CN103627701B - Screening of aptamers specially targeting gastric cancer cells and aptamers obtained after screening - Google Patents
Screening of aptamers specially targeting gastric cancer cells and aptamers obtained after screening Download PDFInfo
- Publication number
- CN103627701B CN103627701B CN201310645924.2A CN201310645924A CN103627701B CN 103627701 B CN103627701 B CN 103627701B CN 201310645924 A CN201310645924 A CN 201310645924A CN 103627701 B CN103627701 B CN 103627701B
- Authority
- CN
- China
- Prior art keywords
- screening
- cell
- cells
- dna
- aptamers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses screening of aptamers specially targeting gastric cancer cells and aptamers obtained after screening, and belongs to the fields of bioanalysis and genetic engineering. The screening method provided by the invention is based on a cell-SELEX technology, SGC 7901 cells human gastric carcinoma cells are adopted as target cells, GES-1 cells of human gastric mucosa cells are adopted as negative-screening cells; during the negative-screening, the amount, elution time and volume of eluant are continuously increased; meanwhile, the incubating time of target cells is gradually shortened, and the incubating time of negative-screening cells is properly prolonged; through screening for several times, a sequence specially bound with the gastric cancer cells and high in binding force can be obtained, namely, the aptamers for special targeted gastric cancer cells can be obtained. The sequences for the aptamers are shown in SEQ ID NO.1-NO.6, and the aptaamers have good binding force and specificity, can be bound with and target the gastric cancer cells specially, and can be used for diagnosis of gastric cancer and preparation of gastric cancer diagnosis drugs.
Description
Technical field
The invention belongs to bioanalysis and genetically engineered field, be specifically related to the aptamer that the screening of the aptamer of selectively targeted stomach cancer cell and screening obtain.
Background technology
Nucleic acid aptamer is the part that can be combined with target material high specific, high-affinity adopting phyletic evolution (systematic evolution of ligands by exponential enrichment, the SELEX) technology of index concentration part to filter out from random single chain oligonucleotide library.Cell SELEX(cell-SELEX) be with complete cell for research object, the nucleotide sequence that can be combined with target cell high specific, high-affinity filtered out from the oligonucleotide library of synthetic.
Cell-SELEX is better than traditional SELEX technology at target sieving, and it can keep integrity and the biological activity of cell surface target molecules better, and is more conducive to analysis and the detection of carrying out clinical sample.
Cancer of the stomach is one of malignant tumour that sickness rate is higher in the world, and the cancer of the stomach great majority that can be diagnosed clinically have been in the middle and advanced stage stage, lack suitable and effective treatment means, so find some tumor markers on stomach cancer cell (also may be gene of curing the disease) to have extremely important meaning to the early diagnosis of cancer of the stomach and methods for the treatment of effectively reasonable in design.
Summary of the invention
Primary and foremost purpose of the present invention is that the shortcoming overcoming prior art is with not enough, provides a kind of screening method of aptamer of selectively targeted stomach cancer cell; The method is based on cell-SELEX technology, and for stomach cancer cell, going out with the DNA library screening of external synthesis can the adaptor sequence of specific recognition stomach cancer cell.
Another object of the present invention is to the aptamer that the selectively targeted stomach cancer cell obtained by above-mentioned screening method is provided.
Another object of the present invention is the application of the aptamer providing above-mentioned selectively targeted stomach cancer cell.
Object of the present invention is achieved through the following technical solutions:
A screening method for the aptamer of selectively targeted stomach cancer cell, based on cell-SELEX technology, comprise the steps: to adopt gastric carcinoma cells SGC7901 cell as target cell, people Gastric Mucosal Cells GES-1 cell is as anti-sieve cell; The volume of the amount of anti-sieve cell, elution time and elutriant is constantly increased in anti-sieved journey; Meanwhile, shorten the incubation time of target cell gradually, the incubation time of the anti-sieve cell of proper extension; By the screening of number wheel, obtain with stomach cancer cell specific binding and the high sequence of bonding force, namely obtain the aptamer of selectively targeted stomach cancer cell.Described elutriant is preferably Du Shi phosphoric acid buffer.
