CN106282390A - Lycium barbarum and Fructus Lycii SNP rapid identification method - Google Patents
Lycium barbarum and Fructus Lycii SNP rapid identification method Download PDFInfo
- Publication number
- CN106282390A CN106282390A CN201610922313.1A CN201610922313A CN106282390A CN 106282390 A CN106282390 A CN 106282390A CN 201610922313 A CN201610922313 A CN 201610922313A CN 106282390 A CN106282390 A CN 106282390A
- Authority
- CN
- China
- Prior art keywords
- fructus lycii
- lycium barbarum
- seq
- sequence
- sequence shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Plant Substances (AREA)
Abstract
The invention discloses a kind of lycium barbarum and Fructus Lycii SNP rapid identification method, it comprises the steps: 1) with testing sample DNA as template, amplification is containing the sequence shown in SEQ ID No.1；2) amplified production is checked order, analyze the sequence shown in SEQ ID No.1, if the 97th, the 173rd is C from 5 ' of sequence shown in SEQ ID No.1 ends, 200th is G, then it is accredited as lycium barbarum, if the 97th, the 173rd is T from 5 ' of sequence shown in SEQ ID No.1 ends, the 200th is A, then be accredited as Fructus Lycii.The present invention is capable of lycium barbarum, the former plant of Fructus Lycii, medical material and drink raw quick, the precise Identification of sheet.
Description
Technical field
The invention belongs to Chinese crude drug source cultivar identification technical field, be specifically related to identify Ningxia Chinese holly by SNP marker
Qi and the method for Fructus Lycii.
Background technology
Lycium barbarum (Lycium barbarum) and Fructus Lycii (Lycium chinense) are Solanaceae Lycium,
2015 version " Chinese Pharmacopoeia " record the source that dry root bark is Chinese crude drug Cortex Lycii both this.Additionally, " Chinese Pharmacopoeia " is also
The exclusive source that dry mature fruit is Chinese crude drug Fructus Lycii of regulation lycium barbarum Lycium barbarum L., and Fructus Lycii
The fruit of Lycium chinense Mill. is not made medicinal.Both this, on appearance character, difference is less, and diagnostic characteristics is seed
Size, in view of lycium barbarum industrial benefit is considerable, lycium barbarum is belonged to together the fruit of nearly edge species Fructus Lycii as Fructus Lycii by operator
Son is commercially sold, and the latter is cheap, the production cost of Fructus Lycii deep processed product is greatly reduced, thus operator can
Therefrom seek more high profit.For safeguarding consumer's interests, it is ensured that drug quality, needing to find a kind of reliable and stable method will be peaceful
Summer Fructus Lycii and Fructus Lycii are identified differentiation.
Summary of the invention
First purpose of the present invention is to provide lycium barbarum and Fructus Lycii qualification SNP.
Second purpose of the present invention is to provide lycium barbarum and Fructus Lycii qualification SNP in lycium barbarum and Fructus Lycii are identified
Application.
The 3rd purpose of the present invention is to provide lycium barbarum and Fructus Lycii SNP rapid identification method.
The lycium barbarum of present invention offer and Fructus Lycii qualification SNP, from nucleotide sequence as shown in SEQ ID No.1, its
In, shown in SEQ ID No.1 the 5 ' of sequence held the 97th, the 173rd for C or T, the 200th is G or A.
The SNP that the present invention provides can be used for identifying lycium barbarum and Fructus Lycii, if from shown in SEQ ID No.1 the 5 ' of sequence
Having held the 97th, the 173rd is C, and the 200th is G, then be accredited as lycium barbarum, if from sequence shown in SEQ ID No.1
5 ' held the 97th, the 173rd for T, the 200th is A, then be accredited as Fructus Lycii.
The lycium barbarum of present invention offer and Fructus Lycii SNP rapid identification method, it comprises the steps:
1) with testing sample DNA as template, the amplification fragment containing sequence shown in SEQ ID No.1；
2) amplified production is checked order, after splicing, remove sequence two ends 5.8S and 28S gene regions, it is thus achieved that complete ITS2 base
Because of spacer, by analyzing the sequence shown in SEQ ID No.1, determine from 5 ' of sequence shown in SEQ ID No.1 ends the 97th
Position, the 173rd, the base of the 200th.
