAGCTGTTTTGAGAGGTCAAGCCT10. AACAAGGCTTGACCTCTCAAAACA11. TGTTGGTTAACTCTTCTCAACCATGGG12. TGGTTCCCATGGTTGAGAAGAGTTAACC13. AACCATTGCAATTGCACGTCGAT14. CTTTATCGACGTGCAATTGCAA15. AAAGCCGTCTCTGGTTTGAGATCTG16. GATCCAGATCTCAAACCAGAGACGG

Table X VIII

SCEPO part 2

Table X IX

SCEPO 3 1． GATCCAGATCTTTGACTACTTTGTT 2． TCTCAACAAAGTAGTCAAAGATCTG 3． GAGAGCTTTGGGTGCTCAAAAGGAAG 4． ATGGCTTCCTTTTGAGCACCCAAAGC 5． CCATTTCCCCACCAGACGCTGCTT 6． GCAGAAGCAGCGTCTGGTGGGGAA 7． CTGCCGCTCCATTGAGAACCATC 8． CAGTGATGGTTCTCAATGGAGCG 9． ACTGCTGATACCTTCAGAAAGTT 10． GAATAACTTTCTGAAGGTATCAG 11． ATTCAGAGTTTACTCCAACTTCT 12． CTCAAGAAGTTGGAGTAAACTCT 13． TGAGAGGTAAATTGAAGTTGTACAC 14． ACCGGTGTACAACTTCAATTTACCT 15． CGGTGAAGCCTGTAGAACTGGT 16． CTGTCACCAGTTCTACAGGCTTC 17． GACAGATAAGCCCGACTGATAA 18． GTTGTTATCAGTCGGGCTTAT 19． CAACAGTGTAGATGTAACAAAG 20． TCGACTTTGTTACATCTACACT

Table XX SCEPO part 3

Table X XI SCEPO gene-

-1?+1HfndⅢ ArgAlaAGCTTGGATA?AAAGAGCTCC?ACCAAGATTG?ATCTGTGACT?CGAGAGTTTT

ACCTAT?TTTCTCGAGG?TGGTTCTAAC?TAGACACTGA?GCTCTCAAAAGGAAAGATAC?TTGTTGGAAG?CTAAAGAAGC?TGAAAACATC?ACCACTGGTTCCTTTCTATG?AACAACCTTC?GATTTCTTCG?ACTTTTGTAG?TGGTGACCAAGTGCTGAACA?CTGTTCTTTG?AACGAAAACA?TTACGGTACC?AGACACCAAGCACGACTTGT?GACAAGAAAC?TTGCTTTTGT?AATGCCATGG?TCTGTGGTTCGTTAACTTCT?ACGCTTGGAA?ACGTATGGAA?GTTGGTCAAC?AAGCTGTTGACAATTGAAGA?TGCGAACCTT?TGCATACCTT?CAACCAGTTG?TTCGACAACTAGTTTGGCAA?GGTTTGGCCT?TGTTATCTGA?AGCTGTTTTG?AGAGGTCAAGTCAAACCGTT?CCAAACCGGA?ACAATAGACT?TCGACAAAAC?TCTCCAGTTCCCTTGTTGGT?TAACTCTTCT?CAACCATGGG?AACCATTGCA?ATTGCACGTCGGAACAACCA?ATTGAGAAGA?GTTGGTACCC?TTGGTAACGT?TAACGTGCAGGATAAAGCCG?TCTCTGGTTT?GAGATCTTTG?ACTACTTTGT?TGAGAGCTTTCTATTTCGGC?AGAGACCAAA?CTCTAGAAAC?TGATGAAACA?ACTCTCGAAAGGGTGCTCAA?AAGGAAGCCA?TTTCCCCACC?AGACGCTGCT?TCTGCCGCTCCCCACGAGTT?TTCCTTCGGT?AAAGGGGTGG?TCTGCGACGA?AGACGGCGAGCATTGAGAAC?CATCACTGCT?GATACCTTCA?GAAAGTTATT?CAGAGTTTACGTAACTCTTG?GTAGTGACGA?CTATGGAAGT?CTTTCAATAA?GTCTCAAATGTCCAACTTCT?TGAGAGGTAA?ATTGAAGTTG?TACACCGGTG?AAGCCTGTAGAGGTTGAAGA?ACTCTCCATT?TAACTTCAAC?ATGTGGCCAC?TTCGGACATCAACTGGTGAC?AGATAAGCCC?GACTGATAAC?AACAGTGTAGTTGACCACTG?TCTATTCGGG?CTGACTATTG?TTGTCACATC

