CN106198975A - A kind of test kit for detection of stomach disorders - Google Patents
A kind of test kit for detection of stomach disorders Download PDFInfo
- Publication number
- CN106198975A CN106198975A CN201610503443.1A CN201610503443A CN106198975A CN 106198975 A CN106198975 A CN 106198975A CN 201610503443 A CN201610503443 A CN 201610503443A CN 106198975 A CN106198975 A CN 106198975A
- Authority
- CN
- China
- Prior art keywords
- detection
- aptamer
- test kit
- pepsinogen
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
- G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
- G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
- G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
- G01N2333/96427—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
- G01N2333/9643—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
- G01N2333/96472—Aspartic endopeptidases (3.4.23)
- G01N2333/96475—Aspartic endopeptidases (3.4.23) with definite EC number
- G01N2333/96477—Pepsin (3.4.23.1; 3.4.23.2; 3.4.23.3)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/06—Gastro-intestinal diseases
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/06—Gastro-intestinal diseases
- G01N2800/062—Gastritis or peptic ulcer disease
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of detection of stomach disorders test kit, belong to external reagent diagnosis technical field.Being obtained by SELEX technology screening can the nucleic acid aptamer of specific binding pepsinogen I I, thus utilize this aptamer to carry out the pepsinogen I I in specificity screening or detection blood, and blood can be reached need not dilute direct reaction detection by the preparation of described aptamer being become detection kit and alleviate the purpose of workload;Obtain wide measurement scope, it is simple to Clinical practice simultaneously.The positive effect of the present invention is: test kit is highly sensitive, specificity good, measure wide ranges, simple to operate, beneficially large-scale promotion application, has wide market prospect.
Description
The application is filing date on November 29th, 2015, Application No. 201510849189.6, invention entitled " a kind of
Test kit for detection of stomach disorders " the divisional application of application for a patent for invention.
Technical field
The application relates to field of biological detection, is specifically related to the detection of gastropathy.
Background technology
Pepsinogen I I (being called for short PG II) derives from full gastric gland and distal duodenum BrunnerShi gland, and gastric mucosa closes
The PGII become is about the 25% of total amount, and PG II major part enters digestive tract, enters blood circulation on a small quantity, is therefore referred to as " reflection
Stomach state and the pointer of function ".
Clinical research both at home and abroad is pointed out, PG II is relatively big with the dependency of gastric mucosa pathological changes, and its rising is withered with fundic gland pipe
Contracting, intestinal epithelial metaplasia or Pseudopyloric gland metaplasia, dysplasia are relevant.Measure PG II content help detect duodenal ulcer,
Other digestive tract disease such as atrophic gastritis, gastritis, gastric cancer, for Clinical detection and health check-up examination demand.In crowd's gastropathy examination
In, everyone makees gastroscope is unpractical, can be detected superficial gastritis, erosive gastritis, stomach by Noninvasive serum PG
Out, then to carry out gastroscopy be a kind of realistic plan to the high-risk Mass screenings such as ulcer, duodenal ulcer, gastric cancer.
Employing time-resolved fluorescence known in the art measures technology, and the TRFIIA test kit of the PGII of establishment is current PGII detection side
In method the sensitiveest, measure one of the method for widest range, but expensive be unfavorable for large-scale promotion.
Phyletic evolution index concentration technology (SELEX technology) is a kind of new combination grown up early 1990s
Chemical technology, it uses jumbo random oligonucleotide library, the outer PCR amplification technique of coalition, divides with target with index concentration
The oligonucleotide of sub-specific bond, through multi-turns screen, it is thus achieved that affinity is high, the oligonucleotide aptamer of high specificity
(aptamers).The own Successful utilization of this technology is in the screening of many target molecules, including metal ion, organic dyestuff, medicine, albumen
Matter, aminoacid and various cytokines etc..
Summary of the invention
It is an object of the invention to the widow by phyletic evolution index concentration technology (SELEX technology) screening pepsinogen I I
Nucleotide aptamer substitutes antibody, it is provided that a kind of succinct quick, pepsinogen I I inspection in early days of high sensitivity, high specific
Survey and isolation and purification method.