Wherein, if from 5 ' of sequence shown in SEQ ID No.1 end the 97th, the 173rd be C, the 200th is G, then
Be accredited as lycium barbarum, if from 5 ' of sequence shown in SEQ ID No.1 end the 97th, the 173rd be T, the 200th is A,
Then it is accredited as Fructus Lycii.
Amplimer uses ITS2 aligning primer, and its sequence is:
Forward primer: ATGCGATACTTGGTGTGAAT；
Reverse primer: GACGCTTCTCCAGACTACAAT.
Above-mentioned primer is for expanding the ITS2 sequence of lycium barbarum or Fructus Lycii.
The present invention also provides for the lycium barbarum containing above-mentioned primer and Fructus Lycii identification kit.
The inventive method suitability is wide, can detect any lycium barbarum that can extract DNA and Fructus Lycii sample.Accordingly, it is capable to
Enough realize lycium barbarum, the former plant of Fructus Lycii, medical material and drink raw quick, the precise Identification of sheet.
Accompanying drawing explanation
Fig. 1 show amplification (note: M:Marker (100bp DNA Ladder) CK: the negative control of ITS2 sequence
1-9: sample YC0026MT06-14).
Fig. 2 show three SNP site sequence alignment results of lycium barbarum and Fructus Lycii ITS2 sequence.
Detailed description of the invention
Below in conjunction with specific embodiment, the invention will be further described, and not to the restriction invented, according to ability
Prior art known to territory, embodiments of the present invention are not limited to this, the most all abilities made according to present disclosure
The equivalent in territory, belongs to protection scope of the present invention.
Embodiment 1
1) the 37 parts of lycium barbarums collected from domestic different sources and 11 parts of Fructus Lycii blades and fruit sample (table 1), respectively
Take 20mg blade, 50mg fruit, add the PVP-40 of sample size 10%, in MM400 high-throughput tissue grinder (Germany
Retsch) it is ground on, extracts the extraction of test kit (TIANGEN Biotech (Beijing) Co., Ltd.) with plant genome DNA
STb gene.
Table 1 lycium barbarum and Fructus Lycii blade and fruit sample message
2) PCR amplification
Primer sequence forward primer: ATGCGATACTTGGTGTGAAT；Reverse primer: GACGCTTCTCCAGACTACAAT,
Synthesized by company limited of Sheng Gong bio-engineering corporation (Beijing).Primer dissolves with aseptic deionization and is diluted to 2.5 μm ol/ μ L.
25 μ L reaction systems: PCR MasterMix 12.5 μ L, each 1.0 μ L of primer (2.5 μm ol/L), template DNA 20～
100ng, adds sterilizing distilled water to 25 μ L, carries out PCR amplification.
PCR response procedures: carry out amplified reaction according to following procedure in PCR instrument:
Taking the pcr amplification product loading of 4 μ L respectively, the agarose gel with 1% carries out electrophoresis, at gel imaging after electrophoresis
Testing result (Fig. 1) on instrument.
3) order-checking
PCR primer directly send Chinese Academy of Agricultural Sciences's Important Project laboratory order-checking.The same PCR primer of sequencing primer.For really
Protect the reliability of DNA bar code sequence, need carry out forward and reverse order-checking or repeat order-checking, then forward and reverse sequencing result is carried out
Splicing obtains DNA bar code sequence.
4) sequence assembly
The present embodiment uses application software CodonCode Aligner V 3.7.1 (CodonCode Co., USA) to carry out
Sequence assembly and check and correction.First, carry out sequencing quality assessment and pretreatment, i.e. remove the low quality part at sequencing result two ends,
And remainder is carried out quality evaluation, and if meeting prescription, sequence assembly can be used for, concrete grammar is: with 20bp
Window slide from sequence 5 ' end and 3 ' ends respectively, if having the Q-value of more than two base in window less than 20, then delete
One base, window continues to slide, if the base Q-value number less than 20 is less than or equal to 2 in window, window stops sliding
Dynamic.The remainder of sequencing result need to be more than 150bp, and average Q value is more than or equal to 30 (Chen et al.2010).The most laggard
Row sequence assembly, according to Hidden Markov Model (HMM) model, removes sequence two ends 5.8S and 28S gene regions, it is thus achieved that
Complete lycium barbarum and Fructus Lycii ITS2 intergenic sequence.
