CN101748210A - Single-strand DNA aptamer for detecting chronic myeloid leukemia and preparation method - Google Patents

Abstract

The invention provides a single-strand DNA aptamer for detecting chronic myeloid leukemia and preparation method, a random single-stranded DNA library whose length is 88 bases is synthesized in vitro, the biotin-streptavidin magnetic sand is adopted to prepare a secondary library, the neutrophilic granulocyte of normal person serves as anti-sieve cells, and the SELEX technology is utilized to sieve the aptamer which is specifically combined with chronic myeloid leukemia K562 cell. The aptamer obtained through sieving is recycled and purified and then is connected with pGEM-T plasmid vector, after the blue-white screening is conducted, 24 clones are randomly selected for sequence detecting. The fluorescence-labeled primer method is adopted to detect the affinity; meanwhile, a primary structure homology analysis and a secondary structure prediction of the aptamer sequence are conducted through using DNAMAN software. The primary structure analysis shows no homologous sequence, but the aptamer sequence can be divided into 6 families (family). The secondary structure analysis shows: the stem ring, convex ring structure formed by the aptamer maybe the structural basis for specifically combining with the K562 cell. In the 24 cloning aptamers, the combining rates of the aptamers of number 5, 10, 21, 22, and 24 and the chronic myeloid leukemia K562 cell are higher, are respectively 40.6%, 45.2%, 40.8%, 42.2%, 41.6%.

Description

Detect single-strand DNA aptamer of chronic myelocytic leukemia and preparation method thereof

Technical field

The invention belongs to biomedical sector, particularly Measurement for Biotechnique.Be specifically related to a kind of utilize molecular biology SELEX technical project can the specific detection human chronic myelogenous leukemia high-affinity single-strand DNA aptamer and preparation method thereof.

Background technology

Leukemia (Leukemia) is a kind of malignant proliferation disease that originates from the marrow pluripotential hemopoietic stem cell.In China, leukemia is listed in one of ten big frequently-occurring tumours, accounts for about 5% of tumour total incidence.Its mortality ratio accounts for the 6th of China tumour male sex, the 8th of women, accounts for the 1st in children and teenager.Chronic myelocytic leukemia, (chronicmyelognous leukemia CML), is an a kind of clinically onset and development leukemia relatively slowly, shows as the expansion of medullary system progenitor cell pond, myelocytic series and progenitor cell hypertrophy thereof to be called for short slow grain.The CML morbidity survey result of China is an annual morbidity 36/10 ten thousand, accounts at China CML that each is leukemoid 20%, accounts for 95% of chronic leukemia.Age of onset is distributed more widely, but sickness rate has the trend that progressively rises with the growth at age.Leukemic clinically diagnosis mainly relies on blood picture, bone marrow smear, cytochemical staining and detects leukemia cell antigen with flow cytometer, but hemogram checking does not have specificity, bone marrow aspiration has certain risk, and technical requirements is higher, the affected factor of cytochemical staining result is more, as reagent, each experimenter's judging criterion etc., the result is differed greatly, flow cytometer detects and costs an arm and a leg, and can not carry out mass survey to leukemia as the project of routine physical examination.The leukemia that existing clinically detection means is diagnosed out has all belonged to late period, if can early diagnosis, and no matter chemotherapy or radiotherapy, result of treatment highly significant, but symptom, sign completely dissolve, blood picture, bone marrow smear recover normal or near normal.Therefore leukemic early diagnosis becomes problem demanding prompt solution.Utilize the SELEX technology screening to go out the adaptive son of target cell specificity, thereby set up leukemic early stage specific detection technological method.

SELEX technology (the aglucon phyletic evolution technology of Systematic Evolution of Ligands by Exponential Enrichment index concentration) is a kind of new tissue chemical technology of early 1990s development, its basic thought is a large vol strand of an external structure oligonucleotide library, and mix with the target material, form the mixture of target material and nucleic acid, wash off not and target material bonded nucleic acid, separate and target material bonded nucleic acid, and be that template is carried out pcr amplification with this nucleic acid molecule, carry out the screening process of next round again.By multiple screening and amplification, obtain high specificity, oligonucleotide aptamer (aptamers) that avidity is high at last, have big, wide, the advantages such as avidity is high, high specificity of target material scope of storage capacity, be successfully applied to the screening of target substances of multiple types, except that being used for nucleotide sequence, protein, amino acid (L-arginine), also can be used for dyestuff, metal ion, medicine small molecules (as theophylline), somatomedin, peptide chain, steroid, carbohydrate, even can be used for complete cell, virus, spore and Protein virus etc.Easy, quick, economic dispatch characteristics that this method has, compare with other chemical libraries such as random peptide library, antibody library and phage display library, the adaptive son that filters out from oligonucleotide library has higher avidity and specificity, has a good application prospect.At present by this technology screening to the target material kind more than 200 is arranged, the adaptive son that filters out plays an important role at the diagnosis of disease, the aspects such as quick exploitation of Medications and remedies.