Sal I ATGTAACAAA GTACATTGTTT CAGCT (table X VI, X VIII and XX).It should be noted that this is synthetic because to have used some all be the codon of secondary appropriateness and being promoted to a certain extent in the establishment of SCEPO and ECEPO.Promptly the 7-12 oligonucleotide of the first part of two kinds of genes is identical, and E is as the 1-6 oligonucleotide of part 2 in two genes is also identical.

See Table X V～X XI

The SCEPO each several part that is assembled into can place M13, carries out sequential analysis again, and the part of separating from the M13 phage 1,2,3 is Hind III/Kpn I, Kpn I/Bgl II and Bgl II/Sal I fragment.

The expression system of SCEPO gene product is and cereuisiae fermentum (S.Cere-Visiae) α-relevant secretion system of factor secretion preferably at present, as the common pending U.S. Patent Application sequence number of submitting to April 22 nineteen eighty-three at GrantA.Bitter 487753, and as No. the 0123294th, european patent application described in the disclosed application on October 31 in 1984 like that.In brief, this system comprises so a kind of establishment, and that promptly wherein encode cereuisiae fermentum α-factor gene product is the DNA of leader sequence, is arranged in the coding region that 5 ＇ end is close to foreign gene to be expressed.Consequently, the gene product of translation includes a leader or a signal sequence, their this signal sequences among the process of rest part of the above-mentioned translation product of secretion because a kind of cutting of endogenous yeast enzyme and by " processing is removed ".Because this manufacture process uses initial (ATG) codon of α-factor translation, so just need not provide such codon on 1 of SCEPO gene.As from table X XI, noticing, L-Ala (+1) thus have a junctor sequence can directly be inserted in the plasmid to go before the numbered sequence, this plasmid comprises the DNA of first 80 residue that is connected on the α-factor leader after α-factor promotor.For the good especially building process of SCEPO genetic expression, comprise a ligation that four parts are arranged, comprising the fragment of above-mentioned SCEPO part and Hind III/big fragment of Sal I that plasmid is obtained with P α C3 enzymolysis.To the plasmid Pac3/SCEPO that is obtained, use BamH I enzymolysis again, isolate promotor, leader and the SCEPO gene of α-factor.And on the plasmid PYE that has been connected to BamH I enzymolysis, forming expression plasmid PYE/SCEPO.

Embodiment 12

Present embodiment relates in the expression system of embodiment 11, the expression that the recombinant products of synthetical ECEPO and SCEPO gene carries out.

When using the expression system that designs for the application e. coli host cell, the plasmid P536 of embodiment 11 is transformed in intestinal bacteria AM7 (AM7E.coli) cell, and this cell has given earlier and having transformed with a suitable plasmid PMW1 who has the C1857 gene.(penbritin 50 mcg/ml, kantlex 5 mcg/ml preferably have the MgSO of 10 mmoles again at LB gravy with these cells ₄) in cultivate, temperature remains on 28 ℃, then culture temperature is elevated to 42 ℃ and induce the expression that produces EPD when cell grows into O.D.600=0.1 in substratum.When cell grew to 40 O.D., the turnout of EPO (estimating with gel) was about 5 milligrams/OD liter.

Harvested cell, molten born of the same parents, with French presser fragmentation (10000PSi), and with N,O-Diacetylmuramidase and NP-40 detergent-treatment.Through the centrifugal water polo that obtains of 24000Xg, use guanidine hydrochloride dissolution again, and progressive purify through a step again, usefulness be C ₄(Vydac) reversed phase high performance liquid laminate Reverse Phase Hplc (ethanol, 0～80%, 50 mmole NH ₄Ac.pH4.5).Proteinic sequential analysis has disclosed degree of purity of production greater than 95%, and the product that is obtained has disclosed 2 kinds of different N-terminals, A-P-P-R ... and P-P-R ..., the ratio of their relative quantities is 3: 1.To this a kind of observation in back of hEPO and (des Ala ＇) hEPO product, pointed out that " processing " of amino terminal is the terminal methionine(Met) of excision and removes initial L-Ala in some cases in host cell.To the activity measured by radioimmunoassay of isolate, its activity level is 150000 to 100000 unit/milligrams; The activity level of external test is 30000 to 62000 unit/milligrams; The field of activity of measuring in the body is 120 to 720 unit/milligrams, (in measuring at each, the people urinates the standard of isolate, 70000 unit/milligrams.) to urinate EPO standard feature curve different significantly for the dosage rational curve and the people that measure recombinant products in vivo.

