CN106282397A - Identify mating type method and the primer pair of four kinds in black Morchella esculenta (L.) Pers monoid - Google Patents
Identify mating type method and the primer pair of four kinds in black Morchella esculenta (L.) Pers monoid Download PDFInfo
- Publication number
- CN106282397A CN106282397A CN201610976065.9A CN201610976065A CN106282397A CN 106282397 A CN106282397 A CN 106282397A CN 201610976065 A CN201610976065 A CN 201610976065A CN 106282397 A CN106282397 A CN 106282397A
- Authority
- CN
- China
- Prior art keywords
- mating type
- primer
- pers
- mat1
- morchella esculenta
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to identify mating type method and the primer pair of four kinds in black Morchella esculenta (L.) Pers monoid, belong to biological technical field, the method is for extracting test strains DNA as template, with primer, P7 2F/P7 2R or P8 5F/P8 5R is carried out PCR amplification and can obtain the bacterial strain of expection band for MAT1 1 mating type, with primer P10 1F/P10 2R or P10 2F/P10 3R carried out PCR amplification can obtain expect the bacterial strain of band for MAT1 2 mating type, the bacterial strain that 2 intended amplified bands can detect then has two kinds of mating types.The mating type that can be common to above-mentioned four kinds of Morchella esculenta (L.) Perss is detected by these four primers.The testing result high specificity of the present invention, reliable and stable quickly, it is adaptable to the research in terms of Morchella esculenta (L.) Pers strain improvement, cultivation, mating type gene and phylogeny.
Description
Technical field
The invention belongs to biology techniques field, be specifically related to a kind of identify ladder rib Morchella esculenta (L.) Pers (Morchella importuna), six younger sister's Morchella esculenta (L.) Perss (Morchella sextelata), seven younger sister's Morchella esculenta (L.) Perss (Morchella septimelata)
With Morchella elata (Morchella elata) molecular detecting method of mating type and general special primer pair.The technology of the present invention is fitted
Research in terms of Morchella esculenta (L.) Pers strain improvement, cultivation, mating type gene and phylogeny.
Background technology
O ' Donnell etc. utilizes polygenes pedigree concordance phylogenetic systematics species identification method (GCPSR), based on LSU,ef1‐a、rpb1 Withrpb2 The nucleotide sequence of these 4 genes, is divided into yellow Morchella esculenta (L.) Pers offspring morchella fungus
(Esculenta Clade), black Morchella esculenta (L.) Pers offspring (Elata Clade) and the Morchella esculenta (L.) Pers offspring (Rufobrunnea that reddens
Clade).Ladder rib Morchella esculenta (L.) Pers, six younger sister's Morchella esculenta (L.) Perss, seven younger sister's Morchella esculenta (L.) Perss and Morchella elata belong to black Morchella esculenta (L.) Pers offspring.
Ascomycetous syngenesis it is now recognized that by single copulation site MAT1 control, this copulation site include with
MAT1-1 mating type that MAT1-1-1 gene is characterized and the MAT1-2 mating type being characterized with MAT1-2-1 gene.Copulation of the same clan
Ascomycetes self-fertility, and the ascomycetes self-sterility of different ancestor's copulation, it is necessary to by being respectively provided with mating type MAT1-1 and copulation
Syngenesis just can be completed after the stud mating of type MAT1-2.
In recent years, the artificial culture of ladder rib Morchella esculenta (L.) Pers and six younger sister's Morchella esculenta (L.) Perss succeeded and rose upsurge in the whole nation, a lot
Local numerous and confused large area commercial growth, but the situation of fruiting does not often occur, and whole booth or field 1 the most even occurs
Morchella esculenta (L.) Pers does not goes out, and traces it to its cause in addition to climatic environmental factor, and topmost is exactly strain problem, it is ensured that strain is reliably first
The key problem in technology wanted.
We are by the research work of early stage, obtain ladder rib Morchella esculenta (L.) Pers, six younger sister's Morchella esculenta (L.) Perss, seven younger sister's Morchella esculenta (L.) Pers and height respectively
MAT1-1-1 and the MAT1-2-1 full length gene sequence of Morchella esculenta (L.) Pers.By list cystospore mating type proportion grading and combine copulation
Site structure is analyzed, it was demonstrated that these four Morchella esculenta (L.) Pers is all different ancestor mating type fungus, and sexual reproduction (fruiting) needs two kinds to join
Type individuality combines and just can complete.The spore separation of Morchella esculenta (L.) Pers and separate tissue are likely to have to the bacterial strain of a kind of mating type,
And the Subculture of strain also there will be the phenomenon that a kind of mating type is lost.Therefore, the detection to strain mating type is
Obtain the key of effective cultivated strains.