At present, utilize the research of the adaptive sub-aspect of SELEX technology screening specificity a lot of at home, but it is still blank in the exploitation of the adaptive son of leukemia, and the document of delivering abroad only reported that with acute myeloblastic leukemia cell, T-ALL be the method for the adaptive son of material screening, however in the preparation of the adaptive son of chronic myelocytic leukemia without any report.Therefore the adaptive son of DNA selected of this testing sieve can fill in the blanks, and provides scientific basis and experiment basis for the diagnosis of chronic myelocytic leukemia, treatment etc.

Summary of the invention

The purpose of this invention is to provide a kind of can specificity in conjunction with the adaptive son of the DNA of chronic myeloid leukemia cell, the adaptive son of this DNA provides new method for diagnosing and treating chronic myelocytic leukemia, for overcoming the problem that to accomplish early diagnosis, early treatment clinically now, provide new solution route.

Another object of the present invention provide a kind of preparation can with the method for the adaptive son of chronic myeloid leukemia cell high-affinity specificity bonded DNA, this method comprises that structure, pcr amplification, the vitamin H-Streptavidin magnetic bead of random single-stranded DNA banks and primer separate that preparation secondary library, SELEX screening, human neutrophil are instead sieved, the analysis of one-level secondary structure, the specific mensuration of adaptive sub-avidity.

The invention has the beneficial effects as follows: can be specific, and very low with the combination rate of other cells in conjunction with on the chronic leukemia K562 cell, so the adaptive son of this DNA is modified detects and treat chronic myelocytic leukemia.Carry out the screening of the adaptive son of DNA of chronic myelocytic leukemia because adopted new combinatorial chemistry technique-SELEX technology, guaranteed that but the adaptive son specificity of DNA that obtains is combined on the chronic myelocytic leukemia cell, thereby detected and the treatment chronic myelocytic leukemia.In addition, the adaptive son of DNA of the present invention's preparation is a small molecules nucleic acid, and its molecular structure is different from the detection material of any use, and only high-affinity there is no harm in conjunction with chronic granulocyte to other cells; The adaptive son of this DNA also is different from traditional antibody, and its molecular weight is little, can infiltrate fast, and modified back is as the medicine portable object, and no antigen does not cause side effect.

Description of drawings

Fig. 1 represents different round-robin PCR product 3% agarose electrophoresis figure;

1-5 represents 9,12,15,18,21 cycle P CR products respectively among Fig. 1; M represents 100bp DNA Marker; Arrow is designated as the purpose band.

Fig. 2 represents the PCR product 3% agarose electrophoresis figure of part SELEX screening;

1-5 represents the 1st, 4,7,10, the 13 PCR products of taking turns screening respectively among Fig. 2; M represents 100bp DNA Marker; Arrow is designated as the purpose band.

Fig. 3 represents that the product combination rate of part SELEX screening surveys absorbance A value figure;

X-coordinate is the screening wheel number among Fig. 3, and ordinate zou is the absorbance A value.

Fig. 4 is the mensuration figure of competence DH5 α transformation efficiency;

Fig. 5 is the complementary screening figure of recombinant chou transformed into escherichia coli DH5 α α;

Fig. 6 is the secondary structure prediction figure of the adaptive son of DNA.

Embodiment

Materials and methods

One, experiment material

1.2 cell and bacterial strain

Chronic myelocytic leukemia K562 cell strain; Bacillus coli DH 5 alpha.