5) sequence alignment
With MEGA6.0 software, the ITS2 intergenic sequence of order-checking each sample spliced is compared, knot
Fruit is as shown in Figure 2.From figure 2 it can be seen that obtain three SNP site, the ITS2 genetic interval of all lycium barbarum samples altogether
The 97th, the 173rd of region sequence (SEQ ID No.1) is C, and the 200th is G, and between the ITS2 gene of all Samples of Alisma Orientalis
Being T every the 97th, the 173rd of gene region array, the 200th is A, shows that these three SNP site can specifically be used for reflecting
Determine lycium barbarum and Fructus Lycii.
Embodiment 2
It is basic with embodiment 1, except that test material is the lycium barbarum in embodiment 1 and Chinese wolfberry fruit to be prepared
The decoction pieces become, with this decoction pieces as sample, extracts DNA, identifies, result also can specifically detect above-mentioned three SNP
Site.
Embodiment 3
It is basic with embodiment 1, except that test material is to buy from 10 medical material markets and 23 portions of Fructus Lyciis of pharmacy
Sub-medical material sample (table 2), with this medical material as sample, extracts DNA, identifies, result also can specifically detect above-mentioned
Three SNP site.
Table 2 commercially available Fructus Lycii medical material information
| Sequence number | Sample number into spectrum | Buy place |
| 1 | YC0026MT01 | Lotus pond medicine city, Chengdu, Sichuan |
| 2 | YC0026MT02 | Lotus pond medicine city, Chengdu, Sichuan |
| 3 | YC0026MT03 | Lotus pond medicine city, Chengdu, Sichuan |
| 4 | YC0026MT04 | Lotus pond medicine city, Chengdu, Sichuan |
| 5 | YC0026MT05 | Lotus pond medicine city, Chengdu, Sichuan |
| 6 | YC0026MT06 | Pharmacy of Beijing |
| 7 | YC0026MT07 | Pharmacy of Beijing |
| 8 | YC0026MT08 | Pharmacy of Beijing |
| 9 | YC0026MT09 | Pharmacy of Beijing |
| 10 | YC0026MT10 | Pharmacy of Beijing |
| 11 | YC0026MT11 | Zhongning County, Ningxia pharmacy |
| 12 | YC0026MT12 | Pharmacy of Yongning Ningxia county |
| 13 | YC0026MT13 | Qinghai Nuo Muhongmou pharmacy |
| 14 | YC0026MT14 | Qinghai Nuo Muhongmou pharmacy |
| 15 | YC0026MT15 | Pharmacy of Jinghe county |
| 16 | YC0026MT16 | Pharmacy of Jinghe county |
| 17 | YC0026MT17 | Wulat Front Banner, Inner Mongolia pharmacy |
| 18 | YC0026MT18 | Inner Mongol company |
| 19 | YC0026MT19 | Anguo medicine city, Hebei |
| 20 | YC0026MT20 | Anguo medicine city, Hebei |
| 21 | YC0026MT21 | Anguo medicine city, Hebei |
| 22 | YC0026MT22 | Anguo medicine city, Hebei |
| 23 | YC0026MT23 | Julu County, Hebei |
Embodiment 4
Substantially with embodiment 1, except that test material is to gather the Fructus Lycii blade from Seoul Korea and fruit sample
Product (table 3), extract DNA, identify, result also can specifically detect above-mentioned three SNP site.
Table 3 Korea S gathers Fructus Lycii blade and fruit sample message
| Sequence number | Sample number into spectrum | Species name | Sampling point | Sampling position |
| 1 | PS1139MT22 | Fructus Lycii | Fruit | Seoul Korea |
| 2 | PS1139MT23 | Fructus Lycii | Fruit | Seoul Korea |
| 3 | PS1139MT24 | Fructus Lycii | Blade | Seoul Korea |
Embodiment 5
It is basic with embodiment 1, except that test material is the 14 parts of lycium barbarums and 1 collected from domestic different sources
Part lycii radicis,cortex sample (table 4), takes the about 50mg of the tissue within cork, extracts DNA, identifies, result also can be specifically
Above-mentioned three SNP site detected.