Summary of the invention
The invention aims to solve the deficiencies in the prior art, it is provided that a kind of identify in black Morchella esculenta (L.) Pers monoid four
The mating type method planted and general special primer pair, the presence or absence of band after PCR being expanded by special primer, identify ladder rib Gaster caprae seu Ovis
Bacterium, six younger sister's Morchella esculenta (L.) Perss, seven younger sister's Morchella esculenta (L.) Perss and the mating type of Morchella elata bacterial strain, determine whether as effective cultivated strains.Draw
Thing is to being common to four kinds of Morchella esculenta (L.) Pers bacterial strains, and method is easy and result is reliable and stable.
For achieving the above object, the technical solution used in the present invention is as follows:
Identify the mating type method of four kinds in black Morchella esculenta (L.) Pers monoid, including the special primer for detecting mating type MAT1-1
To P7-2F/P7-2R or P8-5F/P8-5R, for detect the special primer of mating type MAT1-2 to P10-1F/P10-2R or
P10-2F/P10-3R, corresponding PCR amplification system and amplification program；
Described P7-2F/P7-2R special primer pair:
The nucleotides sequence of P7-2F is classified as 5 '-CCGGTTTATCTTACTGGACTGGTTC-3 '；(SEQ ID No.1)
The nucleotides sequence of P7-2R is classified as 5 '-GCTTTCCTCTTCTCTCGTTGCCATA-3 '；(SEQ ID No.2)
Described P8-5F/P8-5R special primer pair:
The nucleotides sequence of P8-5F is classified as 5 '-ATGTCACTCCGTCCGGTTTACCTTA-3 ', (SEQ ID No.3)
The nucleotides sequence of P8-5R is classified as 5 '-TGGAATGTCTGTGATTGAGGCTGTG-3 '；(SEQ ID No.4)
Described P10-1F/P10-2R special primer pair:
The nucleotides sequence of P10-1F is classified as 5 '-GGCCAGAACAGATGCTCGAAGAAGC-3 ', (SEQ ID No.5)
The nucleotides sequence of P10-2R is classified as 5 '-CTCCCAAAGCATGATCAAATCCCTC-3 '；(SEQ ID No.6)
Described P10-2F/P10-3R special primer pair:
The nucleotides sequence of P10-2F is classified as 5 '-AGACCGCTTTAGATAGATTGGCAGG-3 ', (SEQ ID No.7)
The nucleotides sequence of P10-3R is classified as 5 '-GATCAAATCCCTCCATTAAGGCATC-3 '.(SEQ ID No.8)
It is further preferred that identify that mating type MAT1-1 is identical with the PCR amplification system of MAT1-2, all include 2 × PCRmix
Each 1 L of forward and reverse primer of 12.5 L, 10 M/L, DNA profiling 10ng, ddH2O complements to 25 L.
It is further preferred that P7-2F/P7-2R is identified the PCR amplification of the MAT1-1 mating type of bacterial strain by special primer
Program is: 94 DEG C of denaturation 3 min；94 DEG C of degeneration 30 sec, 62 DEG C of annealing 30 sec, 72 DEG C extend 40 sec, 30 circulations；
72 DEG C extend 10 min；
P8-5F/P8-5R is identified that the PCR amplification program of the MAT1-1 mating type of bacterial strain is: 94 DEG C of denaturations 3 by special primer
min；94 DEG C of degeneration 30 sec, 65 DEG C of annealing 30 sec, 72 DEG C extend 90 sec, 30 circulations；72 DEG C extend 10 min.
When P7-2F/P7-2R is detected the MAT1-1 mating type of bacterial strain by special primer, it is possible to obtain size is about 0.6kb's
Unique band；When P8-5F/P8-5R is detected bacterial strain MAT1-1 mating type by special primer, it is possible to obtain size is about 1.7kb's
Unique band.
It is further preferred that P10-1F/P10-2R and P10-2F/P10-3R is identified the MAT1-of bacterial strain by special primer
The PCR amplification program of 2 mating types is identical, is: 94 DEG C of denaturation 3 min；94 DEG C of degeneration 30 sec, 64 DEG C of annealing 30 sec,
72 DEG C extend 60 sec, 30 circulations；72 DEG C extend 10 min.
Special primer is to P10-1F/P10-2R, during detection bacterial strain MAT1-2 mating type, it is possible to obtain size is about 1.1kb
Unique band；When P10-2F/P10-3R is detected bacterial strain MAT1-2 mating type by special primer, it is possible to obtain size is about
Unique band of 1.0kb.
The present invention provides and identifies the PCR primer pair of the mating type of four kinds in black Morchella esculenta (L.) Pers monoid: include for detecting
The special primer of mating type MAT1-1 is to for P7-2F/P7-2R or P8-5F/P8-5R, and for detecting mating type MAT1-2
Special primer is to for P10-1F/P10-2R or P10-2F/P10-3R.
The present invention is also claimed above-mentioned PCR primer to identifying the mating type of four kinds in black Morchella esculenta (L.) Pers monoid
Reagent and test kit.