The plasmid of the EPO analogue that is partly generated at the A of embodiment 11 part and B is transformed in the AM7 Bacillus coli cells that PMW1-transformed respectively, and cell is cultivated as stated above.With radioimmunoassay and external test method pure isolate is measured again.To (ASn ², des-Pro ²To Ile ⁶) radioimmunoassay of hEPO expression product and the value of external test approximately be respectively 11000 unit/milligrams and 6000 units/milligram protein, and for (His ⁷) measured value of hEPO is respectively about 41000 unit/milligrams and 14000 units/milligram protein, during this just pointed out to measure, " activity " of the product of promoting erythrocyte resultant analogue was its " parental generation " expression product $\frac{1}{4}-\frac{1}{10}$ 。

When using that for the expression system selecting cereuisiae fermentum (S.cerevisiae) for use and design as host cell, plasmid PYE/SCEPO is transformed in the yeast of two kinds of different strains, promptly among YSDP4 (genotype α PeP4-3trP1) and the RK81 (genotype aaPeP4-3trP1).The YSDP4 host who transforms (the yeast genetics method of in the SD substratum, growing, cold spring harbor laboratory, cold spring port, New York, the 62nd page 1983) and replenish with casamino acids, 0.5%, PH6.5,30 ℃ when cell grown into 36 O, D, the time, results substratum, the level of contained EPO product approximately are 244 units per ml (97 micrograms/O.D. liter are measured by RIA).The RK81 cell that transforms is when growing to 6.5 O.D or 60O.D, and the content of the EPO product in the resulting substratum is about 80～90 units per ml (34 micrograms/OD liter are measured by RIA).Preliminary analysis has disclosed, and in the product of growing in expression system, very remarkable heterogeneity is arranged, and this seems the difference because of the glycosylation situation of expressed protein, and contains due to the quite high seminose in the carbohydrate that links to each other.

Plasmid P α C3 and PYE in intestinal bacteria (E.coli) HB101 cell, according to U.S. Patent Office on the 27th detailed rules for the implementation September in 1984, be stored in U.S.'s culture model and collect the center, 12301ParKlawnDrive, Rockville, Maryland, storage number are divided into not Wei A, T, C, C, 39881 and A, T, C, C, 39882.Plasmid PCFM526 in the AM7 cell, plasmid PCFM536 in the JM103 cell, and the plasmid PMW1 in the JM103 cell also on November 21st, 1984 be stored in equally U.S. culture model collect the center, store number for Wei not A, T, C, C33932,33934 and 33933.Yeast (Saccharom-yces Cerevisiae) strain YSPD ₄Also be stored in U.S. culture model on November 21st, 1984 with RK81 and collect the center, storing number is respectively A, T, C, C, 20734 and 20733.

Consider above-mentioned explanation embodiment, just can find out significantly at an easy rate that the present invention provides a large amount of special superior valuable product and methods aspect it a lot.

Polypeptide provided by the present invention is useful material without doubt, no matter and they to be product or synthetic products of microbial expression be not always the case.And the present invention makes people recognize one-level, secondary and the tertiary structure conformation of erythropoietin first.