1.3 cloning vector

Cloning vector pGEM-T is available from Promega company,

1.4 main agents and test kit

1.4.1 PCR test kit: give birth to worker Bioisystech Co., Ltd available from Shanghai;

1.4.2 PCR product purification test kit: give birth to worker Bioisystech Co., Ltd available from Shanghai;

1.4.3 UNIQ-10 pillar DNA glue reclaims purification kit: give birth to worker Bioisystech Co., Ltd available from Shanghai;

1.4.4 100bp DNAmarker: available from Xi'an boat ancient cooking vessel state Bioisystech Co., Ltd;

1.4.5 human neutrophil extracting solution: available from Xi'an boat ancient cooking vessel state Bioisystech Co., Ltd;

1.4.6 vitamin H-strepto-affinity biscuit porcelain pearl and magnetic force frame: available from Promega company;

1.4.7 pGEM-T carrier and T4DNA ligase enzyme: available from Promega company;

1.4.8 calf serum: available from Hangzhou folium ilicis chinensis company;

1.4.9 penbritin (Amp): available from Huamei Bio-Engrg Co.;

1.4.10 ethidium bromide (EB): available from Huamei Bio-Engrg Co.;

1.4.11 Agarose (agarose): German import packing;

1.4.12 IPTG:Promega product packing;

1.4.13 X-gal: U.S.'s import packing;

1.4.14 Tryptones: Britain Oxoid company product;

1.4.15 yeast extract: Britain Oxoid company product;

1.4.16 Agar (agar): Japanese import packing;

1.4.17 ATP: available from Huamei Bio-Engrg Co.;

1.4.18 CaCl2: available from Beijing chemical reagents corporation;

1.4.19 Tris: available from the emerging chemical reagent in Shanghai institute;

1.4.20 EDTA: available from Beijing chemical reagents corporation;

1.4.21 BSA (bovine serum albumin): available from Xi'an company of boat ancient cooking vessel state Bioisystech Co., Ltd;

1.4.22 phenol: chloroform: primary isoamyl alcohol (25: 24: 1): give birth to worker Bioisystech Co., Ltd available from Shanghai;

1.4.23 the little extraction reagent kit of plasmid: day root biochemical technology company limited;

1.5 main agents and preparation

1.5.1 the preparation of RPMI-1640:

Get 10.4g 1640 dry powder and be dissolved in the fresh tri-distilled water of 800ml, magnetic agitation 2h adds 2g NaHCO ₃Restir 4h adds each 100,000 U of penicillin and streptomycin, is settled to 1L, and filtration sterilization and branch install to several bottles, and 4 ℃ of refrigerators are preserved standby.

1.5.2 the deactivation of serum:

1 bottle of calf serum deactivation 35min in 56 ℃ of water-baths eliminates complement activity, divides to install to several bottles, and-20 ℃ of preservations are standby.

1.5.3 glutamine stock solution:

Glutamine 2.922g is dissolved in tri-distilled water and adds to the solution that 100ml promptly is made into 200mmol/L, after the abundant stirring and dissolving, and filtration sterilization, the packing bottle ,-20 ℃ of preservations add the 1ml glutamine solution in the 100ml nutrient solution during use.

1.5.4 the preparation of perfect medium:

Add the calf serum of 10ml deactivation in the 90ml RPMI-1640 liquid nutrient medium, make the RPMI-1640 perfect medium that contains 10% calf serum.

1.5.5 the preparation of D-hank ' s liquid:

Take by weighing NaCl 8.00g, KCl 0.4g, Na ₂HPO ₄12H ₂O 0.134g, KH ₂PO ₄0.06g, NaHCO ₃0.35g phenol red 0.02g is dissolved in the 900ml tri-distilled water, 7.4%NaHCO ₃The pH value is to 7.2-7.4, and capacity flask constant volume is to 1L, 1.034 * 10 ⁵Steam sterilizing 20min under the Pa high pressure, 4 ℃ of refrigerators are preserved standby.

1.5.6 0.01mol/L, the preparation of pH 7.4PBS:

Take by weighing NaCl 8.0g, KCl 0.2g, Na ₂HPO ₄12H ₂O 3.628g, KH ₂PO ₄0.24g be dissolved in the 900ml tri-distilled water, capacity flask constant volume is to 1L, 1.034 * 10 ⁵Vapor sterilization 20min under the Pa high pressure, 4 ℃ of refrigerators are preserved standby.

1.5.7 the preparation of the EDTA of 0.5mol/L (pH8.0):

In the 800ml distilled water, add EDTA-Na ₂2H ₂O 186.1g, vigorous stirring on magnetic stirring apparatus, the pH value to 8.0 with the 1mol/LNaOH regulator solution is settled to 1L then, and it is standby that autoclaving is put in 4 ℃ of refrigerators preservations after the packing.