The present invention also provide for above-mentioned PCR primer to, reagent or test kit four kinds in identifying black Morchella esculenta (L.) Pers monoid
In mating type or the application of black Morchella esculenta (L.) Pers breeding.
In the present invention, utilize P7-2F/P7-2R primer that PCR amplifies the unique band of about 0.6kb, or P8-5F/
P8-5R primer amplifies the unique band of about 1.7kb to PCR, shows that bacterial strain contains MAT1-1 mating type；Utilize P10-1F/P10-
2R primer amplifies the unique band of about 1.1kb to PCR, or P10-2F/P10-3R primer amplifies about 1.0kb to PCR
Unique band, shows that bacterial strain contains MAT1-2 mating type；If detection bacterial strain can detect two intended bands, illustrate that this bacterial strain is
Containing the bacterial strain of two kinds of mating types, as effective cultivated strains, and a wherein intended band can be only detected, this is described
Bacterial strain is the bacterial strain only with a kind of mating type, it is impossible to be used for cultivating, can be as the alternative bacterial strain of cross-breeding.
Terraced rib Morchella esculenta (L.) Pers, six younger sister's Morchella esculenta (L.) Perss, seven younger sister's Morchella esculenta (L.) Perss and the high Gaster caprae seu Ovis that the present invention obtains based on previous research work
The feature of two copulation gene orders of bacterium, devises four pairs of special primers, can be common to these four Morchella esculenta (L.) Pers bacterial strain MAT1-1
Detection with MAT1-2 mating type.Amplified band is single band, and the presence or absence of band i.e. can determine that the mating type of bacterial strain, and result is steady
Fixed reliable.
Four kinds of Morchella esculenta (L.) Pers copulation gene orders involved in the present invention and detection method are not all reported at present both at home and abroad.This
Four pairs of special primers pair in invention, all can be common to the detection of four kinds of Morchella esculenta (L.) Pers mating types, for the sexual life of Morchella esculenta (L.) Pers
Grow the most significant with phyletic evolution research.
Primer can be common to the MAT1-1 mating type of above-mentioned four kinds of Morchella esculenta (L.) Perss to P7-2F/P7-2R or P8-5F/P8-5R
Detection.
Primer can be common to the MAT1-2 of above-mentioned four kinds of Morchella esculenta (L.) Perss and hand over P10-1F/P10-2R or P10-2F/P10-3R
Distribution type detects.
Compared with prior art, it has the beneficial effect that the present invention
Ladder rib Morchella esculenta (L.) Pers, six younger sister's Morchella esculenta (L.) Perss, seven younger sister's Morchella esculenta (L.) Perss, Morchella elata MAT1-1-1 and the current state of MAT1-2-1 gene order
Inside and outside all have no report, four pairs of special primers pair of the present invention, these four Morchella esculenta (L.) Pers copulation gene can be common to and guard section
Amplification, can be identified the mating type of bacterial strain by the presence or absence of amplified band, method is easy and result is reliable and stable.Little 4
Time interior can complete a complete set of testing process, the testing cost of each sample only needs about 50 yuan.The method can also be used further
Research in terms of Morchella esculenta (L.) Pers syngenesis and phyletic evolution.
Accompanying drawing explanation
Fig. 1 is ladder rib Morchella esculenta (L.) Pers YPL2 list cystospore strain mating type detection electrophoretogram.A:P8-5F/P8-5R primer pair
Amplification copulation gene M AT1-1-1；B:P10-1F/P10-2R primer pair amplifies copulation gene M AT1-2-1.M represents Marker-
In DL2000(figure, band from top to bottom is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp)；1 ~ 24 generation
Table ladder rib Morchella esculenta (L.) Pers list cystospore bacterial strain YPL2-1 ~ YPL2-24.
Fig. 2 is six younger sister's Morchella esculenta (L.) Pers HL1 list cystospore strain mating type detection electrophoretograms.M represents Marker-DL2000
(in figure band be followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp) from top to bottom；1 ~ 12 representative strain HL1-1 ~
HL1-12 primer expands copulation gene M AT1-1-1 to P7-2F/P7-2R；13-24 representative strain HL1-1 ~ HL1-12 primer
P10-2F/P10-3R is expanded copulation gene M AT1-2-1.
Fig. 3 is that Morchella elata 2688 list cystospore strain mating type detects electrophoretogram.M represents Marker-DL2000(figure
In band from top to bottom be followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp)；1 ~ 12 representative strain 23-S1 ~ 23-
S12 primer expands copulation gene M AT1-1-1 to P7-2F/P7-2R；13 ~ 24 representative strain 23-S1 ~ 23-S12 primer pair
P10-2F/P10-3R expands copulation gene M AT1-2-1.