As pointed in the front, the product of recombinant production of the present invention or synthetic product, the extracorporeal biology activity that all on different degree, has natural EPO, and can use it afterwards, to replace those isolated EPO materials in the nutrient solution of tissue culture promoting erythrocyte growth.Equally, polypeptide product of the present invention has the activity in vivo of natural EPO isolate on suitable degree, and undoubtedly, they are applicable to the diagnosis and treatment process that comprises human mammiferous hemopoietin.Use it can access diagnosis and treatment any or whole effects in vivo before because of the EFO generation, for example, stimulate the reaction of reticulated red blood cells cell, produce ferrous compound kinetics (fer-rokinetic) effect (for example blood plasma iron transition effects and marrow effect switching time), the change of red corpuscle group, synthetic (, the same) of stimulation HbC referring to people such as Eschbach, and pointed as example 10, improve the level of mammiferous hematocrit.The people of available product of the present invention treatment comprise, generally need blood transfusion patient, comprise traumatic patient.Operation patients, kidney disease patient comprise the dialysis patient, and the patient of the disorderly variation of various blood ingredient, hemophilia for example, reaping hook cytopathy, physiologic anemia or the like.By using the EPO therapy, can make requirement to treatment of blood transfusion drop to minimum, result is that the input of infectious substance also is lowered.Product of the present invention since they, produce this essence with recombination method, thereby do not have thermal source, natural inhibitory substance and analogue etc., and because like this, probably with regard to can providing relative nature derivative, the comprehensive effectiveness of in diagnosis and treatment process, more strengthening.Use the hemopoietin of product of the present invention to treat, also be expected to be useful under iron oxygen envrionment conditions and improve individual oxygen carrying capacity, and may provide useful in cardiovascular effect.

Use one of polypeptide product of the present invention method preferably, it is calipers approach with parenteral road (for example, intravenously, muscle, subcutaneous and peritoneal injection), the composition of being used, should contain routinely treatment effective dose product and have with it can be compatible a certain amount of thinner, and also have a certain amount of carrier and/or assistant agent and its compatibility.Preliminary pharmacological kinetics research indicates, and when carrying out intramuscular injection with monkey EPO product, this medicine transformation period in vivo is than with intravenous longer, and therefore effective dosage is according to the condition of processing and different.But therapeutic dose is considered to such scope at present, and promptly 0.1 (～7 unit) is to 100 (～7000 units micrograms/per kilogram of body weight active substance.The thinner of standard as the human serum albumin, is that medicinal compositions of the present invention is desired, and as the carrier of standard, for example salt solution.

To the auxiliary substance that composition of the present invention was suitable for, comprise the compound that the pungency effect of short erythrocyte is mentioned in addition, for example, testosterone, the daughter cell stimulator, insulin-like growth factor, prostaglandin(PG), thrombotonin, ring AMP, prolactin and triiodothyronine, and used reagent comprises normethandrolone (the male rare alcohol ketone methenolene of 1-first) (testosterone in the treatment aplastic anemia, Standone Stanozolol) and (nandrolone, phenylformic acid nandrolone nandrolone) (referring to people such as Resegotti, PanminervaMedica, the 23rd phase, the 243rd～248 page (1981), people such as MC0Onigle, Kidney Int, the 25th (2) phase, 437-444 page or leaf (1984); People such as Pavlovic-Kantera, EXPt.Hematol, the 8th (Supp8) phase, the 283rd～291 page (1980); And Kurtz, FEBSLetters, 14a (1) phase, the 105th～108 page (1982)).In addition for assistant agent, be that those that reported can improve or coordinate the material of hemopoietin or asialo-EPO effect, for example, Adrenergic agonist, Triiodothyronine, male sex hormone and BPA are (referring to Dunn, " Current Concepts in Ery-thropoiesis ", John Wiley and Sons (Chichester, England, 1983); People such as Weiland, Blut, the 44th (3) phase, the 173rd～175 (1982); Kalmanti, Kidney Ind, the 383rd～391 page of the 22nd phase (1982); Shahidi, New.EngJ.Med, the 289th phase, the 72nd～80 page (1973); People such as Fisher, Steroids, the 30th (6) phase, the 833rd～845 page (1977); People such as Urabe, J.Exp.Med, the 149th phase, the 1314th～1325 page (1979); And people such as Billat, Expt.Hematol, the the 10th (1) phase, 133-140 page or leaf (1982)), the compound that also has such class in addition, be called " factor that the short erythrocyte of liver generates " (referring to, people such as Naughton, Acta, Haemat, the 69th phase, the 171st～179 page (1983)) and " hemo-opsonin " (erythrotropins) (be described in Abstract 364 as people such as Congote, Proceedings Tth Internati-onal Cungress of Endocrinology (Quebec City, Quebec, on July 1st to 7,1984), Congote, Biochem.Biophys.Res, Comm., the the 115th (2) phase, the 447th～483 page (1983) and congote, Anal.Biochem., the 140th phase, the 428th～433 page (1984)) and " erythrogenins " (being described in J.Sury.Oncol as people such as Rothman, the 20th phase, the 105th～108 page (1982)).Designed preliminary screening, reaction with the hemopoietin of the mouse of measuring undue anoxybiotic polycythemia, this mouse uses 5-α-2 hydrogen testosterone or nandrolone (phenylformic acid nandrolone nandrolone) to handle in advance, and in after give hemopoietin of the present invention, the result who is produced is ambiguous.