Technical scheme:
For single stranded DNA random library and the primer of phyletic evolution index concentration technology screening in the present invention, by the U.S.
Invitrogen company synthesizes, and two ends are fixed sequence program, and centre is the random sequence of 42 bases: 5'-
TACGACATGAACCGTGATAA (N42) CAGTGAAACCTGATGATCGA-3', storage capacity is 1014Above;
Primer 1:5'TACGACATGAACCGTGATAA-3';
Primer 2: 5'-TCGATCAGCAGGTTTCACTG-3'.
Human pepsinogen II is fitted together to egg according to the recombined human pepsinogen I I isozyme disclosed in CN103387971A
White method prepares;
GelRed nucleic acid dye is purchased from Biotium company;
Nitrocellulose filter is purchased from U.S. Mi Libo (MilliPore) company;
It is Time Inc. that the purified reagent of oligonucleotide is purchased from sky, Beijing;
PCR kit and carrier T are purchased from U.S. Pu Luomaige (ftOmega) company.
A kind of affine human pepsinogen II nucleic acid aptamer, it is characterised in that nucleotides sequence is classified as: SEQ ID NO:1-
17 arbitrary shown DNA moleculars.
A kind of above-mentioned affine human pepsinogen II nucleic acid aptamer, it is characterised in that: there is the oligonucleoside of identical function
Acid aptamer homologous sequence accounts for more than 60%.
A kind of above-mentioned affine human pepsinogen II nucleic acid aptamer, it is characterised in that: derivative RNA sequence has identical
Function.
A kind of above-mentioned affine human pepsinogen II nucleic acid aptamer, it is characterised in that: for hybridizing with DNA sequence
Oligonucleotide sequence.
A kind of above-mentioned affine human pepsinogen II nucleic acid aptamer, it is characterised in that: in any position of nucleic acid aptamer
Oligonucleotide aptamer sequence obtained by putting deletion or increasing part oligonucleotide residues has identical function.
A kind of above-mentioned affine human pepsinogen II nucleic acid aptamer, it is characterised in that: in any position of nucleic acid aptamer
Putting after carrying out the displacement of nucleotide kind and rare bases, the oligonucleotide aptamer sequence obtained has identical function.
A kind of above-mentioned affine human pepsinogen II nucleic acid aptamer, it is characterised in that: in any position of nucleic acid aptamer
Put carry out phosphorylation, methylate, amino, sulfydryl, isotope, biotin, digoxin, fluorescent material, nano luminescent material or enzyme
After labelling is modified, the oligonucleotide aptamer sequence obtained has identical function.
A kind of above-mentioned affine human pepsinogen II nucleic acid aptamer, it is characterised in that: for human pepsinogen II's
Detection is with isolated and purified, thus is used for the detection of disease of brain.
The preparation method of a kind of above-mentioned affine human pepsinogen II nucleic acid aptamer, sequentially includes the following steps: 1) strand
The synthesis of DNA random oligonucleotide library;2) utilize phyletic evolution index concentration method that oligonucleotide library is screened;3)
Amplification and the oligonucleotide of human albumin specific bond;4) carry out next round screening, after 12 take turns above screening, obtain purpose
Oligonucleotide sequence;5) cloning and sequencing.
The invention have the advantage that have simplicity, quickly, economic dispatch feature, with other combinatorial chemical libraries such as random peptide library, resist
Body storehouse is compared with phage display libraries, the many advantages of aptamer tool filtered out from oligonucleotide library: 1) itself
It is oligonucleotide, molecular weight, can be cost-effective with chemosynthesis;2) there is affinity more higher than antibody and specificity;
3) labelling and can be at different parts selectively labelling it is easy to;4) repeatability and good stability, and be prone to preserve, i.e. to height
Gentle drastic conditions is insensitive.Therefore, phyletic evolution index concentration technology has a good application prospect.
Detailed description of the invention
The preparation of embodiment 1 human pepsinogen II
Method preparation according to the recombined human pepsinogen I I isozyme chimeric protein disclosed in CN103387971A obtains
Obtaining human pepsinogen II, protein concentration is 100mg/mL.