Fig. 4 is that the effective cultivated strains of Morchella esculenta (L.) Pers detects electrophoretogram.M represents in Marker-DL2000(figure bar from top to bottom
Band is followed successively by 2000bp, 1000bp, 750bp, 500bp)；1,2,3,4 respectively representative strain YPL2, YPL6, HL1, HL2 with drawing
Thing expands copulation gene M AT1-1-1 to P7-2F/P7-2R；5,6,7,8 respectively representative strain YPL2, YPL6, HL1, HL2 with drawing
Thing expands copulation gene M AT1-2-1 to P10-2F/P10-3R；CK represents the negative control not adding template.
Fig. 5 is seven younger sister's Morchella esculenta (L.) Pers 3712 list cystospore strain mating type detection electrophoretograms.M represents Marker-DL2000
(in figure band be followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp) from top to bottom；1 ~ 12 representative strain
3712-10 ~ 3712-21 primer expands copulation gene M AT1-1-1 to P8-5F/P8-5R；13 ~ 24 representative strain 3712-10 ~
3712-21 primer expands copulation gene M AT1-2-1 to P10-1F/P10-2R.
Detailed description of the invention
Below in conjunction with embodiment, the present invention is described in further detail.
It will be understood to those of skill in the art that the following example is merely to illustrate the present invention, and should not be regarded as limiting this
Bright scope.Unreceipted concrete technology or condition person in embodiment, according to the technology described by the document in this area or condition
Or carry out according to product description.Agents useful for same or instrument unreceipted production firm person, be and can be obtained by purchase
Conventional products.
Embodiment 1 ladder rib Morchella esculenta (L.) Pers YPL2 list cystospore strain mating type is identified
Ladder rib Morchella esculenta (L.) Pers list cystospore bacterial strain YPL2-1 YPL2-24 is seeded in PDA culture medium, cultivates 10d, picking for 23 DEG C
Appropriate mycelium, CTAB method is extracted DNA, is taken 3 L in 1% (W/V) agarose gel electrophoresis detection DNA mass and concentration.
Respectively with the DNA of YPL2-1 YPL2-24 as template, with primer P8-5F/P8-5R carried out PCR amplification: 25 L
Amplification system includes 2 × PCRmix(TSINGKE Bio Inc) P8-5F, P8-5R primer each 1 of 12.5 L, 10 M/L
L, DNA profiling 1 L, ddH2O 9.5 µL.PCR amplification program is: 94 DEG C of denaturation 3 min；94 DEG C of degeneration 30 sec, 65 DEG C are moved back
Fire 30 sec, 72 DEG C extend 90 sec, 30 circulations；72 DEG C extend 10 min.
Respectively with the DNA of YPL2-1 YPL2-24 as template, with primer P10-1F/P10-2R carried out PCR amplification, 25
L amplification system includes 2 × PCRmix(TSINGKE Bio Inc) P10-1F, P10-2R primer of 12.5 L, 10 M/L is each
1 L, DNA profiling 1 L, ddH2O 9.5µL.PCR amplification program is: 94 DEG C of denaturation 3 min；94 DEG C of degeneration 30 sec, 64
DEG C annealing 30 sec, 72 DEG C extend 60 sec, 30 circulation；72 DEG C extend 10 min.
All amplified productions are electrophoresis detection on 1.2% (W/V) agarose gel, and result is shown in A and B of Fig. 1, bacterial strain YP2-
2、YPL2-8、YPL2-10、YPL2-12、YPL2-13、YP2-14、YPL2-16、YPL2-17、YPL2-18、YPL2-21、YPL2-
22, YPL2-23, YPL2-24 have the unique band of about 1.7kb when P8-5F/P8-5R is expanded by primer, and with primer to P10-
Without band during 1F/P10-2R amplification, it is accredited as mating type MAT1-1 bacterial strain.And bacterial strain YP2-1, YPL2-3, YPL2-4, YPL2-
5, P8-5F/P8-5R is expanded by YPL2-6, YP2-7, YPL2-9, YPL2-11, YPL2-15, YPL2-19, YPL2-20 at primer
Time without band, and when P10-1F/P10-2R is expanded by primer, have the unique band of about 1.1kb, be accredited as mating type MAT1-2 bacterium
Strain.
Embodiment 2 six younger sister's Morchella esculenta (L.) Pers HL1 list cystospore strain mating type is identified
Six younger sister Morchella esculenta (L.) Pers list cystospore bacterial strain HL1-1 HL1-12 are seeded in PDA culture medium, cultivate 10d for 23 DEG C, and picking is fitted
Amount mycelium, CTAB method is extracted DNA, is taken 3 L and detect DNA mass and concentration at 1% agarose gel electrophoresis.