Polypeptide of the present invention has purposes widely too aspect diagnosis, comprising applying marking or unlabelled form, can be used for different immunoassaies, comprise R1A, EL1SA and similar approach, equally also can be used for external and activity in vivo mensuration.Referring to for example, people such as Dunn, Expt.Hematol, the 11st (7) phase, the 590th～600 page (1983); People such as Gibson, Path-ology, the 16th phase, the 155th～156 page (1984); Krystal, ExptHematol, the 11st (7) phase, the 649th～660 page (1983); People such as Saito, Jap.J.Med, the 23rd (1) phase, the 16th～21 page (1984); People such as Nathan, NewEng.J.Med, the 308th (9) phase, the 520th～522 page (1982); And the various relevant reference of wherein quoting from of measuring.Polypeptide of the present invention, comprise according to the synthetic polypeptide of the residue sequence synthetic of the EPO that discloses first at this, also can provide of great use pure material for producing polyclonal antibody and monoclonal antibody " storehouse ", this monoclonal antibody is specifically designed to the continuous or discrete epitope of difference EPO.As an example, according to people such as Hopp, P.N.A.S. (U.S.A.) the 78th phase, the 3824th～3828 page (1981) are to the content of hydrotherapy, the initial analysis that the aminoacid sequence of his-and-hers watches VI carries out, and according to people such as Chou, Ann.Rev.Biochiem. the 47th phase, the 251st page (1978) are to the initial analysis of secondary structure, having disclosed synthetic duplicates, cross over included 41～51,116～118, and the artificial synthetic polypeptide of the continuous sequence of 144～166 amino acids residues, produce the antigenicity reaction of height probably, and the polypeptide peptide and the complete protein of synthetic, can produce usefully, immunocompetent mono-clonal and polyclonal antibody are arranged.Such antibody, be hopeful detect and the work of the related analogs of affinity purification EPO or EPO in be useful.

In order to describe, following three kinds of synthetic polypeptide have been prepared: (1) hEPO 41～57 V-P-D-T-K-V-N-F-Y-

A-W-K-R-M-E-V-G；(2)hEPO?116～128?K-E-A-I-S-P-P-D-A-

A-S-A-A；(3)hEPPO?144～166?V-Y-S-N-F-L-R-G

K-L-K-L-Y-T-G-E

-A-C-R-T-G-D-R uses aforementioned polypeptides to carry out preliminary immunization research, its result has disclosed has more weak positive reaction to hEPO 41～57, hEPO116-128 there is not appreciable reaction, hEPO144-166 is had strong positive reaction, and above result draws by the measurement of urinating the immunoprecipitation ability of EPO isolate with the people who exempts from serum antibody and 125 I marks.To the preliminary study of the activity in vivo of these three kinds of synthetic polypeptide disclosed their isolateds combine all do not have significant active.

Though determined the primary structure conformation of ripe EPO basically by the specified sequence of the mammals EPO amino-acid residue that illustrative embodiment provided, but should understand like this, promptly in the table V specific sequence of 165 amino-acid residues of monkey EPO and in the table VI specific sequence of 166 residues of human EPO, do not limit the use range of useful polypeptide provided by the present invention.The present invention also includes the material of the equipotential form of various natural EPOs, to the mammals polypeptide, as the bioactive research of human IFN-, has pointed out that they may exist in the past.(relatively, for example, in No. the 0077670th, the disclosed application of Europe Patent Office, reported human immune interferon and on its 140th, an arginine residues has been arranged, and people such as Gray, Natuxe, the 295th phase, the 503rd～508 page (1982) have also reported this kind Interferon, rabbit has glutamine on the 140th.These two kinds is feature to form " maturation " human r Interferon, rabbit sequence all.The various equipotential forms of ripe EPO polypeptide, can be on the length of its peptide sequence and/or the aminoacid deletion in its sequence, replacement, insert or add each other or compare with the sequence in table V and the VI different, its consequence then is the different ability that lies dormant in glycosylated ability.As previously mentioned, the equipotential form of a kind of human EPO that infers, being considered as included in has a methyl-sulfuric acid residue on 126.Just as expected, DNA genome and the CDNA sequence of coding EPO also may have natural equipotential form.Their the coding the above-mentioned type the equipotential polypeptide or simply use different codons to synthesize specified same polypeptide.

