CN106282390A - Lycium barbarum and Fructus Lycii SNP rapid identification method - Google Patents

Lycium barbarum and Fructus Lycii SNP rapid identification method Download PDF

Info

Publication number
CN106282390A
CN106282390A CN201610922313.1A CN201610922313A CN106282390A CN 106282390 A CN106282390 A CN 106282390A CN 201610922313 A CN201610922313 A CN 201610922313A CN 106282390 A CN106282390 A CN 106282390A
Authority
CN
China
Prior art keywords
fructus lycii
lycium barbarum
seq
sequence
sequence shown
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610922313.1A
Other languages
Chinese (zh)
Inventor
宋经元
辛天怡
姚辉
陈士林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Medicinal Plant Development of CAMS and PUMC
Original Assignee
Institute of Medicinal Plant Development of CAMS and PUMC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Medicinal Plant Development of CAMS and PUMC filed Critical Institute of Medicinal Plant Development of CAMS and PUMC
Priority to CN201610922313.1A priority Critical patent/CN106282390A/en
Publication of CN106282390A publication Critical patent/CN106282390A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

The invention discloses a kind of lycium barbarum and Fructus Lycii SNP rapid identification method, it comprises the steps: 1) with testing sample DNA as template, amplification is containing the sequence shown in SEQ ID No.1;2) amplified production is checked order, analyze the sequence shown in SEQ ID No.1, if the 97th, the 173rd is C from 5 ' of sequence shown in SEQ ID No.1 ends, 200th is G, then it is accredited as lycium barbarum, if the 97th, the 173rd is T from 5 ' of sequence shown in SEQ ID No.1 ends, the 200th is A, then be accredited as Fructus Lycii.The present invention is capable of lycium barbarum, the former plant of Fructus Lycii, medical material and drink raw quick, the precise Identification of sheet.