Respectively with the DNA of HL1-1 HL1-12 as template, with primer, P7-2F/P7-2R being carried out PCR amplification, 25 L expand
Increasing system includes 2 × PCRmix(TSINGKE Bio Inc) each 1 L of P7-2F, P7-2R primer of 12.5 L, 10 M/L,
DNA profiling 1 L, ddH2O 9.5 µL.PCR amplification program is: 94 DEG C of denaturation 3 min；94 DEG C of degeneration 30 sec, 62 DEG C of annealing
30 sec, 72 DEG C extend 40 sec, 30 circulations；72 DEG C extend 10 min.
Respectively with the DNA of HL1-1 HL1-12 as template, with primer, P10-2F/P10-3R carried out PCR amplification, 25 L
Amplification system includes 2 × PCRmix(TSINGKE Bio Inc) P10-2F, P10-3R primer each 1 of 12.5 L, 10 M/L
L, DNA profiling 1 L, ddH2O 9.5µL.PCR amplification program is: 94 DEG C of denaturation 3 min；94 DEG C of degeneration 30 sec, 64 DEG C
Anneal 30 sec, and 72 DEG C extend 60 sec, 30 circulations；72 DEG C extend 10 min.
All amplified productions are electrophoresis detection on 1.2% agarose gel, and result is shown in Fig. 2, bacterial strain HL1-1, HL1-5, HL1-
6, HL1-7, HL1-9, HL1-10 only have primer that P7-2F/P7-2R amplifies about 0.6kb band, for MAT1-1 mating type；
Bacterial strain HL1-3, HL1-8, HL1-11, HL1-12 only have primer that P10-2F/P10-3R amplifies about 1.0kb band, for
MAT1-2 mating type；And two primers of bacterial strain HL1-2, HL1-4 are to all amplifying band, comprise two kinds of mating types.
Embodiment 3 Morchella elata 2688 list cystospore strain mating type is identified
Morchella elata list cystospore bacterial strain 23-S1 23-S12 is seeded in PDA culture medium, cultivates 10d for 23 DEG C, and picking is appropriate
Mycelium, CTAB method is extracted DNA, is taken 3 L and detect DNA mass and concentration at 1% agarose gel electrophoresis.
With primer, P7-2F/P7-2R and P10-2F/P10-3R being carried out mating type detection, operating procedure is with embodiment 2.
All amplified productions are electrophoresis detection on 1.2% agarose gel, and result is shown in Fig. 3, bacterial strain 23-S3,23-S7,23-
S9,23-S10,23-S11 only have primer that P7-2F/P7-2R amplifies about 0.6kb band, for MAT1-1 mating type；Bacterial strain
23-S1,23-S2,23-S4,23-S15,23-S6,23-S8,23-S12 only have primer that P10-2F/P10-3R is amplified 1.0kb
Left and right band, for MAT1-2 mating type.
Embodiment 4 ladder rib bacterial strain and the six effective cultivated strains of younger sister's Morchella esculenta (L.) Pers are identified
Ladder rib Morchella esculenta (L.) Pers bacterial strain YPL2, YPL6 and six younger sister Morchella esculenta (L.) Pers bacterial strain HL1, HL2 is seeded in PDA culture medium, 23 DEG C of cultivations
10d, the appropriate mycelium of picking, CTAB method is extracted DNA, is taken 3 L and detect DNA mass and concentration at 1% agarose gel electrophoresis.
With primer, P7-2F/P7-2R and P10-2F/P10-3R being carried out mating type detection, operating procedure is with embodiment 2.
All amplified productions are electrophoresis detection on 1.2% agarose gel, result see Fig. 4, bacterial strain YPL6, YPL2, HL1,
HL2, shows to comprise two kinds of mating types to amplifying expection band with two primers, can be as effective cultivated strains.By mirror
After fixed effective cultivated strains bacterial strain YPL6 and HL1 plantation, fruiting the most, and 4 bacterial strains containing only a kind of mating type all do not go out
Mushroom.
Embodiment 5 seven younger sister's Morchella esculenta (L.) Pers 3712 list cystospore strain mating type is identified
Seven younger sister's Morchella esculenta (L.) Pers 3712 list cystospore bacterial strain 3712-10 3712-21 are seeded in PDA culture medium, 23 DEG C of cultivations
10d, the appropriate mycelium of picking, CTAB method is extracted DNA, is taken 3 L and detect DNA mass and concentration at 1% agarose gel electrophoresis.
With primer, P8-5F/P8-5R and P10-1F/P10-2R being carried out mating type detection, operating procedure is with embodiment 1.
All amplified productions are electrophoresis detection on 1.2% agarose gel, result see Fig. 5, bacterial strain 3712-1,3712-5,
3712-8,3712-9 only have primer that P8-5F/P8-5R amplifies about 1.7kb band, for MAT1-1 mating type；Bacterial strain
3712-2,3712-3,3712-4,3712-6,3712-7,3712-10,3712-11,3712-12 only have primer to P10-1F/
P10-2R amplifies about 1.1kb band, for MAT1-2 mating type.