Except the natural equipotential form of ripe EPO, the present invention also comprises other " EPO product ", for example the fragment of the polypeptide analog of EPO and " maturation " EPO.Follow the process that people such as above-mentioned Alton openly apply for (WO/83/040553), people can design and make gene at an easy rate, this genes encoding is expressed in microorganism has certain polypeptide, the primary structure conformation of this peptide species is compared with the one-level conformation that is used for ripe EPO described herein, they have one or more different amino-acid residues in polypeptide, perhaps their the some above position difference of amino-acid residue in polypeptide, for example, have metalepsy or with middle portion the effect of adding arranged endways with the disappearance effect.In addition, CDNA and EPO genome, can be easily by known site-directed mutagenesis technology and being modified, and be used to produce analogue and the derivative of EPO.Such EPO product will have a kind of biological property of EPO at least, but then has difference in other properties.For example, the EPO product that the present invention is designed comprises that those have removed a part of DNO sequence in advance, and the shortening that produces the EPO product, disappearance (Ash for example ², des-Pro ²To Ile ⁶HEPO, (des-Thr ¹⁶³To Arg ¹⁶⁶) hEPO and " △ 27-55hEPO " and the EPO product that shortens, and the latter has the coded amino acid residue sequence of dna sequence dna that has lacked whole exons; Perhaps those are to the more stable EPO product of hydrolysis (and thereby having more more remarkable or last longer effectiveness than natural EPO); Perhaps those are by this may make the product of yeast production that higher activity is arranged except the EPO product in one or more potential sites of carrying out glycosylation); Perhaps those one or more cysteine residues are removed or the EPO product that replaced by for example Histidine or serine residue ((His for example ⁷) the hEPO analogue) and those the EPO products that can from microorganism system, separate at an easy rate with activity form; Perhaps those have one or more tyrosine residuess by EPO product that phenylalanine replaced ((Phe for example ¹⁵) hEPO, (Phe ⁴⁰) hEPO and (Phe ¹⁴⁵) the hEPO analogue) and those can be easy to be attached to EPO product on the EPO acceptor on the target cell more or less.Also comprise being the interior partial continuous aminoacid sequence of ripe EPO or the peptide fragment of secondary conformation duplicate.This fragment can have a kind of activity (for example with receptors bind) of EPO and lack other the activity (activity that for example short erythrocyte generates.This on the one hand on those possible EPO fragments particularly importantly, when considering human genome DNA's sequence of table VI, they have just been illustrated, promptly, the outline that each and every one " fragment ", intron sequences of whole continuous EPO sequence delineated out them, they may form unique biological active " zone ".It is worth mentioning, EPO product of the present invention lacks any or multiple activity in vivo this point, can not get rid of its operability in treatment all sidedly referring to people such as Weiland, the same) or its operability at other field, for example in the mensuration of EPO or the use in the EPO antagonistic action.The antagonistic action of hemopoietin may be of great use when the symptom of Sheng is crossed in the production of treatment polycyth(a)emia or EPO, (referring to, Ad am-son for example, HOSP.Practice, the 18th (12) phase, the 49th～57 page (1983), and people such as Hellmann, ClinLabHaemat, the fifth phase, the 335th～342 page (1983)).

According to a further aspect in the invention, take off herein the coding people that states and monkey EPO polypeptide the clone dna sequence dna, for providing intelligence is to possess noticeable value, be that they provide about feeding the message of class hemopoietin aminoacid sequence, although and these messages are the isolate of natural product have been done the analytical processing of many decades, still can't obtain to the present invention, these dna sequence dnas itself also are products of great use, when carrying out the synthetic hemopoietin of extensive microorganism by various recombinant technologys, has noticeable value too.From another aspect, dna sequence dna provided by the present invention is useful in following growth, promptly grow new and useful virus or circular plasmids dna vector.The new conversion with useful is crossed or the host cell (comprising the cells of mamma animals in bacterium and yeast cell and the tissue culture) the microorganism protokaryon and eucaryon of transfection, and all be of great use to the aspects such as new and useful method that the such microbial host cell that can express EPO and EPO product carries out grown cultures, dna sequence dna of the present invention, be used in separation EPO and relevant coding mammals CDNA genomic dna sequence for the probe that serves as a mark, be noticeable suitable material too, said mammals is to have pointed out the mankind and the monkey class kind in addition of special explanation herein, dna sequence dna of the present invention, in different protein synthesis method (for example in insect cell) or the use range in human and other mammiferous genetics treatments, also do not calculate at present.Dna sequence dna of the present invention is desirably in that to develop in the mammiferous research work that gene changes frausgenic over to be useful, and the cells of mamma animals that this gene changes over to might become " host " of eucaryon and produce a large amount of hemopoietins and the product of hemopoietin.Referring to people such as Palmiter, Science, the 222nd (4625) phase, the 809th～814 page (1983).

Thereby according to this viewpoint, the characteristic description that each illustrative embodiment is done significantly is not in order to limit the scope of the invention, and to the professional and technical personnel, it will be appreciated that a large amount of modifications and its change.For example, as long as explanation embodiment of the present invention provides dna sequence dna, just comprised CDNA and genomic dna sequence have been arranged, because the application provides the basic message for the aminoacid sequence of making dna sequence dna, the present invention also comprises the made dna sequence dna of setting up according to the knowledge of EPO aminoacid sequence.Their can encode EPO (as embodiment 12) and EPO fragment and EPO polypeptide analogs i.e. " EPO product ", and they have one or more biological properties of natural EPO, but do not have or have the biological property of other EPO in various degree.

Dna sequence dna provided by the present invention, comply with so, just comprise and be applicable in all protokaryons or the eukaryotic host cell and possess the dna sequence dna that assurance can be explained, expressed polypeptide product has primary structure conformation and its a kind of or various biological character of at least a portion hemopoietin, and is to select in nine kinds of following sequences: (a) dna sequence dna that provides in table V and table VI; (b) that dna sequence dna and fragment thereof of hybridizing mutually with determined dna sequence dna in (a); (C) if certain sequence does not have the merger of genetic code, with this certain dna sequence dna of the dna sequence dna hybridization of having determined at (a) with (b).What be worth proposition in this respect is that for example, we wish that the homotopic monkey that exists hybridizes with table V and the sequence of table VI or their fragment mutually with human EPO gene order and other mammiferous gene orders.Furthermore, if there is not the merger of genetic code, then SCEPO and ECEPO gene, made or lure the CDNA of friendship, or the genomic dna sequence of encode various EPO fragments and analogue, also all will with top mentioned dna sequence dna hybridization.If wish to reduce the background that non-dna material causes in the hybridization, can abide by the hybridization conditions when beginning to separate monkey and human EPO coding DNA or adopt stricter condition, under some such hybridization conditions, can carry out hybridization above-mentioned smoothly.

Similar therewith, when above-mentioned implementation the EPO product with the Fang Su of microbial expression when thereby cells of mamma animals is expressed DNA explanation microbial expression EPO product in the hybrid vector that is inserted into bacterial plasmid and viral genome source, then a large amount of various expression systems all has been included among the plan of careful inference of the present invention.Included noticeable be some expression systems like this, promptly comprise and to be used for the expression system of various bacterium, yeast and the carrier in the cells of mamma animals of tissue culture from homologous, equally yet comprise not carrier-containing expression system (for example calcium phosphate transfection of cell).In this, to it should be understood that, to the DNA in the source of monkey for example in monkey host cell tissue culture and the expression that the human host cell carried out in cultivating, in fact constitute " external source " DNA and expressed example, because sought the EPODNA that obtains high level expression, in its host's genome, had the origin of himself.Expression system of the present invention has also further been planned some such practices, the consequently tenuigenin formation effect of EPO product, with in host's tenuigenin or film, (for example accumulate in the bacterium periphery chamber, accumulating glycosylated and nonglycosylated EPO product or as above illustrated that accumulates in the supernatant liquor of tissue culture medium (TCM), or be accumulated in the quite rare system, for example (people such as Gray is at Biotechnology for the P.aeYuginosa expression system, the 2nd phase is described in the 161st～165 page (1984).

The improved hybridizing method of the present invention, can be used in the above-mentioned DNA screening by hybridization clearly equally also can be used for RNA/RNA and RNA/DNA screening.The mixed probe technology has been formed some in the crossover process prevailingly and has been improved as described herein, so that the separation of polynucleotide is more rapid and reliable, the improvement on these many methods comprises, the transfer of bacterium colony and the method for maintenance; Filter membrane with nylon matrix, for example GeneScreen (Gene Screen) and GeneScreen eurymeric (GeneScreen Plus) can use a filter membrane to hybridize with probe again again, and this filter membrane can use new egg enzyme to handle (with people such as for example Taub repeatedly, Anat, Biochem, the 126th phase, compare the 222nd～230 page (1982)); Make mix quantity greatly for example (above 32 kinds) to and the mixed probe of the concentration very low (being about 0.025 pmol) of every single kind; Each step after hybridizing and hybridize under the temperature condition of strictness, this temperature are to approach the calculated value of any minimum dissociation temperature in (promptly only within 4 ℃, be more preferably only in 2 ℃) employed mixed probe.These improvements are all combined, may be in the result who uses their times institute's unanticipated.This point can be given fully to explain by such fact, promptly used once being awarded in the spy of CDNA low UMNA of being equivalent to report in the past to screen in having become than the plaque genomic library of ground in the work, isolated only one sequence gene in 1500000 phages to enrichment newspaper by the mixed probe of four times of amounts of the used probe amount of success.Completing successfully of this work, basically the idea of delivering with people such as top Anderson of being considered takes place simultaneously, and they think that the screening method of mixed probe is " when corresponding RNA can not be obtainable, it was unpractical separating the proteinic idea of mammals ".

In the various features disclosed in the above-mentioned specification sheets, in following requirement that provides and/or accompanying drawing, no matter be with separately or in any bonded mode, all may be to become from various forms to realize important materials of the present invention.

11 cultures that the application relates to have replenished the Chinese typical culture collection center (CCTCC) that is deposited in on June 26th, 1991, the preserving number of the title of culture and ATCC thereof and CCTCC correspondence is listed in following:

Plasmid pCFM526 ATCC No.39932 CCTCC No.M91076

Plasmid pMWl ATCC No.39933 CCTCC No.M91077

Plasmid pCFM536 ATCC No.39934 CCTCC No.M91078

S.cere?YSPD4 ATCC?No.20734 CCTCC?No.M91073

S.cere?RK81 ATCC?No.20733 CCTCC?No.M91072

Plasmid p α C3 ATCC No.39881 CCTCC No.M91074

Plasmid p α YE ATCC No.39882 CCTCC No.M91075

Lambda particles phage λ HEI ATCC No.40381 CCTCC No.M91080

Plasmid pMKE83 ATCC No.67545 CCTCC No.M91082

Plasmid pCFM414 ATCC No.40076 CCTCC No.M91079

Hybrid knurl 5 F12 AD3 ATCC No.HB8209 CCTCC No.C91013

Claims (4)

1. produce the method for antibody materials, this antibody materials is characterised in that the immunoreactivity with hemopoietin and synthetic polypeptide, described synthetic polypeptide has the primary structure conformation of mainly duplicating the consecutive order of the amino-acid residue except any polypeptide that contains the amino-acid residue order that is included in fully in the following order in the natural hemopoietin: A-P-P-R-L-I-C-D-S-R-V-L-E-R-Y-L-L-E-A-K

This method comprises that cultivation can produce the cell of described antibody materials.

2. by the process of claim 1 wherein that described antibody materials is a monoclonal antibody.

3. by the process of claim 1 wherein that described antibody materials is a polyclonal antibody.

4. by claim 1,2 or 3 method, wherein said antibody materials and hemopoietin and have the synthetic polypeptide that is selected from following order and carry out immune response: V-P-D-T-K-V-N-F-Y-A-W-K-R-M-E-V-G, K-E-A-I-S-P-P-D-A-A-S-A-A, V-Y-S-N-F-L-R-G-K-L-K-L-Y-T-G-E-A-C-R-T-G-D-R.

Images