Description

Lycium barbarum and Fructus Lycii SNP rapid identification method
Technical field
The invention belongs to Chinese crude drug source cultivar identification technical field, be specifically related to identify Ningxia Chinese holly by SNP marker Qi and the method for Fructus Lycii.
Background technology
Lycium barbarum (Lycium barbarum) and Fructus Lycii (Lycium chinense) are Solanaceae Lycium, 2015 version " Chinese Pharmacopoeia " record the source that dry root bark is Chinese crude drug Cortex Lycii both this.Additionally, " Chinese Pharmacopoeia " is also The exclusive source that dry mature fruit is Chinese crude drug Fructus Lycii of regulation lycium barbarum Lycium barbarum L., and Fructus Lycii The fruit of Lycium chinense Mill. is not made medicinal.Both this, on appearance character, difference is less, and diagnostic characteristics is seed Size, in view of lycium barbarum industrial benefit is considerable, lycium barbarum is belonged to together the fruit of nearly edge species Fructus Lycii as Fructus Lycii by operator Son is commercially sold, and the latter is cheap, the production cost of Fructus Lycii deep processed product is greatly reduced, thus operator can Therefrom seek more high profit.For safeguarding consumer's interests, it is ensured that drug quality, needing to find a kind of reliable and stable method will be peaceful Summer Fructus Lycii and Fructus Lycii are identified differentiation.
Summary of the invention
First purpose of the present invention is to provide lycium barbarum and Fructus Lycii qualification SNP.
Second purpose of the present invention is to provide lycium barbarum and Fructus Lycii qualification SNP in lycium barbarum and Fructus Lycii are identified Application.
The 3rd purpose of the present invention is to provide lycium barbarum and Fructus Lycii SNP rapid identification method.
The lycium barbarum of present invention offer and Fructus Lycii qualification SNP, from nucleotide sequence as shown in SEQ ID No.1, its In, shown in SEQ ID No.1 the 5 ' of sequence held the 97th, the 173rd for C or T, the 200th is G or A.
The SNP that the present invention provides can be used for identifying lycium barbarum and Fructus Lycii, if from shown in SEQ ID No.1 the 5 ' of sequence Having held the 97th, the 173rd is C, and the 200th is G, then be accredited as lycium barbarum, if from sequence shown in SEQ ID No.1 5 ' held the 97th, the 173rd for T, the 200th is A, then be accredited as Fructus Lycii.
The lycium barbarum of present invention offer and Fructus Lycii SNP rapid identification method, it comprises the steps:
1) with testing sample DNA as template, the amplification fragment containing sequence shown in SEQ ID No.1;
2) amplified production is checked order, after splicing, remove sequence two ends 5.8S and 28S gene regions, it is thus achieved that complete ITS2 base Because of spacer, by analyzing the sequence shown in SEQ ID No.1, determine from 5 ' of sequence shown in SEQ ID No.1 ends the 97th Position, the 173rd, the base of the 200th.
Wherein, if from 5 ' of sequence shown in SEQ ID No.1 end the 97th, the 173rd be C, the 200th is G, then Be accredited as lycium barbarum, if from 5 ' of sequence shown in SEQ ID No.1 end the 97th, the 173rd be T, the 200th is A, Then it is accredited as Fructus Lycii.
Amplimer uses ITS2 aligning primer, and its sequence is:
Forward primer: ATGCGATACTTGGTGTGAAT;
Reverse primer: GACGCTTCTCCAGACTACAAT.
Above-mentioned primer is for expanding the ITS2 sequence of lycium barbarum or Fructus Lycii.
The present invention also provides for the lycium barbarum containing above-mentioned primer and Fructus Lycii identification kit.
The inventive method suitability is wide, can detect any lycium barbarum that can extract DNA and Fructus Lycii sample.Accordingly, it is capable to Enough realize lycium barbarum, the former plant of Fructus Lycii, medical material and drink raw quick, the precise Identification of sheet.
Accompanying drawing explanation
Fig. 1 show amplification (note: M:Marker (100bp DNA Ladder) CK: the negative control of ITS2 sequence 1-9: sample YC0026MT06-14).
Fig. 2 show three SNP site sequence alignment results of lycium barbarum and Fructus Lycii ITS2 sequence.
Detailed description of the invention
Below in conjunction with specific embodiment, the invention will be further described, and not to the restriction invented, according to ability Prior art known to territory, embodiments of the present invention are not limited to this, the most all abilities made according to present disclosure The equivalent in territory, belongs to protection scope of the present invention.
Embodiment 1
1) the 37 parts of lycium barbarums collected from domestic different sources and 11 parts of Fructus Lycii blades and fruit sample (table 1), respectively Take 20mg blade, 50mg fruit, add the PVP-40 of sample size 10%, in MM400 high-throughput tissue grinder (Germany Retsch) it is ground on, extracts the extraction of test kit (TIANGEN Biotech (Beijing) Co., Ltd.) with plant genome DNA STb gene.
Table 1 lycium barbarum and Fructus Lycii blade and fruit sample message
2) PCR amplification
Primer sequence forward primer: ATGCGATACTTGGTGTGAAT;Reverse primer: GACGCTTCTCCAGACTACAAT, Synthesized by company limited of Sheng Gong bio-engineering corporation (Beijing).Primer dissolves with aseptic deionization and is diluted to 2.5 μm ol/ μ L.
25 μ L reaction systems: PCR MasterMix 12.5 μ L, each 1.0 μ L of primer (2.5 μm ol/L), template DNA 20~ 100ng, adds sterilizing distilled water to 25 μ L, carries out PCR amplification.
PCR response procedures: carry out amplified reaction according to following procedure in PCR instrument:
Taking the pcr amplification product loading of 4 μ L respectively, the agarose gel with 1% carries out electrophoresis, at gel imaging after electrophoresis Testing result (Fig. 1) on instrument.
3) order-checking
PCR primer directly send Chinese Academy of Agricultural Sciences's Important Project laboratory order-checking.The same PCR primer of sequencing primer.For really Protect the reliability of DNA bar code sequence, need carry out forward and reverse order-checking or repeat order-checking, then forward and reverse sequencing result is carried out Splicing obtains DNA bar code sequence.
4) sequence assembly
The present embodiment uses application software CodonCode Aligner V 3.7.1 (CodonCode Co., USA) to carry out Sequence assembly and check and correction.First, carry out sequencing quality assessment and pretreatment, i.e. remove the low quality part at sequencing result two ends, And remainder is carried out quality evaluation, and if meeting prescription, sequence assembly can be used for, concrete grammar is: with 20bp Window slide from sequence 5 ' end and 3 ' ends respectively, if having the Q-value of more than two base in window less than 20, then delete One base, window continues to slide, if the base Q-value number less than 20 is less than or equal to 2 in window, window stops sliding Dynamic.The remainder of sequencing result need to be more than 150bp, and average Q value is more than or equal to 30 (Chen et al.2010).The most laggard Row sequence assembly, according to Hidden Markov Model (HMM) model, removes sequence two ends 5.8S and 28S gene regions, it is thus achieved that Complete lycium barbarum and Fructus Lycii ITS2 intergenic sequence.
5) sequence alignment
With MEGA6.0 software, the ITS2 intergenic sequence of order-checking each sample spliced is compared, knot Fruit is as shown in Figure 2.From figure 2 it can be seen that obtain three SNP site, the ITS2 genetic interval of all lycium barbarum samples altogether The 97th, the 173rd of region sequence (SEQ ID No.1) is C, and the 200th is G, and between the ITS2 gene of all Samples of Alisma Orientalis Being T every the 97th, the 173rd of gene region array, the 200th is A, shows that these three SNP site can specifically be used for reflecting Determine lycium barbarum and Fructus Lycii.
Embodiment 2
It is basic with embodiment 1, except that test material is the lycium barbarum in embodiment 1 and Chinese wolfberry fruit to be prepared The decoction pieces become, with this decoction pieces as sample, extracts DNA, identifies, result also can specifically detect above-mentioned three SNP Site.
Embodiment 3
It is basic with embodiment 1, except that test material is to buy from 10 medical material markets and 23 portions of Fructus Lyciis of pharmacy Sub-medical material sample (table 2), with this medical material as sample, extracts DNA, identifies, result also can specifically detect above-mentioned Three SNP site.
Table 2 commercially available Fructus Lycii medical material information
Sequence number Sample number into spectrum Buy place
1 YC0026MT01 Lotus pond medicine city, Chengdu, Sichuan
2 YC0026MT02 Lotus pond medicine city, Chengdu, Sichuan
3 YC0026MT03 Lotus pond medicine city, Chengdu, Sichuan
4 YC0026MT04 Lotus pond medicine city, Chengdu, Sichuan
5 YC0026MT05 Lotus pond medicine city, Chengdu, Sichuan
6 YC0026MT06 Pharmacy of Beijing
7 YC0026MT07 Pharmacy of Beijing
8 YC0026MT08 Pharmacy of Beijing
9 YC0026MT09 Pharmacy of Beijing
10 YC0026MT10 Pharmacy of Beijing
11 YC0026MT11 Zhongning County, Ningxia pharmacy
12 YC0026MT12 Pharmacy of Yongning Ningxia county
13 YC0026MT13 Qinghai Nuo Muhongmou pharmacy
14 YC0026MT14 Qinghai Nuo Muhongmou pharmacy
15 YC0026MT15 Pharmacy of Jinghe county
16 YC0026MT16 Pharmacy of Jinghe county
17 YC0026MT17 Wulat Front Banner, Inner Mongolia pharmacy
18 YC0026MT18 Inner Mongol company
19 YC0026MT19 Anguo medicine city, Hebei
20 YC0026MT20 Anguo medicine city, Hebei
21 YC0026MT21 Anguo medicine city, Hebei
22 YC0026MT22 Anguo medicine city, Hebei
23 YC0026MT23 Julu County, Hebei
Embodiment 4
Substantially with embodiment 1, except that test material is to gather the Fructus Lycii blade from Seoul Korea and fruit sample Product (table 3), extract DNA, identify, result also can specifically detect above-mentioned three SNP site.
Table 3 Korea S gathers Fructus Lycii blade and fruit sample message
Sequence number Sample number into spectrum Species name Sampling point Sampling position
1 PS1139MT22 Fructus Lycii Fruit Seoul Korea
2 PS1139MT23 Fructus Lycii Fruit Seoul Korea
3 PS1139MT24 Fructus Lycii Blade Seoul Korea
Embodiment 5
It is basic with embodiment 1, except that test material is the 14 parts of lycium barbarums and 1 collected from domestic different sources Part lycii radicis,cortex sample (table 4), takes the about 50mg of the tissue within cork, extracts DNA, identifies, result also can be specifically Above-mentioned three SNP site detected.
Table 4 lycium barbarum and lycii radicis,cortex sample message
Sequence number Sample number into spectrum Species name Sampling position
1 YC0026MT24 Lycium barbarum Yinchuan of Ningxia Province city
2 YC0026MT25 Lycium barbarum Zhongning County, Ningxia
3 YC0026MT26 Lycium barbarum Zhongning County, Ningxia
4 YC0026MT27 Lycium barbarum Zhongning County, Ningxia
5 YC0026MT28 Lycium barbarum Jingtai Regions of Gansu county
6 YC0026MT29 Lycium barbarum Jingtai Regions of Gansu county
7 YC0026MT30 Lycium barbarum Jingyuan, Gansu county
8 YC0026MT31 Lycium barbarum Dulan county
9 YC0026MT32 Lycium barbarum Zhongning County, Ningxia
10 YC0026MT33 Lycium barbarum Jingtai Regions of Gansu county
11 YC0026MT34 Lycium barbarum Jingtai Regions of Gansu county
12 YC0026MT35 Lycium barbarum Golmud of Qinghai
13 YC0026MT36 Lycium barbarum Golmud of Qinghai
14 YC0026MT37 Lycium barbarum Yinchuan of Ningxia Province city
15 YC0095MT14 Fructus Lycii Julu County, Hebei
Embodiment 6
It is basic with embodiment 1, except that test material is to buy from 10 medical material markets and part Cortex Lycii of pharmacy Medical material sample (table 5), takes the about 50mg of the tissue within cork, extracts DNA, identifies, result also can specifically detect Three above-mentioned SNP site.
Table 5 commercially available Cortex Lycii medical material information
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For Yuan, on the premise of without departing from the technology of the present invention principle, it is also possible to make some improvements and modifications, these improvements and modifications Also should be regarded as protection scope of the present invention.

Claims (6)

1. lycium barbarum and Fructus Lycii are identified and mark with single nucleotide polymorphism (single nucleotide polymorphism) SNP Note, it is characterised in that its nucleotide sequence is as shown in SEQ ID No.1, and wherein, shown in SEQ ID No.1, the 5 ' of sequence hold 97th, the 173rd is C or T, and the 200th is G or A.
2. the application in identifying lycium barbarum and Fructus Lycii of the SNP described in claim 1, it is characterised in that if from SEQ ID Shown in No.1 the 5 ' of sequence held the 97th, the 173rd for C, the 200th is G, then be accredited as lycium barbarum, if from SEQ Shown in ID No.1 the 5 ' of sequence held the 97th, the 173rd for T, the 200th is A, then be accredited as Fructus Lycii.
3. lycium barbarum and Fructus Lycii authentication method, it comprises the steps:
1) with testing sample DNA as template, the amplification fragment containing sequence shown in SEQ ID No.1;
2) amplified production is checked order, after splicing, remove sequence two ends 5.8S and 28S gene regions, it is thus achieved that between complete ITS2 gene Septal area, by analyzing the sequence shown in SEQ ID No.1, determine from 5 ' of sequence shown in SEQ ID No.1 ends the 97th, the 173, the base of the 200th.
Method the most according to claim 3, it is characterised in that if from 5 ' of sequence shown in SEQ ID No.1 ends the 97, the 173rd is C, and the 200th is G, then be accredited as lycium barbarum, if from 5 ' of sequence shown in SEQ ID No.1 ends 97th, the 173rd is T, and the 200th is A, then be accredited as Fructus Lycii.
5. no matter the application in identifying lycium barbarum and Fructus Lycii of the SNP described in claim 1, by which kind of mode obtained and comprise Sequence shown in SEQ ID No.1, all can use SNP marker to identify lycium barbarum and Fructus Lycii.
6. the mode described in 5 in claim that contains identifies lycium barbarum and Fructus Lycii test kit.
CN201610922313.1A 2016-10-25 2016-10-25 Lycium barbarum and Fructus Lycii SNP rapid identification method Pending CN106282390A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610922313.1A CN106282390A (en) 2016-10-25 2016-10-25 Lycium barbarum and Fructus Lycii SNP rapid identification method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610922313.1A CN106282390A (en) 2016-10-25 2016-10-25 Lycium barbarum and Fructus Lycii SNP rapid identification method

Publications (1)

Publication Number Publication Date
CN106282390A true CN106282390A (en) 2017-01-04

Family

ID=57719868

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610922313.1A Pending CN106282390A (en) 2016-10-25 2016-10-25 Lycium barbarum and Fructus Lycii SNP rapid identification method

Country Status (1)

Country Link
CN (1) CN106282390A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107164489A (en) * 2017-06-07 2017-09-15 苏州市李良济健康产业有限公司 A kind of primer pair and its application for Identification chinese herbs medicine material rhizoma alismatis
CN107523639A (en) * 2017-09-30 2017-12-29 数字本草中医药检测有限公司 A kind of lycium barbarum uses SNP specific primers and its discrimination method with matrimony vine identification

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GENBANK: "lycium barbarum isolate 1321 5.8s ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28s ribosomal RNA gene, partial sequence", 《GENBANK:KF451098.1》 *
TIANYI XIN ET AL.: "survey of commercial rhodiola products revealed species diversity and potential safety issues", 《SCIENTIFIC REPORTS》 *
辛天怡等: "宁夏枸杞及其同属近源物种ITS2条形码鉴定", 《中药与天然药高峰论坛暨第十二届全国中药和天然药物学术研讨会 论文集》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107164489A (en) * 2017-06-07 2017-09-15 苏州市李良济健康产业有限公司 A kind of primer pair and its application for Identification chinese herbs medicine material rhizoma alismatis
CN107523639A (en) * 2017-09-30 2017-12-29 数字本草中医药检测有限公司 A kind of lycium barbarum uses SNP specific primers and its discrimination method with matrimony vine identification

Similar Documents

Publication Publication Date Title
CN102888456B (en) Method for quickly identifying pseudo-ginseng
Palhares et al. Medicinal plants recommended by the world health organization: DNA barcode identification associated with chemical analyses guarantees their quality
Nguyen et al. Authentication markers for five major Panax species developed via comparative analysis of complete chloroplast genome sequences
CN104651515B (en) A kind of method building Camellia sinensis DNA fingerprinting
Hamouda Molecular analysis of genetic diversity in population of Silybum marianum (L.) Gaertn in Egypt
CN107586867A (en) Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method
Liu et al. Species identification of Rhododendron (Ericaceae) using the chloroplast deoxyribonucleic acid PsbA-trnH genetic marker
Qian et al. Conservation genetics of an endangered Lady’s Slipper Orchid: Cypripedium japonicum in China
CN106636342A (en) EST-SSR marker primer group developed on basis of sequence of transcriptome of ligusticum wallichii, and acquisition method and application of EST-SSR marker primer group
CN106244681A (en) A kind of method and the application that utilize genome SSR and EST SSR finger printing to differentiate mung bean variety
Greiner et al. Evolution of the polyploid north-west Iberian Leucanthemum pluriflorum clan (Compositae, Anthemideae) based on plastid DNA sequence variation and AFLP fingerprinting
CN106282390A (en) Lycium barbarum and Fructus Lycii SNP rapid identification method
CN111133117A (en) Identification of plant DNA isolated from dietary supplements
CN113897415B (en) Method for identifying three basic species of rheum officinale medicinal material and application
CN106048020A (en) Gene identification card for animal medicine stiff silkworm
CN105063028A (en) SSR (simple sequence repeat) primer group and method for constructing malt fingerprint maps by aid of primer group
Lima et al. Seasonal change in main alkaloids of jaborandi (Pilocarpus microphyllus Stapf ex Wardleworth), an economically important species from the Brazilian flora
Liu et al. Identification of medical plants of 24 Ardisia species from China using the matK genetic marker
CN107475359A (en) A kind of DNA bar code authentication method of integration of drinking and medicinal herbs medicinal material spina date seed and its mixed adulterant
Cai et al. Development and Application of a Cultivar-Specific Sequence-Characterized Amplified Region (SCAR) Marker for the Detection of Chrysanthemum morifolium Ramat.‘Daboju’
CN108220473A (en) It is marked using chloroplaset InDel and differentiates CMS-S maize material
Boczkowska et al. Genome-wide diversity analysis of Valeriana officinalis L. using DArT-seq derived SNP markers
Lithanatudom et al. A first phylogeny of the genus Dimocarpus and suggestions for revision of some taxa based on molecular and morphological evidence
CN104611328A (en) Method for rapid identification of alisma orientale and alisma plantago-aquatica
KR101959732B1 (en) Primers for detecting SSR markers specific to allotetraploid mandarin orange and uses thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20170104