The ultimate principle of the present invention, principal character and advantages of the present invention have more than been shown and described.The technical staff of the industry
It should be appreciated that the present invention is not restricted to the described embodiments, described in above-described embodiment and description, the present invention is simply described
Principle, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, these change and
Improvement both falls within scope of the claimed invention.Claimed scope is by appending claims and equivalence thereof
Thing defines.
Sequence table
SEQ ID No.1
CCGGTTTATC TTACTGGACT GGTTC 25
SEQ ID No.2
GCTTTCCTCT TCTCTCGTTG CCATA 25
SEQ ID No.3
ATGTCACTCC GTCCGGTTTA CCTTA 25
SEQ ID No.4
TGGAATGTCT GTGATTGAGG CTGTG 25
SEQ ID No.5
GGCCAGAACA GATGCTCGAA GAAGC 25
SEQ ID No.6
CTCCCAAAGC ATGATCAAAT CCCTC 25
SEQ ID No.7
AGACCGCTTT AGATAGATTG GCAGG 25
SEQ ID No.8
GATCAAATCC CTCCATTAAG GCATC 25
SEQUENCE LISTING
<110>KUNMING INST OF BOTANY CAS
<120>mating type method and the primer pair of four kinds in black Morchella esculenta (L.) Pers monoid are identified
<130>
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 25
<212> DNA
<213>artificial sequence
<400> 1
CCGGTTTATC TTACTGGACT GGTTC 25
<210> 2
<211> 25
<212> DNA
<213>artificial sequence
<400> 2
GCTTTCCTCT TCTCTCGTTG CCATA 25
<210> 3
<211> 25
<212> DNA
<213>artificial sequence
<400> 3
ATGTCACTCC GTCCGGTTTA CCTTA 25
<210> 4
<211> 25
<212> DNA
<213>artificial sequence
<400> 4
TGGAATGTCT GTGATTGAGG CTGTG 25
<210> 5
<211> 25
<212> DNA
<213>artificial sequence
<400> 5
GGCCAGAACA GATGCTCGAA GAAGC 25
<210> 6
<211> 25
<212> DNA
<213>artificial sequence
<400> 6
CTCCCAAAGC ATGATCAAAT CCCTC 25
<210> 7
<211> 25
<212> DNA
<213>artificial sequence
<400> 7
AGACCGCTTT AGATAGATTG GCAGG 25
<210> 8
<211> 25
<212> DNA
<213>artificial sequence
<400> 8
GATCAAATCC CTCCATTAAG GCATC 25
Claims (10)
1. identify the mating type method of four kinds in black Morchella esculenta (L.) Pers monoid, it is characterised in that include for detecting mating type
The special primer of MAT1-1 is to P7-2F/P7-2R or P8-5F/P8-5R, for detecting the special primer pair of mating type MAT1-2
P10-1F/P10-2R or P10-2F/P10-3R, corresponding PCR amplification system and amplification program；
Described P7-2F/P7-2R special primer centering, the nucleotides sequence of P7-2F is classified as 5 '-
The nucleotides sequence of CCGGTTTATCTTACTGGACTGGTTC-3 ', P7-2R is classified as 5 '-GCTTTCCTCTTCTCTCGTTGCCATA
-3’ ；
Described P8-5F/P8-5R special primer centering, the nucleotides sequence of P8-5F is classified as 5 '-
The nucleotides sequence of ATGTCACTCCGTCCGGTTTACCTTA-3 ', P8-5R is classified as 5 '-
TGGAATGTCTGTGATTGAGGCTGTG -3’ ；
Described P10-1F/P10-2R special primer centering, the nucleotides sequence of P10-1F is classified as 5 '-
The nucleotides sequence of GGCCAGAACAGATGCTCGAAGAAGC-3 ', P10-2R is classified as 5 '-
CTCCCAAAGCATGATCAAATCCCTC -3’ ；
Described P10-2F/P10-3R special primer centering, the nucleotides sequence of P10-2F is classified as 5 '-
The nucleotides sequence of AGACCGCTTTAGATAGATTGGCAGG-3 ', P10-3R is classified as 5 '-
GATCAAATCCCTCCATTAAGGCATC -3’。
The mating type method of four kinds in qualification black Morchella esculenta (L.) Pers monoid the most according to claim 1, it is characterised in that mirror
Determining mating type MAT1-1 identical with the PCR amplification system of MAT1-2, all include 2 × PCRmix 12.5 L, 10 M/L's is forward and reverse
Each 1 L of primer, DNA profiling 10ng, ddH2O complements to 25 L.