Embodiment 2-in-1 one-tenth random single-stranded DNA banks and primer
Random single chain DNA (ssDNA) library: 5'-TACGACATGAACCGTGATAA (N42) CAGTGAAACCTGATGATCGA-
3', constructs the ssDNA pool of a length of 82nt, and two ends are immobilized primer sequence, and centre is the random sequence of 42 bases,
Storage capacity is I014Above;Primer 1:5'TACGACATGAACCGTGATAA-3';Primer 2: 5'-TCGATCAGCAGGTTTCACTG-
3';All become 100 μm ol/L stock solution _ 20 DEG C storages standby with TE buffer ssDNA pool and two kinds of primers.
Being double-stranded DNA by single-stranded DNA banks amplification, product is through 2% agarose gel electrophoresis and cuts glue recovery purification;To reclaim
Double-stranded DNA be template, in vitro transcription goes out single stranded RNA random library, and transcription product is through PAGE purification.75 μ g RNA libraries are through nitric acid
The anti-sieve of cellulose membrane removes the RNA molecule being combined with film, then with 2ug human pepsinogen II albumen, hatches 30min, instead for 37 DEG C
Answer liquid to filter through nitrocellulose filter, wash filter membrane;Then filter membrane is shredded, be placed in elution buffer (6mol/L carbamide,
0.55mol/L ammonium acetate, l.5mmol/L EDTA, 0.15%SDS) in boil 5min, centrifugal, take supernatant, dehydrated alcohol precipitation RNA,
And be redissolved in 20 μ 1DEPC water;With RNA for template RT-PCR amplifying doulbe-chain DNA, in vitro transcription goes out RNA library for next round
Screening;Often in wheel screening process, RT-PCR obtains double-stranded DNA library, goes out RNA aptamer storehouse with this double-stranded DNA for template in vitro transcription,
Screening carries out 10 altogether and takes turns.Having obtained 14 aptamers, its sequence is respectively shown in SEQ ID NO:1-14.Particular sequence is as follows:
The performance measurement of embodiment 3 protein binding aptamer
Aptamer taking 2.0 μ g respectively, digests lh with calf intestinal alkaline phosphatase (CIP) 37 DEG C, purification reclaims and removes phosphoric acid
The RNA changed;By T4 polynucleotide kinase labelling [γ-32P] ATP in dephosphorylized RNA molecule end.10nmol radioactivity
The aptamer of labelling human pepsinogen II 37 DEG C with variable concentrations (1-200nM) respectively hatches 30min, respectively organizes reactant liquor
Filtering through nitrocellulose filter, wash filter membrane, be dried filter membrane, liquid scintillation counter measures the exit dose of residual on filter membrane, with equally
Product are parallel does twice mensuration.Calculate the dissociation constant of each aptamer and destination protein.Result is as follows:
Aptamer specificity analyses and stability analysis described in embodiment 4
It is respectively adopted human albumin, immune globulin, pg120 albumen, escherichia coli outer membrane protein A, pepsin
Proenzyme II, carries out specific detection with 14 aptamers, through binding tests find, these aptamers the most not with these albumen phases
In conjunction with, and only keep higher specificity with people's protein binding.
By described aptamer, take 0.2ug, be respectively placed in the serum of room temperature, aqueous solution, place surrounding.Pass through RT-
PCR detects, and finds its Stability Analysis of Structures of placement of surrounding, is not degraded.
The diagnosis of aptamer disease described in embodiment 5
Take 9 patients w ith peptic ulcer diseases and the blood of 4 normal persons, use normal saline dilution, it is thus achieved that target sample.
By 14 markd aptamers of coupling respectively with the sample mixing 40min of 9 patients and 4 normal persons, logical
Cross biotin to separate, the content of quantitative analysis human pepsinogen therein II, found by analysis, pepsin in 9 patients
The content of proenzyme II dramatically increases, and has exceeded the threshold value of regulation.Reach the diagnostic criteria that corresponding gastropathy is sick.As can be seen here, its
Diagnosis effect is preferable.
These are only the preferred embodiments of the present invention, be not limited to the present invention, for those skilled in the art
For Yuan, all any modification, equivalent substitution and improvement etc. done within the spirit and principles in the present invention, should be included in this
Within the protection domain of invention.
Sequence table
< 110 > Lu Meizhen
< 120 > mono-kind is for the test kit of detection of stomach disorders
〈160〉14
〈210〉1
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-1
TACGACATGAACCGTGATAACTCATATATGTTCCCAACACGTCCAACTTATCCCTGACAATACAGTGAAACCTGATGATCGA
〈210〉2
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-2
TACGACATGAACCGTGATAACCGCTTCACACACTACCGCTCTCTCTTAGACTATTAACAATTCAGTGAAACCTGATGATCGA
〈210〉3
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-3
TACGACATGAACCGTGATAAATTCATACTTGTACAAATACTCTCGCATCTCCACTTATAATACAGTGAAACCTGATGATCGA
〈210〉4
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-4
TACGACATGAACCGTGATAAATAATTCTTTGCTTACCCTAAATATTCCAAACCCATCGACCACAGTGAAACCTGATGATCGA
〈210〉5
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-5
TACGACATGAACCGTGATAAACCTTATTATCCTACCACATCTCCTCAAACCAGCATTTAATACAGTGAAACCTGATGATCGA
〈210〉6
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-6
TACGACATGAACCGTGATAACAATCCACTGCCTCATTCCTTCCTTTATTCACATATTCCAAACAGTGAAACCTGATGATCGA
〈210〉7
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-7
TACGACATGAACCGTGATAACGCTTATCTTCTCACATAATTCCGAAACATAAAACCTCTCCACAGTGAAACCTGATGATCGA
〈210〉8
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-8
TACGACATGAACCGTGATAAATCGCCAACACCCTCCGTCTCGCTCTCCTAATATACAATCCTCAGTGAAACCTGATGATCGA
〈210〉9
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-9
TACGACATGAACCGTGATAATCGAACATTAACAATACCACGCCTATATTCTTAACATAAATACAGTGAAACCTGATGATCGA
〈210〉10
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-10
TACGACATGAACCGTGATAACACTTATAACAAACTCCAAGCCTCCTACAACGTACTATCACACAGTGAAACCTGATGATCGA
〈210〉11
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-11
TACGACATGAACCGTGATAAAAATATAAAGCTCTATGTTATTCACACGCATACTTCTTATCACAGTGAAACCTGATGATCGA
〈210〉12
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-12
TACGACATGAACCGTGATAACGCCCTACAATTCCCAATTAGCCTATTATTTAACATCCTAATCAGTGAAACCTGATGATCGA
〈210〉13
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-13
TACGACATGAACCGTGATAACCATATCTTGACCTATCACTTAGCCTAAATACTTTAAACATTCAGTGAAACCTGATGATCGA
〈210〉14
〈211〉 82
〈212〉DNA
< 213 > artificial sequence
〈400〉PG II-14
TACGACATGAACCGTGATAACTACCTTCATACAATCGCAATATTCACTTTTAAACACAATAACAGTGAAACCTGATGATCGA
Claims (3)
1. for the test kit of detection of stomach disorders, its contain can be specific binding with pepsinogen I I aptamer.
2. test kit as claimed in claim 1, it is characterised in that: described aptamer sequence is as shown in SEQ ID No:8.
3. the method for a detection of stomach disorders, it is characterised in that utilize the test kit described in any one of claim 1-2.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610503443.1A CN106198975A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510849189.6A CN105277698B (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610503443.1A CN106198975A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510849189.6A Division CN105277698B (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106198975A true CN106198975A (en) | 2016-12-07 |
Family
ID=55147066
Family Applications (14)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610504868.4A Pending CN105911280A (en) | 2015-11-29 | 2015-11-29 | Kit for stomach illness detection |
CN201610497173.8A Withdrawn CN106153914A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610504437.8A Pending CN105929160A (en) | 2015-11-29 | 2015-11-29 | Kit for stomach disease detection |
CN201610503443.1A Withdrawn CN106198975A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610503444.6A Pending CN105891478A (en) | 2015-11-29 | 2015-11-29 | Stomach disease detection kit |
CN201610504850.4A Pending CN105891480A (en) | 2015-11-29 | 2015-11-29 | Stomach disease detection kit |
CN201610504405.8A Pending CN105891479A (en) | 2015-11-29 | 2015-11-29 | Stomach disease detection kit |
CN201610503246.XA Pending CN106053809A (en) | 2015-11-29 | 2015-11-29 | Kit for detecting gastric disease |
CN201610504436.3A Withdrawn CN106153915A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610505427.6A Withdrawn CN106153916A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201510849189.6A Expired - Fee Related CN105277698B (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610505390.7A Pending CN105929161A (en) | 2015-11-29 | 2015-11-29 | Kit for detecting stomach diseases |
CN201610504439.7A Withdrawn CN106198977A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610504404.3A Withdrawn CN106405083A (en) | 2015-11-29 | 2015-11-29 | A kit for stomach disease detection |
Family Applications Before (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610504868.4A Pending CN105911280A (en) | 2015-11-29 | 2015-11-29 | Kit for stomach illness detection |
CN201610497173.8A Withdrawn CN106153914A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610504437.8A Pending CN105929160A (en) | 2015-11-29 | 2015-11-29 | Kit for stomach disease detection |
Family Applications After (10)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610503444.6A Pending CN105891478A (en) | 2015-11-29 | 2015-11-29 | Stomach disease detection kit |
CN201610504850.4A Pending CN105891480A (en) | 2015-11-29 | 2015-11-29 | Stomach disease detection kit |
CN201610504405.8A Pending CN105891479A (en) | 2015-11-29 | 2015-11-29 | Stomach disease detection kit |
CN201610503246.XA Pending CN106053809A (en) | 2015-11-29 | 2015-11-29 | Kit for detecting gastric disease |
CN201610504436.3A Withdrawn CN106153915A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610505427.6A Withdrawn CN106153916A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201510849189.6A Expired - Fee Related CN105277698B (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610505390.7A Pending CN105929161A (en) | 2015-11-29 | 2015-11-29 | Kit for detecting stomach diseases |
CN201610504439.7A Withdrawn CN106198977A (en) | 2015-11-29 | 2015-11-29 | A kind of test kit for detection of stomach disorders |
CN201610504404.3A Withdrawn CN106405083A (en) | 2015-11-29 | 2015-11-29 | A kit for stomach disease detection |
Country Status (1)
Country | Link |
---|---|
CN (14) | CN105911280A (en) |
Family Cites Families (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2002350661A1 (en) * | 2002-10-31 | 2004-05-25 | Labrea Holding S.A. | Diagnostic device and kit |
FI20065542A0 (en) * | 2006-09-01 | 2006-09-01 | Biohit Oyj | Method and Sampling Kit for Assessment of Abdominal Mucosal Condition |
EP2557425A3 (en) * | 2007-10-26 | 2013-07-10 | Biohit Oyj | Methods and products for diagnosing autoimmune diseases and gastric cancer linked with atrophic gastritis |
WO2011163497A2 (en) * | 2010-06-23 | 2011-12-29 | The Board Of Trustees Of The University Of Illinois | Method for determining predisposition to esophageal-related disorders |
CN102839181B (en) * | 2011-06-23 | 2014-05-14 | 复旦大学附属华山医院 | Nucleic acid aptamer sequence of gastric cancer cells, and uses thereof |
CN102426236A (en) * | 2011-08-31 | 2012-04-25 | 内蒙古科慧生物科技有限责任公司 | Pepsinogen II (PGII) quantitative determination kit and detection method thereof |
CN103305521B (en) * | 2012-03-06 | 2016-06-08 | 复旦大学附属华山医院 | The sequence of the aptamer of a kind of stomach cancer cell and application |
CN102645537B (en) * | 2012-04-26 | 2014-07-30 | 北京美康生物技术研究中心 | Latex enhanced turbidimetric immunoassay kit for diagnosing gastric diseases or gastric cancer, preparation method thereof and application |
CN103320445B (en) * | 2013-07-11 | 2017-07-28 | 重庆市肿瘤研究所 | The DNA aptamer GCA 5 of specific recognition stomach cancer cell and its application |
CN104418937B (en) * | 2013-08-22 | 2018-01-02 | 朱建安 | People PGII epitope peptides, antigen, antibody, purposes and kit |
CN103627701B (en) * | 2013-12-04 | 2015-07-15 | 武汉大学 | Screening of aptamers specially targeting gastric cancer cells and aptamers obtained after screening |
CN104818278A (en) * | 2015-04-17 | 2015-08-05 | 刘红卫 | Aptamer capable of being in specific binding to TS/MDEP protein in gastric cancer cells |
CN104830867A (en) * | 2015-06-07 | 2015-08-12 | 杨洋 | Aptamer capable of being specifically combined with DKK1 protein in cancer cells |
-
2015
- 2015-11-29 CN CN201610504868.4A patent/CN105911280A/en active Pending
- 2015-11-29 CN CN201610497173.8A patent/CN106153914A/en not_active Withdrawn
- 2015-11-29 CN CN201610504437.8A patent/CN105929160A/en active Pending
- 2015-11-29 CN CN201610503443.1A patent/CN106198975A/en not_active Withdrawn
- 2015-11-29 CN CN201610503444.6A patent/CN105891478A/en active Pending
- 2015-11-29 CN CN201610504850.4A patent/CN105891480A/en active Pending
- 2015-11-29 CN CN201610504405.8A patent/CN105891479A/en active Pending
- 2015-11-29 CN CN201610503246.XA patent/CN106053809A/en active Pending
- 2015-11-29 CN CN201610504436.3A patent/CN106153915A/en not_active Withdrawn
- 2015-11-29 CN CN201610505427.6A patent/CN106153916A/en not_active Withdrawn
- 2015-11-29 CN CN201510849189.6A patent/CN105277698B/en not_active Expired - Fee Related
- 2015-11-29 CN CN201610505390.7A patent/CN105929161A/en active Pending
- 2015-11-29 CN CN201610504439.7A patent/CN106198977A/en not_active Withdrawn
- 2015-11-29 CN CN201610504404.3A patent/CN106405083A/en not_active Withdrawn
Also Published As
Publication number | Publication date |
---|---|
CN106405083A (en) | 2017-02-15 |
CN105891479A (en) | 2016-08-24 |
CN105911280A (en) | 2016-08-31 |
CN105277698B (en) | 2016-09-21 |
CN105891480A (en) | 2016-08-24 |
CN105277698A (en) | 2016-01-27 |
CN105929160A (en) | 2016-09-07 |
CN106153916A (en) | 2016-11-23 |
CN106153915A (en) | 2016-11-23 |
CN105891478A (en) | 2016-08-24 |
CN106198977A (en) | 2016-12-07 |
CN106053809A (en) | 2016-10-26 |
CN105929161A (en) | 2016-09-07 |
CN106153914A (en) | 2016-11-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP2023113877A (en) | Method for assisting in detection of pancreatic cancer | |
CN105277698B (en) | A kind of test kit for detection of stomach disorders | |
CN105301262B (en) | A kind of test kit for human brain disease detection | |
CN105807068A (en) | Kit for specific detection of endometrial cancer | |
CN105785007A (en) | Kit for specific detection of endometrial cancer | |
CN105823895A (en) | Kit for specific detection of endometrial cancer | |
CN105823894A (en) | Kit for specific detection of endometrial cancer | |
CN105821156A (en) | Method for detecting or/and quantifying hepatitis B virus in vitro and primer and probe used by same | |
CN106053847A (en) | Lip cancer specificity detection kit | |
CN105177013A (en) | Kit for detecting cerebrovascular diseases |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WW01 | Invention patent application withdrawn after publication | ||
WW01 | Invention patent application withdrawn after publication |
Application publication date: 20161207 |
|
DD01 | Delivery of document by public notice | ||
DD01 | Delivery of document by public notice |
Addressee: Lu Mei Zhen Document name: Notification of Approving Refund |