Preferably, the screening method of the aptamer of described selectively targeted stomach cancer cell, comprise the steps: to adopt gastric carcinoma cells SGC7901 cell as target cell, people Gastric Mucosal Cells GES-1 cell is as anti-sieve cell; The amount of the initial DNA library added is 5 ~ 10nmol, and the amount of initial target cell is 2 ~ 3 × 10
6individual cell; 2 ~ 3 × 10 are added when taking turns screening from the 3rd
6individual anti-sieve cell, next take turns screening often increasing by one, cell count increases an order of magnitude, and elution time from 1min be increased to 5min, the volume of elutriant from 500 μ L be increased to 3mL; Meanwhile, the incubation time of target cell shortens to 30min from 60min, and the incubation time of anti-sieve cell is increased to 45min from 30min; Carry out altogether 10 screenings taken turns.
Preferred, the screening method of the aptamer of described selectively targeted stomach cancer cell, comprises the steps:
Adopt gastric carcinoma cells SGC7901 cell as target cell, people Gastric Mucosal Cells GES-1 cell is as anti-sieve cell;
(1) first round screening: by after 7 ~ 10nmol DNA library denaturing treatment with 2 ~ 3 × 10
6individual target cell hatches 60min at 37 DEG C, the Ya Wenku that the DNA collecting combination after 500 μ L washings washed cells screens as next round;
(2) screening is taken turns at second, third: with 2 ~ 3 × 10 after the Ya Wenku denaturing treatment of screen previous round
6individual target cell hatches 60min at 37 DEG C, the Ya Wenku that the DNA collecting combination after 500 μ L washings washed cells screens as next round;
(3) fourth round screening: with 2 ~ 3 × 10 after the Ya Wenku denaturing treatment that third round is screened
6after individual target cell hatches 60min at 37 DEG C, collect the DNA of combination after 500 μ L washings washed cells, with 2 ~ 3 × 10 after denaturing treatment
6individual anti-sieve cell hatches 30min at 37 DEG C, and 1000 μ L washings washed cells 1 time, 1min/ time, collect unconjugated DNA, carry out asymmetric PCR;
(4) the 5th take turns screening: get after (3) PCR primer 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 45min at 37 DEG C, collect the DNA combined, with 2 ~ 3 × 10 after denaturing treatment
6individual anti-sieve cell hatches 30min at 37 DEG C, and 1000 μ L washings washed cells 2 times, 2min/ time, collect unconjugated DNA, carry out asymmetric PCR;
(5) the 6th take turns screening: get after (4) PCR primer 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 45min at 37 DEG C, collect the DNA combined, with 2 ~ 3 × 10 after denaturing treatment
6individual anti-sieve cell hatches 30min at 37 DEG C, and 1000 μ L washings washed cells 2 times, 2min/ time, collect unconjugated DNA, carry out asymmetric PCR;
(6) the 7th take turns screening: get after (5) PCR primer 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 30min at 37 DEG C, collect the DNA combined, with 1 ~ 2 × 10 after denaturing treatment
7individual anti-sieve cell hatches 45min at 37 DEG C, and 2000 μ L washings washed cells 3 times, 3min/ time, collect unconjugated DNA, carry out asymmetric PCR;
(7) the 8th take turns screening: get after (6) PCR primer 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 30min at 37 DEG C, collect the DNA combined, with 1 ~ 2 × 10 after denaturing treatment
7individual anti-sieve cell hatches 45min at 37 DEG C, and 2000 μ L washings washed cells 3 times, 3min/ time, collect unconjugated DNA, carry out asymmetric PCR;
(8) the 9th take turns screening: get after (7) PCR primer 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 30min at 37 DEG C, collect the DNA combined, with 1 ~ 2 × 10 after denaturing treatment
8individual anti-sieve cell hatches 45min at 37 DEG C, and 3000 μ L washings washed cells 3 times, 5min/ time, collect unconjugated DNA, carry out asymmetric PCR;
(9) the tenth take turns screening: get after (8) PCR primer 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 30min at 37 DEG C, collect the DNA combined, with 1 ~ 2 × 10 after denaturing treatment
8individual anti-sieve cell hatches 45min at 37 DEG C, and 3000 μ L washings washed cells 3 times, 5min/ time, collect unconjugated DNA, carry out asymmetric PCR.
Described DNA library is preferably random single-stranded DNA banks: 5 '-ACCGACCGTGCTGGACTCT-N
40-AGT
ATGAGCGAGCGTTGCG-3’。
Described washings is preferably Du Shi phosphoric acid buffer.