The mating type method of four kinds in qualification black Morchella esculenta (L.) Pers monoid the most according to claim 2, it is characterised in that special
P7-2F/P7-2R is identified that the PCR amplification program of the MAT1-1 mating type of bacterial strain is by different primer: 94 DEG C of denaturation 3 min；94℃
Degeneration 30 sec, 62 DEG C of annealing 30 sec, 72 DEG C extend 40 sec, 30 circulations；72 DEG C extend 10 min；
P8-5F/P8-5R is identified that the PCR amplification program of the MAT1-1 mating type of bacterial strain is: 94 DEG C of denaturations 3 by special primer
min；94 DEG C of degeneration 30 sec, 65 DEG C of annealing 30 sec, 72 DEG C extend 90 sec, 30 circulations；72 DEG C extend 10 min.
The mating type method of four kinds in qualification black Morchella esculenta (L.) Pers monoid the most according to claim 3, it is characterised in that special
When P7-2F/P7-2R is detected the MAT1-1 mating type of bacterial strain by different primer, it is possible to obtain size is about unique band of 0.6kb；
When P8-5F/P8-5R is detected bacterial strain MAT1-1 mating type by special primer, it is possible to obtain size is about unique band of 1.7kb.
The mating type method of four kinds in qualification black Morchella esculenta (L.) Pers monoid the most according to claim 2, it is characterised in that special
P10-1F/P10-2R with P10-2F/P10-3R is identified that the PCR amplification program of the MAT1-2 mating type of bacterial strain is identical by different primer,
It is: 94 DEG C of denaturation 3 min；94 DEG C of degeneration 30 sec, 64 DEG C of annealing 30 sec, 72 DEG C extend 60 sec, 30 circulations；72
DEG C extend 10 min.
The mating type method of four kinds in qualification black Morchella esculenta (L.) Pers monoid the most according to claim 5, it is characterised in that special
Different primer is to P10-1F/P10-2R, during detection bacterial strain MAT1-2 mating type, it is possible to obtain size is about unique band of 1.1kb；
When P10-2F/P10-3R is detected bacterial strain MAT1-2 mating type by special primer, it is possible to obtain size is about unique bar of 1.0kb
Band.
7. identify the PCR primer pair of the mating type of four kinds in black Morchella esculenta (L.) Pers monoid, it is characterised in that: include for detecting friendship
The special primer of distribution type MAT1-1 is to for P7-2F/P7-2R or P8-5F/P8-5R, and for detecting the spy of mating type MAT1-2
Different primer is to for P10-1F/P10-2R or P10-2F/P10-3R.
8. contain the PCR primer described in claim 7 to identifying the examination of the mating type of four kinds in black Morchella esculenta (L.) Pers monoid
Agent.
9. contain the PCR primer described in claim 7 to identifying the reagent of the mating type of four kinds in black Morchella esculenta (L.) Pers monoid
Box.
10. the reagent described in, claim 8 or the test kit described in claim 9 are existed by the PCR primer described in claim 7
Identify in black Morchella esculenta (L.) Pers monoid in the mating type of four kinds or the application of black Morchella esculenta (L.) Pers breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610976065.9A CN106282397B (en) | 2016-11-07 | 2016-11-07 | Identify four kinds in black hickory chick monoid of mating type method and primer pair |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610976065.9A CN106282397B (en) | 2016-11-07 | 2016-11-07 | Identify four kinds in black hickory chick monoid of mating type method and primer pair |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106282397A true CN106282397A (en) | 2017-01-04 |
| CN106282397B CN106282397B (en) | 2019-09-20 |
Family
ID=57721024
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610976065.9A Active CN106282397B (en) | 2016-11-07 | 2016-11-07 | Identify four kinds in black hickory chick monoid of mating type method and primer pair |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106282397B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107151698A (en) * | 2017-04-01 | 2017-09-12 | 中国科学院昆明植物研究所 | Identify the mating type method of 11 kinds in black hickory chick monoid |
| CN109628625A (en) * | 2018-12-07 | 2019-04-16 | 广东东阳光药业有限公司 | Identify specific primer, the kit, method and its application of six younger sister hickory chicks |
| CN109628626A (en) * | 2018-12-07 | 2019-04-16 | 广东东阳光药业有限公司 | Identify specific primer, the kit, method and its application of terraced rib hickory chick |
| CN111500759A (en) * | 2020-05-07 | 2020-08-07 | 云南菌视界生物科技有限公司 | Method and primer pair for identifying mating type genes of commercially-cultured morchella species |
| CN116970602A (en) * | 2023-03-24 | 2023-10-31 | 中国科学院昆明植物研究所 | Species-specific primers for Morchella esculenta, morchella esculenta and Morchella terranei and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101649350A (en) * | 2009-06-01 | 2010-02-17 | 中国农业大学 | Molecular detection method for rapidly distinguishing mating types of Chinese caterpillar fungus |
-
2016