Table 4 lycium barbarum and lycii radicis,cortex sample message
| Sequence number | Sample number into spectrum | Species name | Sampling position |
| 1 | YC0026MT24 | Lycium barbarum | Yinchuan of Ningxia Province city |
| 2 | YC0026MT25 | Lycium barbarum | Zhongning County, Ningxia |
| 3 | YC0026MT26 | Lycium barbarum | Zhongning County, Ningxia |
| 4 | YC0026MT27 | Lycium barbarum | Zhongning County, Ningxia |
| 5 | YC0026MT28 | Lycium barbarum | Jingtai Regions of Gansu county |
| 6 | YC0026MT29 | Lycium barbarum | Jingtai Regions of Gansu county |
| 7 | YC0026MT30 | Lycium barbarum | Jingyuan, Gansu county |
| 8 | YC0026MT31 | Lycium barbarum | Dulan county |
| 9 | YC0026MT32 | Lycium barbarum | Zhongning County, Ningxia |
| 10 | YC0026MT33 | Lycium barbarum | Jingtai Regions of Gansu county |
| 11 | YC0026MT34 | Lycium barbarum | Jingtai Regions of Gansu county |
| 12 | YC0026MT35 | Lycium barbarum | Golmud of Qinghai |
| 13 | YC0026MT36 | Lycium barbarum | Golmud of Qinghai |
| 14 | YC0026MT37 | Lycium barbarum | Yinchuan of Ningxia Province city |
| 15 | YC0095MT14 | Fructus Lycii | Julu County, Hebei |
Embodiment 6
It is basic with embodiment 1, except that test material is to buy from 10 medical material markets and part Cortex Lycii of pharmacy
Medical material sample (table 5), takes the about 50mg of the tissue within cork, extracts DNA, identifies, result also can specifically detect
Three above-mentioned SNP site.
Table 5 commercially available Cortex Lycii medical material information
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For Yuan, on the premise of without departing from the technology of the present invention principle, it is also possible to make some improvements and modifications, these improvements and modifications
Also should be regarded as protection scope of the present invention.
Claims (6)
1. lycium barbarum and Fructus Lycii are identified and mark with single nucleotide polymorphism (single nucleotide polymorphism) SNP
Note, it is characterised in that its nucleotide sequence is as shown in SEQ ID No.1, and wherein, shown in SEQ ID No.1, the 5 ' of sequence hold
97th, the 173rd is C or T, and the 200th is G or A.
2. the application in identifying lycium barbarum and Fructus Lycii of the SNP described in claim 1, it is characterised in that if from SEQ ID
Shown in No.1 the 5 ' of sequence held the 97th, the 173rd for C, the 200th is G, then be accredited as lycium barbarum, if from SEQ
Shown in ID No.1 the 5 ' of sequence held the 97th, the 173rd for T, the 200th is A, then be accredited as Fructus Lycii.
3. lycium barbarum and Fructus Lycii authentication method, it comprises the steps:
1) with testing sample DNA as template, the amplification fragment containing sequence shown in SEQ ID No.1；
2) amplified production is checked order, after splicing, remove sequence two ends 5.8S and 28S gene regions, it is thus achieved that between complete ITS2 gene
Septal area, by analyzing the sequence shown in SEQ ID No.1, determine from 5 ' of sequence shown in SEQ ID No.1 ends the 97th, the
173, the base of the 200th.
Method the most according to claim 3, it is characterised in that if from 5 ' of sequence shown in SEQ ID No.1 ends the
97, the 173rd is C, and the 200th is G, then be accredited as lycium barbarum, if from 5 ' of sequence shown in SEQ ID No.1 ends
97th, the 173rd is T, and the 200th is A, then be accredited as Fructus Lycii.
5. no matter the application in identifying lycium barbarum and Fructus Lycii of the SNP described in claim 1, by which kind of mode obtained and comprise
Sequence shown in SEQ ID No.1, all can use SNP marker to identify lycium barbarum and Fructus Lycii.
6. the mode described in 5 in claim that contains identifies lycium barbarum and Fructus Lycii test kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610922313.1A CN106282390A (en) | 2016-10-25 | 2016-10-25 | Lycium barbarum and Fructus Lycii SNP rapid identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610922313.1A CN106282390A (en) | 2016-10-25 | 2016-10-25 | Lycium barbarum and Fructus Lycii SNP rapid identification method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106282390A true CN106282390A (en) | 2017-01-04 |
Family
ID=57719868
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610922313.1A Pending CN106282390A (en) | 2016-10-25 | 2016-10-25 | Lycium barbarum and Fructus Lycii SNP rapid identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106282390A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164489A (en) * | 2017-06-07 | 2017-09-15 | 苏州市李良济健康产业有限公司 | A kind of primer pair and its application for Identification chinese herbs medicine material rhizoma alismatis |
| CN107523639A (en) * | 2017-09-30 | 2017-12-29 | 数字本草中医药检测有限公司 | A kind of lycium barbarum uses SNP specific primers and its discrimination method with matrimony vine identification |
-
2016
- 2016-10-25 CN CN201610922313.1A patent/CN106282390A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "lycium barbarum isolate 1321 5.8s ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28s ribosomal RNA gene, partial sequence", 《GENBANK:KF451098.1》 * |
| TIANYI XIN ET AL.: "survey of commercial rhodiola products revealed species diversity and potential safety issues", 《SCIENTIFIC REPORTS》 * |
| 辛天怡等: "宁夏枸杞及其同属近源物种ITS2条形码鉴定", 《中药与天然药高峰论坛暨第十二届全国中药和天然药物学术研讨会 论文集》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164489A (en) * | 2017-06-07 | 2017-09-15 | 苏州市李良济健康产业有限公司 | A kind of primer pair and its application for Identification chinese herbs medicine material rhizoma alismatis |
| CN107523639A (en) * | 2017-09-30 | 2017-12-29 | 数字本草中医药检测有限公司 | A kind of lycium barbarum uses SNP specific primers and its discrimination method with matrimony vine identification |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102888456B (en) | Method for quickly identifying pseudo-ginseng | |
| CN104651515B (en) | A kind of method building Camellia sinensis DNA fingerprinting | |
| CN107586867A (en) | Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method | |
| Liu et al. | Species identification of Rhododendron (Ericaceae) using the chloroplast deoxyribonucleic acid PsbA-trnH genetic marker | |
| Nowak et al. | Molecular evaluation of the validity of the morphological characters of three Swedish Chara sections: Chara, Grovesia, and Desvauxia (Charales, Charophyceae) | |
| CN106636342A (en) | EST-SSR marker primer group developed on basis of sequence of transcriptome of ligusticum wallichii, and acquisition method and application of EST-SSR marker primer group | |
| Greiner et al. | Evolution of the polyploid north-west Iberian Leucanthemum pluriflorum clan (Compositae, Anthemideae) based on plastid DNA sequence variation and AFLP fingerprinting | |
| CN106282390A (en) | Lycium barbarum and Fructus Lycii SNP rapid identification method | |
| CN111133117A (en) | Identification of plant DNA isolated from dietary supplements | |
| CN113897415B (en) | Method for identifying three basic species of rheum officinale medicinal material and application | |
| Lima et al. | Seasonal change in main alkaloids of jaborandi (Pilocarpus microphyllus Stapf ex Wardleworth), an economically important species from the Brazilian flora | |
| CN106048020A (en) | Gene identification card for animal medicine stiff silkworm | |
| CN104830969A (en) | Panax notoginseng molecule ID and identification method | |
| CN105063028A (en) | SSR (simple sequence repeat) primer group and method for constructing malt fingerprint maps by aid of primer group | |
| CN107475359A (en) | A kind of DNA bar code authentication method of integration of drinking and medicinal herbs medicinal material spina date seed and its mixed adulterant | |
| Cai et al. | Development and Application of a Cultivar-Specific Sequence-Characterized Amplified Region (SCAR) Marker for the Detection of Chrysanthemum morifolium Ramat.‘Daboju’ | |
| Rumpunen et al. | Comparison of differentiation estimates based on morphometric and molecular data, exemplified by various leaf shape descriptors and RAPDs in the genus Chaenomeles (Rosaceae) | |
| Lithanatudom et al. | A first phylogeny of the genus Dimocarpus and suggestions for revision of some taxa based on molecular and morphological evidence | |
| CN104611328A (en) | Method for rapid identification of alisma orientale and alisma plantago-aquatica | |
| CN104480105A (en) | Rapid identification method of Rhizoma Acori Calami | |
| Chen et al. | A molecular identification of medicinal Rheum Species cultivated germplasm from the northwest of China using DNA barcoding | |
| CN113493851B (en) | Application of 32 soybean InDel markers in detection of soybean genetic diversity | |
| CN108384885A (en) | A kind of combination of cinnamomum camphora SSR primers and its cultivar identification method | |
| CN109022610B (en) | Molecular specificity marker primer of anoectochilus formosanus and identification method thereof | |
| CN106755396A (en) | A kind of primer for building matrimony vine DNA fingerprinting is combined and application and method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170104 |