The primer of described asymmetric PCR is preferably: upstream primer B1:5 '-ACCGACCGTGCTGGACTCT-3 ', downstream primer B2:5 '-CGCAACGCTCGCTCTCA-3 '; The condition optimization of asymmetric PCR is: upstream and downstream primer ratio is 50:1,95 DEG C of denaturation 5 min, 94 DEG C of sex change 45 s, 60 DEG C of annealing 45 s, and 72 DEG C extend 45 s, 28 circulations, and last 72 DEG C extend 7 min.
The aptamer of selectively targeted stomach cancer cell, is obtained by above-mentioned screening method.
The aptamer of described selectively targeted stomach cancer cell preferably includes S1a, S1b, S1F, S2a, S3F and S4a, and its nucleotide sequence is as follows:
S1a：5’-TCTGGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGGAGT-3’；
S1b：5’-ACTCTGGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGGAGTATG
-3’；
S1F：5’-GGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGG-3’；
S2a：5’-GGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGT-3’；
S3F：5’-CCCTTGTTGATGGACAACTCCCTTCCTCTCCACTTCGTGGAGT-3’；
S4a：5’-GATCTCTCTCTGCCCTAAGTCCGCACCCGTGCTTCCCTGT-3’。
Preferred, the aptamer of described selectively targeted stomach cancer cell is S1a and S4a.
The aptamer of above-mentioned selectively targeted stomach cancer cell is preparing the application in diagnosing gastric cancer medicine.
A kind of diagnosing gastric cancer medicine, comprises above-mentioned aptamer.
The present invention has the following advantages and effect relative to prior art tool:
The aptamer that the present invention screens is to target cell---and stomach cancer cell has very high specificity and selectivity, to non-target cell substantially without recognition reaction.Can find out that aptamer of the present invention can distinguish target cell and anti-sieve cell well from the burnt picture of copolymerization and flow cytometry tests.
The present invention constantly increases the volume of the amount of anti-sieve cell, elution time and elutriant in the anti-sieved journey of aptamer, ensure that the specificity and high-affinity of screening the adaptor sequence obtained.
The detection meanss such as the present invention's flow cytometry, Laser Scanning Confocal Microscope demonstrate screen the aptamer obtained there is good bonding force and specificity.
Aptamer of the present invention can specific combination target stomach cancer cell, can be used for the diagnosis of cancer of the stomach.
Accompanying drawing explanation
Fig. 1 is the fluidic cell figure detected the enrichment in library, A and B is the library of SGC7901 cell and GES-1 cell enrichment respectively; In figure, ordinate zou and X-coordinate are respectively cell count and fluorescence intensity.
Fig. 2 is the confocal microscopy view of the enrichment in library, the library of A:SGC7901 cell+do not screen, the library of B:GES-1 cell+do not screen, the storehouse that C:SGC7901 cell+the eight is taken turns, the storehouse that D:GES-1 cell+the eight is taken turns; The each figure left side of A, B, C, D is the picture under fluorescence field (488nm excites), and the right is the picture of light field.
Fig. 3 is the flow cytometry analysis figure that screening obtains the bonding force of aptamer.
Fig. 4 is the specific confocal microscopy view that screening obtains aptamer, A:SGC7901 cell+FITC-S1a, B:GES-1 cell+FITC-S1a, C:SGC7901 cell l+FITC-S4a, D:GES-1 cell+FITC-S4a; The each figure left side of A, B, C, D is the picture under fluorescence field (488nm excites), and the right is the picture of light field.
Embodiment
After DNA library and a certain amount of target cell are hatched for some time at a certain temperature, the storehouse of elution of bound, then be combined with certain anti-sieve cell, collect unconjugated DNA library, the Ya Wenku screened as next round by pcr amplification.So repeatedly carry out 8 ~ 10 screenings taken turns, the DNA library of often being taken turns is proved respectively the enrichment in library with flow cytometer and Laser Scanning Confocal Microscope.Cloning, check order in the storehouse higher to bonding force, measures bonding force and the specificity of each bar sequence and stomach cancer cell, finally obtain the reasonable sequence of several bonding forces.
Below in conjunction with embodiment and accompanying drawing, further detailed description is done to the present invention, but embodiments of the present invention are not limited thereto.If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.
Embodiment 1 is based on the aptamer of the selectively targeted gastric carcinoma cells of cell-SELEX technology screening
Screen target cell used and anti-sieve cell is respectively gastric carcinoma cells SGC7901 and people Gastric Mucosal Cells GES-1 cell; DNA library used is random single-stranded DNA banks: 5 '-ACCGACCGTGCTGGACTCT-N
40-AGTATGAG
CGAGCGTTGCG-3 '; Asymmetric PCR upstream primer B1:5 '-ACCGACCGTGCTGGACTCT-3 ', downstream primer B2:5 '-CGCAACGCTCGCTCTCA-3 ', synthesized by match Parkson, Shanghai company.
Detailed process is as follows:
(1) during screening, target cell cell scraper is scraped the washing of rear Du Shi phosphoric acid buffer, centrifugal collecting cell precipitation when the first round; The DNA library of 7 ~ 10nmol synthetic is dissolved in binding buffer liquid (magnesium chloride, 4.5g/L glucose containing 5mM in Du Shi phosphoric acid buffer), with 2 ~ 3 × 10 after 95 DEG C of denaturing treatment
6individual target cell hatches 60min at 37 DEG C; The Ya Wenku that the DNA that 95 DEG C of heating after 500 μ L Du Shi phosphoric acid buffer washed cells, collected by centrifugation combine screens as next round.
(2) be all be library by the DNA of previous round elution of bound when second, third takes turns screening, with 2 ~ 3 × 10 after denaturing treatment
6individual target cell hatches 60min at 37 DEG C, the Ya Wenku that the DNA that after 500 μ L Du Shi phosphoric acid buffer washed cells, collected by centrifugation combines screens as next round.
(3) library of fourth round screening is the Ya Wenku of third round wash-out, with 2 ~ 3 × 10 after denaturing treatment
6after individual target cell hatches 60min at 37 DEG C, the DNA that after 500 μ L Du Shi phosphoric acid buffer washed cells, collected by centrifugation combines, with 2 ~ 3 × 10 after denaturing treatment
6individual anti-sieve cell hatches 30min at 37 DEG C, 1000 μ L Du Shi phosphoric acid buffer washed cells 1 time, 1min/ time, the unconjugated DNA of collected by centrifugation is template, carries out asymmetric PCR amplification (condition: upstream and downstream primer ratio is 50:1,95 DEG C of denaturation 5 min, 94 DEG C of sex change 45 s, 60 DEG C of annealing 45 s, 72 DEG C extend 45 s, 28 circulations, last 72 DEG C extend 7 min), 12% sex change PAGE electrophoresis, object band is reclaimed in rubber tapping, and ultraviolet is quantitative.
(4) the 5th take turns screening, get after above-mentioned quantitative DNA 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 45min at 37 DEG C, collect the DNA combined, with 2 ~ 3 × 10 after denaturing treatment
6individual anti-sieve cell hatches 30min at 37 DEG C, 1000 μ L Du Shi phosphoric acid buffer washed cells 2 times, 2min/ time, the unconjugated DNA of collected by centrifugation is template, carries out asymmetric PCR amplification (condition is with (3)), 12% sex change PAGE electrophoresis, object band is reclaimed in rubber tapping, and ultraviolet is quantitative.
(5) the 6th take turns screening, get after above-mentioned quantitative DNA 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 45min at 37 DEG C, the DNA that collected by centrifugation combines, with 2 ~ 3 × 10 after denaturing treatment
6individual anti-sieve cell hatches 30min at 37 DEG C, 1000 μ L Du Shi phosphoric acid buffer washed cells 2 times, 2min/ time, the unconjugated DNA of collected by centrifugation is template, carries out asymmetric PCR amplification (condition is with (3)), 12% sex change PAGE electrophoresis, object band is reclaimed in rubber tapping, and ultraviolet is quantitative.
(6) the 7th take turns screening, get after above-mentioned quantitative DNA 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 30min at 37 DEG C, the DNA that collected by centrifugation combines, with 1 ~ 2 × 10 after denaturing treatment
7individual anti-sieve cell hatches 45min at 37 DEG C, 2000 μ L Du Shi phosphoric acid buffer washed cells 3 times, 3min/ time, the unconjugated DNA of collected by centrifugation is template, carries out asymmetric PCR amplification (condition is with (3)), 12% sex change PAGE electrophoresis, object band is reclaimed in rubber tapping, and ultraviolet is quantitative.