- 2016-11-07 CN CN201610976065.9A patent/CN106282397B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101649350A (en) * | 2009-06-01 | 2010-02-17 | 中国农业大学 | Molecular detection method for rapidly distinguishing mating types of Chinese caterpillar fungus |
Non-Patent Citations (3)
| Title |
|---|
| S. POGGELER: "Mating-type genes for classical strain improvements of ascomycetes", 《APPL MICROBIOL BIOTECHNOL》 * |
| XI-HUI DU 等: "A review on research advances, issues, and perspectives of morels", 《MYCOLOGY》 * |
| 杜习慧 等: "羊肚菌的多样性、演化历史及栽培研究进展", 《菌物学报》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107151698A (en) * | 2017-04-01 | 2017-09-12 | 中国科学院昆明植物研究所 | Identify the mating type method of 11 kinds in black hickory chick monoid |
| CN107151698B (en) * | 2017-04-01 | 2020-10-02 | 中国科学院昆明植物研究所 | Method for identifying mating types of eleven black morchella flora |
| CN109628625A (en) * | 2018-12-07 | 2019-04-16 | 广东东阳光药业有限公司 | Identify specific primer, the kit, method and its application of six younger sister hickory chicks |
| CN109628626A (en) * | 2018-12-07 | 2019-04-16 | 广东东阳光药业有限公司 | Identify specific primer, the kit, method and its application of terraced rib hickory chick |
| CN109628625B (en) * | 2018-12-07 | 2022-08-12 | 东莞东阳光保健品研发有限公司 | Specific primer, kit and method for identifying morchella esculenta and application of specific primer, kit and method |
| CN111500759A (en) * | 2020-05-07 | 2020-08-07 | 云南菌视界生物科技有限公司 | Method and primer pair for identifying mating type genes of commercially-cultured morchella species |
| CN116970602A (en) * | 2023-03-24 | 2023-10-31 | 中国科学院昆明植物研究所 | Species-specific primers for Morchella esculenta, morchella esculenta and Morchella terranei and application thereof |
| CN116970602B (en) * | 2023-03-24 | 2024-01-19 | 中国科学院昆明植物研究所 | Species-specific primers for Morchella esculenta, morchella esculenta and Morchella terranei and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106282397B (en) | 2019-09-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106282397A (en) | Identify mating type method and the primer pair of four kinds in black Morchella esculenta (L.) Pers monoid | |
| CN110241249B (en) | Primer and method for rapidly detecting pathogen of agaricus bisporus wart spongiform in covering soil | |
| CN107151698B (en) | Method for identifying mating types of eleven black morchella flora | |
| CN111534621A (en) | Primer and detection method for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of colletotrichum gloeosporioides | |
| CN106282396B (en) | Identify the method and primer pair of terraced rib hickory chick mating type | |
| CN104946760B (en) | A kind of method and dedicated kit for detecting Pythium inflatum | |
| CN106591489A (en) | Rice grain length gene GW7 molecular marker and special primer sequences thereof | |
| KR101615433B1 (en) | SNP marker for identifying the antlered form Ganoderma lucidum, and identifying method using the same | |
| Nieuwenhuis et al. | On the asymmetry of mating in natural populations of the mushroom fungus Schizophyllum commune | |
| CN102220320B (en) | Specific molecular marker of volvariella volvacea V23 strain as well as obtaining method and application thereof | |
| CN111850155A (en) | Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection | |
| CN112662804B (en) | Primer group, kit and method for detecting pathogenic variation of avirulence gene AvrPi9 of rice blast | |
| CN113215302B (en) | InDel molecular marker and method for identifying mating types B of different monokaryons of same strain of shiitake mushroom | |
| CN112779274B (en) | Ribosomal RNA gene of mulberry plaster disease pathogenic bacteria and application thereof | |
| CN113122650A (en) | Fruit phytophthora infestans detection method and application thereof | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| CN102181544B (en) | Molecular detection method for pisolithus tinctorius of forest ectomycorrhizal fungi | |
| CN114891920B (en) | Primer for identifying double-single hybrid heterozygote of shiitake mushroom and identification method thereof | |
| CN117004751B (en) | Molecular detection target g7594 of Fusarium solani (Fusarium solani) and application thereof | |
| KR102260717B1 (en) | Composition for identification of a mutant of a Pleurotus ostreatus cap color and identification method using the same | |
| CN111187851B (en) | Specific molecular marker primer of rice blast resistance gene Pi-kf2 (t) and application | |
| CN109666761B (en) | Specific DNA fragment for identifying thelephora ganbajun zang, amplification primer, preparation method and application thereof | |
| CN116463338B (en) | Specific detection target g2339 of phytophthora parasitica and application thereof | |
| CN111321238A (en) | Method for identifying mating types of twenty-two species in yellow morchella flora | |
| KR101919313B1 (en) | Primer set for the simultaneous detection of the toxigenic or nontoxigenic Clostridium tetani, diagnostic kit using the same and diagnostic method using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |