CN106282383A

CN106282383A - The application in detection keratoconus of the KRT12 gene

Info

Publication number: CN106282383A
Application number: CN201610878045.8A
Authority: CN
Inventors: 杜显利; 陈鹏; 王殿强; 孙大鹏
Original assignee: SPECIALTY OF OPHTHALMOLOGY RESEARCH INSTITUTE SHANDONG PROV
Current assignee: SPECIALTY OF OPHTHALMOLOGY RESEARCH INSTITUTE SHANDONG PROV
Priority date: 2016-10-08
Filing date: 2016-10-08
Publication date: 2017-01-04
Anticipated expiration: 2036-10-08
Also published as: CN106282383B

Abstract

It is an object of the invention to provide the application in preparation detection keratoconus diagnostic product of a kind of KRT12 gene, the invention provides the new purposes of KRT12 gene, thus providing a kind of keratoconus disease gene diagnosis, prenatal gene examination and approach of genetic counselling of effectively carrying out, application effect shows the SNP site of gene provided by the present invention and detection primer can be effectively used for clinical patients and fetus fine hair or amniotic fluid carries out the quick of KRT12 gene mutation site and detects.

Description

The application in detection keratoconus of the KRT12 gene

Technical field

The invention belongs to gene diagnosis technical field, be specifically related to Keratin 12 (KRT12) gene at detection keratoconus In application.

Background of invention

Keratoconus (keratoconus) is a kind of abiotrophic degeneration's disease, thinning to prolapse with keratectasia, central authorities Go out, a kind of oculopathy being characterized in cone.It often results in highly irregular myopic astigmatism, there will be acute cornea water late period Swollen, form cicatrix, vision is remarkably decreased.Fall ill more than adolescence, slowly develop.Keratoconus is much in clinic.The world The prevalence of scope general population is 0.5 ‰～2.3 ‰, and America and Europe is 0.1 ‰～0.5 ‰, and Japan is 0.7 ‰～0.8 ‰, China 0.4 ‰, the most agnate between there are differences, although its sickness rate is relatively the highest, but mainly ring shadow due to it between twenty and fifty, therefore The order of severity that the health hazard that caused of society is showed by it far above its sickness rate and clinical symptoms.

The definite cause of disease of constitutional keratoconus and pathogenesis do not understand, it may be that multifactorial result, such as heredity Theory, collagen theory, gene theory, theory of matrix initiation, metabolism and dysplasia theory etc..More scholar thinks that primary disease is often dyeing Body recessive inheritance.Keratoconus can independently occur, it is possible to as eye or the concomitant symptom of whole body syndrome.Entering according to the state of an illness Exhibition, disease early stage, simple glasses are the most rectifiable.When cornea irregular astigmatism significantly increases, rigid cornea should be worn Contact lens (RGP) is corrected defects of vision.But RGP can not stop PD, need when RGP can not wear or correct defects of vision poor to do Corneal graft, brings heavy financial burden to patient and the whole society.In early days and mid-term feasible corneal collagen crosslinking hands Art reinforces cornea hardness, slows down keratoconus tempo to a certain extent.This present situation promote to go further to find and Solve the Disease-causing gene that this disease is new, provide basis for subsequent gene diagnosis, prenatal diagnosis and gene therapy.

Summary of the invention

It is an object of the invention to provide the application in preparation detection keratoconus diagnostic product of a kind of KRT12 gene, from And make up the deficiencies in the prior art.

Applicant, from a keratoconus family, finds the pathogenic mutation that the KRT12 gene of this family exists in heredity, It is detected as the SNP site relevant to keratoconus disease, thus facilitates the present invention.

Present invention firstly provides the purposes that KRT12 gene is new, be for detecting in keratoconus battalion diagnostic product in preparation Application；

Above-mentioned diagnostic product, preferred as embodiment, is primer or the probe of detection keratoconus.

Another aspect of the present invention provides a kind of SNP site relevant to keratoconus disease, for KRT12 gene coding region Territory is by start codon between the 1456th and 1457, and inserting base is GAT；

Detecting the primer pair of above-mentioned SNP site, its primer information is as follows:

The present invention also provides for a kind of test kit for detecting keratoconus, include above-mentioned primer centering any one or Several.

Wherein as follows for detecting the primer information of above-mentioned SNP site:

KRT12-8.1L:CAACCAGTGTTGGATTAATATTTG SEQ ID NO:15

KRT12-8.1R:CCAGGTCCAGAAGGATATAAGG SEQ ID NO:16

The invention provides the new purposes of KRT12 gene, thus provide one and effectively carry out keratoconus disease Gene diagnosis, prenatal gene examination and the approach of genetic counselling, application effect shows the SNP site of gene provided by the present invention And detection primer can be effectively used for clinical patients and fetus fine hair or amniotic fluid carries out the quick of KRT12 gene mutation site and examines Survey.

Detailed description of the invention

KRT12 gene is made up of 7108 nucleotide bases, is positioned at 17q12, the mRNA of transcribed one-tenth about 1485bp (NM_000223.3), directly translation forms the protein of 494 aminoacid compositions.

Below in conjunction with embodiment, the present invention is described in detail.

Embodiment 1: screen the mutational site of KRT12 gene from keratoconus

1, peripheral blood genomic DNA is extracted:

Meeting country's relevant policies regulation, and on the basis of sampling object is agreed to, extracting outside first family member In week venous blood 2-5ml, putting into EDTA anticoagulant tube ,-80 DEG C frozen standby；Frozen EDTA anticoagulation, after room temperature is melted, takes 500 μ L are put in centrifuge tube, add equal-volume TE (pH8.0), and mixing, 4 DEG C, 10000rpm is centrifuged 10 minutes, abandons supernatant.

Add 180 μ L TE, 20 μ LSDS (10%), 8 μ L E.C. 3.4.21.64 (l0mg/ml) mixings, be placed in 37 DEG C of water-baths overnight. Sample, brief centrifugation precipitation sample is taken out from water-bath.The saturated phenol of isopyknic Tris-(about 300 μ L) is added in reaction tube, Fully mixing, under room temperature, 10000rpm is centrifuged 10 minutes, in Aspirate supernatant (about 300 μ L) to a new centrifuge tube.Repeat phenol to take out Carry once, in the new centrifuge tube of Aspirate supernatant to.

Add the saturated phenol of isopyknic Tris: chloroform mixed liquor (each 150 μ L of phenol, chloroform), mixing, room temperature 10000rpm from The heart 10 minutes, transfer supernatant is to a new centrifuge tube.

Add the saturated phenol of isopyknic Tris: chloroform: isoamyl alcohol mixed liquor (each 100 μ L of phenol, chloroform, isoamyl alcohol), mixing, Room temperature 10000rpm is centrifuged 10 minutes, and transfer supernatant is to a new centrifuge tube.

Add l/10 volume 3mol/L, pH5.2 sodium acetate (about 30 μ L), 2 times of volume pre-cooling 100% ethanol, be gently mixed, Visible white flocculent deposit.Room temperature 10000rpm is centrifuged 10 minutes, makes DNA be deposited at the bottom of pipe, abandons supernatant.

Adding 70% ethanol to DNA precipitation, once, room temperature 7000rpm is centrifuged 5 minutes, abandons supernatant, is placed in room temperature in rinsing Volatilization residue ethanol, is eventually adding 50 μ L TE (pH8.0), 4 DEG C of overnight dissolving DNAs.

To the DNA row agarose gel electrophoresis extracted, and apply ultraviolet spectrophotometer in 260nm and 280nm colorimetric, detection DNA purity and concentration.

2. the sudden change of patient KRT12 gene in direct sequencing verifies this family

PCR expands purpose fragment: reaction condition and reaction system:

(1) PCR reaction condition: 94 DEG C of 3min；94 DEG C of 40sec, 55 ± 2 DEG C of 40se, 72 DEG C of 60sec, 30-35cycles； 72℃10min。

(2) reaction system: (TAKARA LA Taq polymerase)

This reaction system is applied to carry out the genomic DNA template of Mei Ming family member and the amplification of this KRT12 primer respectively Reaction.Between 1456 and 1457, inserting base is GAT

PCR primer checks order: above-mentioned PCR primer is checked order by the conventional Sanger sequencing of application, three trouble in this family The KRT12 gene coding region of person there occurs heterozygous mutant between the 1456th and 1457 by start codon, inserts Base is GAT, causes the 486th, KRT12 albumen to be sported arginine by glutamine, and the 487th sports termination codon. Application mutation forecasting program Mutation Taster prediction finds, this sudden change result in KRT12 protein function " disease Causing " damage of level, thus cause the generation of keratoconus in this family.Repeatedly sequencing result shows this mutational site It is not because amplification or order-checking mistake are introduced.The peripheral blood base of normal person in 200 examples normally local crowd and this family Because group DNA sample carries out the Mutation Screening in this site, do not find this sudden change.

Collect the clear and definite keratoconus of diagnosis in Shandong eye institute and Qingdao ophthalmologic hospital and distribute patient one, carry Take its peripheral blood genomic DNA, apply the DNA profiling of this patient and KRT12-8.1L and KRT12-8.1R primer to carry out PCR expansion Increasing, above-mentioned PCR primer is checked order by the conventional Sanger sequencing of application, and the KRT12 gene of this patient is deposited and sent out in the present invention Existing SNP mutation, i.e. coding region there occurs heterozygous mutant between the 1456th and 1457 by start codon, insert Base is GAT, causes the 486th, KRT12 albumen to be sported arginine by glutamine, and the 487th sports termination codon.

The above results shows that KRT12 gene can be used to detect whether patient has the potential danger suffering from keratoconus.Logical Cross and each exon fragment of the KRT12 gene of tester is compared in normal homologous segment, determine the ill wind of person to be detected Danger.

Claims

1. the application of a KRT12 gene, it is characterised in that described application is for the diagnosis detecting keratoconus in preparation Application in goods.

Apply the most as claimed in claim 1, it is characterised in that described diagnostic product is for detecting KRT12 gene and circle The SNP site that cone angle film is relevant, described SNP site is positioned at by start codon the 1456th, KRT12 gene coding region And between 1457.

Apply the most as claimed in claim 1, it is characterised in that described diagnostic product is PCR detection primer.

4. the primer pair being used for detecting keratoconus, the information of described primer pair is as follows:

5. the test kit being used for detecting keratoconus, it is characterised in that described test kit includes described in claim 3 Any one or several of primer centering.

6. a SNP site relevant to keratoconus disease, described SNP site be positioned at KRT12 gene coding region by Beginning codon rises and there occurs heterozygous mutant between the 1456th and 1457, and inserting base is GAT.

7. the method that a test right requires the SNP site described in 6, it is characterised in that be with the primer described in claim 4 Any one or several of centering detect.

8. method as claimed in claim 7, it is characterised in that the information of described primer pair is as follows:

KRT12-8.1L:CAACCAGTGTTGGATTAATATTTG SEQ ID NO:15

KRT12-8.1R:CCAGGTCCAGAAGGATATAAGG SEQ ID NO:16.