(7) the 8th take turns screening, get after above-mentioned quantitative DNA 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 30min at 37 DEG C, the DNA that collected by centrifugation combines, with 1 ~ 2 × 10 after denaturing treatment
7individual anti-sieve cell hatches 45min at 37 DEG C, 2000 μ L Du Shi phosphoric acid buffer washed cells 3 times, 3min/ time, the unconjugated DNA of collected by centrifugation is template, carries out asymmetric PCR amplification (condition is with (3)), 12% sex change PAGE electrophoresis, object band is reclaimed in rubber tapping, and ultraviolet is quantitative.
(8) the 9th take turns screening, get after above-mentioned quantitative DNA 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 30min at 37 DEG C, the DNA that collected by centrifugation combines, with 1 ~ 2 × 10 after denaturing treatment
8individual anti-sieve cell hatches 45min at 37 DEG C, 3000 μ L Du Shi phosphoric acid buffer washed cells 3 times, 5min/ time, the unconjugated DNA of collected by centrifugation is template, carries out asymmetric PCR amplification (condition is with (3)), 12% sex change PAGE electrophoresis, object band is reclaimed in rubber tapping, and ultraviolet is quantitative.
(9) the tenth take turns screening, get after above-mentioned quantitative DNA 7 ~ 10nmol denaturing treatment with 2 ~ 3 × 10
6after individual target cell hatches 30min at 37 DEG C, the DNA that collected by centrifugation combines, with 1 ~ 2 × 10 after denaturing treatment
8individual anti-sieve cell hatches 45min at 37 DEG C, 3000 μ L Du Shi phosphoric acid buffer washed cells 3 times, 5min/ time, the unconjugated DNA of collected by centrifugation is template, carries out asymmetric PCR amplification (condition is with (3)), 12% sex change PAGE electrophoresis, object band is reclaimed in rubber tapping, and ultraviolet is quantitative.
(10) DNA library of often being taken turns is proved respectively the enrichment in library with flow cytometer and Laser Scanning Confocal Microscope, result as depicted in figs. 1 and 2.As seen from Figure 1, for SGC7901 cell, under certain cell quantity, along with the increase of screening wheel number, the average fluorescent strength on cell also increases thereupon; And for GES-1 cell, the average fluorescent strength on cell does not increase to some extent with the increase of screening wheel number.Show that the DNA library of screening obtains enrichment to a certain degree on target cell (SGC7901 cell), initial DNA library is taken turns the 8th and is obtained maximum enrichment.As seen from Figure 2, for SGC7901 cell, relative to the library of not screening, the 8th storehouse of taking turns and cell have very strong combination (cytolemma having fluorescence clearly); And for GES-1 cell, the 8th storehouse of taking turns after the DNA library of not screening or enrichment all not significantly with its combination, so we can't see fluorescence substantially in fluorescence field.Show to screen the 8th takes turns DNA library obtain maximum enrichment on target cell (SGC7901 cell).
(11) amplified library that the 8th takes turns is become dsDNA, then be inserted on pUC-T plasmid with T-A Cloning Kit, then proceed in E. coli, picking mono-clonal, extract plasmid, company is sent to check order, by comparison, obtain a series of sequence, then use the secondary structure of each aptamer of DNAMAN software prediction, by the bonding force by each bar sequence of Flow Cytometry Assay and target cell, finally obtain the sequence that following bonding force is high:
S1a:5’-TCTGGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGGAGT-3’；
S1b: 5’-ACTCTGGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGGAGTATG-3’；
S1F: 5’-GGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGG-3’；
S2a: 5’-GGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGT-3’；
S3F: 5’-CCCTTGTTGATGGACAACTCCCTTCCTCTCCACTTCGTGGAGT-3’；
S4a: 5’-GATCTCTCTCTGCCCTAAGTCCGCACCCGTGCTTCCCTGT-3’。
(12) 3 × 10 are got
5individual target cell hatches 20min with aptamer S1a and S4a of different concns (0nM, 25nM, 50nM, 100nM, 120nM, 150nM, 200nM, 250nM, 300nM, 500nM, 800nM, 1000nM) respectively, flow cytometry tests is carried out after washing, result as shown in Figure 3, along with the increase of aptamer concentration, it is stronger to the bonding force of target cell, and final combination is tending towards saturated.When aptamer and Cell binding rate reach 50%, the concentration of now required aptamer is exactly its equilibrium dissociation constant Kd, and we can obtain aptamer S1a and S4a and be respectively 141.1nM and 55.33nM with the force constant of linkage of cell separately thus.
(13) aptamer S1a, S4a of being marked by the FITC of 200nM are respectively with 3 × 10
5individual target cell or 3 × 10
5individual anti-sieve cell is in conjunction with 20min, washing, Laser Scanning Confocal Microscope experiment is carried out after the paraformaldehyde of 4% is fixing, as shown in Figure 4, for SGC7901 cell, aptamer S1a and S4a all can well and its combination for result, and fluorescence clearly can be seen on cytolemma, and for GES-1 cell, aptamer S1a and S4a all less than significantly with its combination, so we can't see fluorescence substantially in fluorescence field.
Draw to draw a conclusion by above-mentioned experiment: adaptor sequence of the present invention all can well be combined with target cell, and targeting is also fine, for these aptamers provide possibility for clinical diagnosis and molecular image later.
Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
SEQUENCE LISTING
<110> Wuhan University
The aptamer that the screening of the aptamer of the selectively targeted stomach cancer cell of <120> and screening obtain
<130> 1
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 78
<212> DNA
<213> Artificial Sequence
<220>
<223> random single-stranded DNA banks
<220>
<221> misc_feature
<222> (20)..(59)
<223> n is a, c, g, or t
<400> 1
accgaccgtg ctggactctn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnna 60
gtatgagcga gcgttgcg 78
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> asymmetric PCR upstream primer B1
<400> 2
accgaccgtg ctggactct 19
<210> 3
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> asymmetric PCR downstream primer B2
<400> 3
cgcaacgctc gctctca 17
<210> 4
<211> 46
<212> DNA
<213> Artificial Sequence
<220>
<223> aptamer S1a
<400> 4
tctggacgct ctgtagtgtg ttgaccagtc cctcccgtgc tggagt 46
<210> 5
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> aptamer S1b
<400> 5
actctggacg ctctgtagtg tgttgaccag tccctcccgt gctggagtat g 51
<210> 6
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> aptamer S1F
<400> 6
ggacgctctg tagtgtgttg accagtccct cccgtgctgg 40
<210> 7
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> aptamer S2a
<400> 7
ggacgctctg tagtgtgttg accagtccct cccgtgctgt 40
<210> 8
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> aptamer S3F
<400> 8
cccttgttga tggacaactc ccttcctctc cacttcgtgg agt 43
<210> 9
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> aptamer S4a
<400> 9
gatctctctc tgccctaagt ccgcacccgt gcttccctgt 40
Claims (4)
1. the aptamer of selectively targeted stomach cancer cell, is characterized in that: comprise S1a, S1b, S1F, S2a, S3F and S4a, and its nucleotide sequence is as follows respectively:
S1a：5’-TCTGGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGGAGT-3’；
S1b：5’-ACTCTGGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGGAGTATG-3’；
S1F：5’-GGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGG-3’；
S2a：5’-GGACGCTCTGTAGTGTGTTGACCAGTCCCTCCCGTGCTGT-3’；
S3F：5’-CCCTTGTTGATGGACAACTCCCTTCCTCTCCACTTCGTGGAGT-3’；
S4a：5’-GATCTCTCTCTGCCCTAAGTCCGCACCCGTGCTTCCCTGT-3’。
2. the aptamer of selectively targeted stomach cancer cell according to claim 1, is characterized in that: be S1a and S4a.
3. the aptamer of the selectively targeted stomach cancer cell described in claim 1 or 2 is preparing the application in diagnosing gastric cancer medicine.
4. a diagnosing gastric cancer medicine, is characterized in that: the aptamer comprising the selectively targeted stomach cancer cell described in claim 1 or 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310645924.2A CN103627701B (en) | 2013-12-04 | 2013-12-04 | Screening of aptamers specially targeting gastric cancer cells and aptamers obtained after screening |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310645924.2A CN103627701B (en) | 2013-12-04 | 2013-12-04 | Screening of aptamers specially targeting gastric cancer cells and aptamers obtained after screening |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103627701A CN103627701A (en) | 2014-03-12 |
| CN103627701B true CN103627701B (en) | 2015-07-15 |
Family
ID=50209150
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310645924.2A Expired - Fee Related CN103627701B (en) | 2013-12-04 | 2013-12-04 | Screening of aptamers specially targeting gastric cancer cells and aptamers obtained after screening |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103627701B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105891478A (en) * | 2015-11-29 | 2016-08-24 | 卢美珍 | Stomach disease detection kit |
| CN108613862B (en) * | 2018-05-10 | 2020-10-27 | 北京理工大学 | Double-target synchronous aptamer screening method based on capillary electrophoresis |
| CN108929873B (en) * | 2018-07-10 | 2021-10-29 | 安徽省昂普拓迈生物科技有限责任公司 | Aptamer specifically binding to metastatic gastric cancer cells and application thereof |
| CN111088323A (en) * | 2018-10-23 | 2020-05-01 | 北京和理咨询有限公司 | Cell SELEX method for screening transmembrane target protein aptamer, transmembrane target protein aptamer and application of transmembrane target protein aptamer |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101481685B (en) * | 2008-10-21 | 2011-04-20 | 武汉大学 | Small molecule nucleotide aptamer medicament for hepatitis C virus, preparation and use |
| CN101748210A (en) * | 2009-11-11 | 2010-06-23 | 兰州大学 | Single-strand DNA aptamer for detecting chronic myeloid leukemia and preparation method |
| CN103290019B (en) * | 2013-06-14 | 2014-03-12 | 严鹏科 | Atherosclerosis targeting aptamer as well as preparation method and application thereof |
-
2013
- 2013-12-04 CN CN201310645924.2A patent/CN103627701B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN103627701A (en) | 2014-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | An aptamer-based probe for molecular subtyping of breast cancer | |
| ES2954456T3 (en) | Digital analysis of circulating tumor cells in blood samples | |
| CN103627701B (en) | Screening of aptamers specially targeting gastric cancer cells and aptamers obtained after screening | |
| US20210388453A1 (en) | Controls for nucleic acid assays | |
| CN102827845B (en) | Nucleic acid aptamer of epithelial cell adhesion molecule and preparation method thereof | |
| CN106434870A (en) | ncRNA and uses thereof | |
| CN101654711B (en) | Primer for detecting dynamic mutation of CAG repetitive sequence of ATXN3 gene and PCR amplification method thereof | |
| CN101899534B (en) | Kit and method for detecting goose parvovirus and Muscovy duck parvovirus | |
| CN108929873B (en) | Aptamer specifically binding to metastatic gastric cancer cells and application thereof | |
| CN103667514B (en) | A kind of human interleukin 2 8B gene pleiomorphism fluorescence PCR detection reagent kits | |
| CN105734679B (en) | Nucleic acid target sequence captures the preparation method of sequencing library | |
| Ding et al. | Diagnostic applications of gastric carcinoma cell aptamers in vitro and in vivo | |
| WO2022095141A1 (en) | Gpc1 dna aptamer and use thereof | |
| CN111836902A (en) | Fluorescent nucleic acid nanostructure-graphene biosensor for nucleic acid detection | |
| WO2020187137A1 (en) | Method for preparing probe targeting target nucleic acid target | |
| ES2908932T3 (en) | Nucleic acid microvesicle profiling and uses thereof as hallmarks in kidney transplant rejection diagnosis | |
| CN102766693A (en) | Nucleic acid aptamer for detecting human hepatoma cell line SMMC-7721 as well as screening method and application thereof | |
| Shandilya et al. | Gold based nano-photonic approach for point-of-care detection of circulating long non-coding RNAs | |
| CN109266654B (en) | Aptamer for detecting bladder cancer and application thereof | |
| CN107177676B (en) | Use of long-chain non-coding RNA NONHSAT113026 as molecular marker for diagnosing kidney cancer | |
| CN109266653B (en) | Reagent, device and method for capturing drug-resistant heterogeneous circulating tumor cells and performing gene analysis | |
| CN110468209A (en) | A kind of kit for the transfer of early warning colorectal cancer | |
| TWI642778B (en) | Aptamer specific to ovarian cancer and detection method for ovarian cancer | |
| CN103320445A (en) | DNA (deoxyribonucleic acid) aptamer GCA-5 capable of specifically identifying gastric cancer cells and application of DNA aptamer GCA-5 | |
| CN103525926B (en) | A kind of screening method of the drug toxicity private medical service gene marker based on gene expression profile |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150715 Termination date: 20161204 |