1.5.8 the preparation of the TE damping fluid of pH 8.0:

Draw Tris-Cl (pH 8.0) 10ml of 1mol/L, the EDTA of 0.5mol/L (pH8.0) 2ml, the distilled water of adding 800ml is regulated pH to 8.0, is settled to 1000ml, autoclaving after the packing, 4 ℃ of refrigerators are preserved standby.

1.5.9 the preparation of ethidium bromide (EB):

The ethidium bromide of dissolving 0.1g in the 10ml distilled water, magnetic agitation 3h makes its dissolving, uses the aluminium foil wrapping container after the packing, and 4 ℃ of refrigerators are preserved standby.

1.5.10 the preparation of 5 * TBE:

Take by weighing 54g Tris alkali and add 27.5g boric acid and 20ml 0.5mol/L EDTA (pH 8.0), add distilled water and be settled to 1L, 4 ℃ of refrigerators are preserved standby.

1.5.11 the preparation of 6 * sample-loading buffer:

The sucrose that takes by weighing the tetrabromophenol sulfonphthalein of 2.5mg and 4g is settled to 10ml after with the distilled water dissolving, and 4 ℃ of refrigerators are preserved standby.

1.5.12 the preparation of 3% sepharose:

1.5g agarose+50ml electrophoretic buffer, heating 30s adds 10mg/ml ethidium bromide 1.25ul, fully mixing to boiling when the agar thing of fusing is cooled to 50 ℃ in microwave oven, warm gel is poured in the glued membrane of having put comb, used after at room temperature placing 30-45min.

1.5.13 the preparation of 3%BSA:

3g bovine serum albumin (BSA) is dissolved among the 100ml PBS, and 4 ℃ of refrigerators are preserved standby.

1.5.14 the preparation of 2 * binding buffer liquid:

50mM TrisHCl, 5mM KCl, 100mM NaCl, 1mM MgCl ₂, regulate pH 7.4.

1.5.15 the preparation of 2 * lavation buffer solution:

0.1ml Tween 20 solution are added in the PBS damping fluid of 100ml sterilization pH 7.4, abundant mixing, 4 ℃ of refrigerators are preserved standby.

Two, experimental technique

2.1 the cultivation of chronic myelocytic leukemia K562 cell

Place 37 ℃, saturated humidity, 5%CO with the RPMI-1640 nutrient solution that contains 10% calf serum ₂Incubator in cultivate.Go down to posterity once every other day.

2.2 random single chain DNA (ssDNA) library and primer

Below ssDNA library and primer all entrust Shanghai living worker Bioisystech Co., Ltd synthetic at random.

2.2.1 ssDNA library at random

Having made up length is the library of ssDNA at random of 88nt, and two ends are the immobilized primer sequence, and middle 52 Nucleotide are stochastic sequence, and storage capacity is approximately 10 ¹⁶, resultant quantity is 2OD ₂₆₀The tri-distilled water that synthetic storehouse is added 22 μ l is mixed with 100 μ M stock solutions-20 and ℃ stores for future use.

The synthetic sequence is as follows:

5’-ATACCAGCTTATTCAATT-52-nt-AGA?TAGTAAGTGCAATCT-3’

Synthesized standard substance (5 '-FITC-88nt-3 ') in addition, used when measuring combination rate.

2.2.2 primer

Synthetic following 5 kinds of primers do not have any secondary structure and form, and do not have homology with existing nucleotide sequence in the nucleotide sequence.Primer sequence is as follows:

P1 5’-ATACCAGCTTATTCAATT-3’

P2 5’-FITC-ATACCAGCTTATTCAATT-3’

P3 5’-Dig-ATACCAGCTTATTCAATT-3’

P4 5’-Bio-AGATTGCACTTACTATCT-3’

P5 5’-AGATTGCA?CTTACTA?TCT-3’

Primer P1 and P5 correspond respectively to the two ends fixed sequence program in ssDNA storehouse at random, are beneficial to annealing extension when PCR reacts; Primer P4 biotin labeling is using during for strand with vitamin H-Streptavidin magnetic bead DNA isolation two strands; Primer P2, P3 use fluorescein and digoxigenin labeled respectively, use when measuring combination rate.More than 5 kinds of primer resultant quantities be 5OD ₂₆₀, the tri-distilled water that the primer of every OD adds 57 μ l is mixed with 100 μ M stock solutions-20 and ℃ stores for future use.

2.3 the adaptive son of SELEX technology screening K562 cell

2.3.1 SELEX screening process

The library of ssDNA at random of (1) 10 μ g is added in 400 μ l, 2 * binding buffer liquid, and 99 ℃ of sex change 5min in the 1.5ml Eppendorf tube place 0 ℃ of 10min on ice then immediately;

(2) add 3%BSA 13.5 μ l and reduce background;

(3) with 1 * 10 ⁶Individual's chronic myelocytic leukemia K562 cell is added to mixing in the above-mentioned solution, 37 ℃ of water-bath 30min;

(4) change centrifuge tube, remove and tube wall bonded ssDNA;

(5) the centrifugal 5min of 3000rpm removes supernatant, adds the 400 μ l binding buffer liquid mixings centrifugal 5min of 3000rpm again, 6 times repeatedly;

(6) last gained precipitation adds 100 μ l ddH ₂O, 100 ℃ of heating 10min;

(7) the centrifugal 5min of 10000rpm gets supernatant, and through phenol: the chloroform extracting, ethanol sedimentation is dissolved in ssDNA in the 20 μ lTE damping fluids.

2.3.2 pcr amplification

The ssDNA that above-mentioned screening process is obtained becomes the dsDNA of an end band vitamin H through pcr amplification with upstream primer P1 and the biotin labeled primer P4 in downstream.

The PCR reaction system is: template m μ l, 10 * PCRButter, 5 μ l, MgCl ₂3 μ l, dNTPs 5 μ l, Taq DNA polymerase 2U, upstream primer, each 25pmol of the biotin labeled primer of downstream 5 ' end add deionized water to 50 μ l;

The PCR reaction conditions is: 94 ℃ of pre-sex change 2min, and the sex change 30s that carries out 94 ℃ of n circulations then, 45 ℃ of annealing 1min, 72 ℃ are extended 30s, and last 72 ℃ are extended 5min.

The PCR reaction system is as follows:

M is the template amount, constantly changes along with the increase of screening wheel number, and concrete numerical value sees Table 1;

N is a cycle index, constantly changes along with the increase of screening wheel number, concrete numerical tabular 1.

In order to catch adaptive son as much as possible, several the wheel in the screening process of beginning, ssDNA library and cell concentration are thrown in a lot; Several the wheel in the screening subsequently, because the adaptive son enrichment of high specific, in order to improve the preciseness of screening, binding time reduces to 20min by 30min; The template amount also reduces to 0.5 μ l by 2 μ l; Yet the PCR cycle number but is increased to 16 circulations by 11 original circulations; Concrete numerical value sees Table 1.

Table 113 is taken turns screening adds cell, ssDNA library, binding time, PCR cycle number and template scale

2.3.3 the pcr amplification product electrophoresis is identified

With 3% the sepharose that contains concentration 0.25 μ l EB, take turns in the PCR product that screens product every, get 5-10 μ l and be splined on 80V, carry out electrophoresis, take out gel behind the 30min, observe and photograph with gel images analytical system (Syngene ChemiGenius 2).

2.3.4 pcr amplification product purifying

The PCR product reclaims the test kit purifying with UNIQ-10 pillar PCR product.

In the experimentation, we find that annealing temperature is very big to the influence of PCR reaction result: this experiment optimum annealing temperature is 45 ℃; When annealing temperature during at 40-65 ℃, 3% agarose gel electrophoresis has the purpose band; When annealing temperature is lower than 40 ℃, there is fragment to occur greater than the purpose band; When annealing temperature is higher than 65 ℃, there is not any PCR reaction product.

In addition, template content and cycle index are also very big to the reaction result influence: the template content and the cycle index of the every SELEX of wheel screening all have nothing in common with each other.Template content is certain, and cycle index is very few, no purpose band, and cycle index is too much, the scalariform band then occurs and conditions of streaking is arranged, and the result is as shown in Figure 1; Template content is very few, suitably increases circulation and also can obtain the purpose band; Template content does not too much have the purpose band on the contrary.Other factors such as primer concentration, dNTP concentration, Mg ²⁺Ionic concns etc. also have certain influence in amplification procedure.

Electrophoretic band is tapered with the increase of SELEX screening wheel number and becomes fine and close, and the result as shown in Figure 2.

2.3.5 magnetic bead separates the secondary library of preparation

Get 100 μ l magnetic beads in the mid-magnetic force frame of 1.5ml Eppendorf tube 1～2min, inhale and abandon supernatant; Take down Eppendorf tube, add the resuspended magnetic bead of 100ul 2 * lavation buffer solution; Replacement magnetic force frame 1～2min inhales and abandons lavation buffer solution, adds 200 μ l, 2 * lavation buffer solution, adds 37 ℃ of water-bath 15min of the biotinylated dsDNA of 200 μ l again; Last magnetic force frame 1～2min inhales and abandons supernatant; Wash 2～3 times with 200 μ l1 * lavation buffer solution; Add 50 μ l150mM NaOH in 37 ℃ of water-bath 15min, dsDNA is unwind; Last magnetic force frame, a ssDNA who contains vitamin H still stays on the Streptavidin magnetic bead and is adsorbed in tube wall, and another ssDNA that does not contain vitamin H then is present in the supernatant, isolates the ssDNA in the supernatant and measures the A value, and this is the ssDNA storehouse of next round screening.

2.3.6 the extraction of normal people's neutrophil leucocyte

This experiment material is all taken from the Physical Examination crowd of No.1 Hospital of Lanzhou University, with all experimental subjects signature informed consent postscripts, extract venous blood 2ml on an empty stomach, and from blood, extract neutrophil leucocyte with human neutrophil extracting solution (available from Xi'an boat ancient cooking vessel state Bioisystech Co., Ltd), step is carried out to specifications.

2.3.7 sieve with neutrophil leucocyte is counter

For the speed of accelerating to screen, and improve the specificity of adaptive son effectively, this experiment is done anti-sieve with neutrophil leucocyte, and step is as follows:

(1) magnetic bead is separated the ssDNA storehouse 99 ℃ of heating 5min that obtains and carry out sex change, place 0 ℃ of 10min then immediately;

(2) with 1 * 10 ⁶The individual neutrophil leucocyte that extracts from blood goes to add above-mentioned solution behind the supernatant, and 37 ℃ of water-bath 30min of damping fluid 400 μ l bring Selection In;

(3) with the centrifugal 2min of mixed solution 3000rpm, get supernatant, be used for next round SELEX screening.

2.3.8 the mensuration of ssDNA library and K562 cellular affinity

The product of 1-13 wheel SELEX screening, carry out pcr amplification with the primer P3 of mark digoxin and the primer P4 of mark vitamin H, electrophoresis is identified clearly PCR product test kit purifying of purpose band, fully react with the K562 cell then and unwind with 150mM NaOH, the ssDNA of digoxigenin labeled is free in the supernatant, measures ssDNA content.

Press ssDNA: K562 cell=500pmol: 1 * 106 combination in 400 μ l, 2 * binding buffer liquid, centrifugal, abandon supernatant, the alkaline phosphatase that adds the anti digoxin antibody mark of 100 μ l dilution in 1: 15000, reaction 10min, centrifugal, abandon supernatant, behind 500 μ l1 * binding buffer liquid suspension K562 cell, centrifugal, abandon supernatant, repeated washing 3 times, flush away not with anti digoxin antibody bonded alkaline phosphatase, with substrate colour developing, measure A value (three tests are averaged) with enzyme connection instrument in 405nm after the termination reaction.Result such as Fig. 3 represent.

2.4 clone, order-checking and structural analysis

2.4.1 preparation competence e.colidh5

(1) selects single colony inoculation in the test tube that contains 2ml LB liquid nutrient medium from intestinal bacteria DH 5 α flat boards, 37 ℃ of shaking table jolting overnight incubation;

(2) next day, get the muddy bacterium liquid of 0.5ml and transfer in the Erlenmeyer flask that contains 50ml LB liquid nutrient medium, 37 ℃ of shaking table jolting 2～3h make the OD of bacterium liquid ₆₀₀≤ 0.4～0.5;

(3) bacterium liquid is transferred in the centrifuge tube of 50ml, placed 10min immediately on ice;

(4) 0～4 ℃, the centrifugal 10min of 4000rmp makes cell precipitation, reclaims cell;

(5) pour out nutrient solution in the centrifuge tube, centrifuge tube is inverted in 1min on the filter paper of a sterilization, to flow to end nutrient solution as far as possible;

(6) with the CaCl of ice-cold 0.1M ₂The 10ml precipitation that suspends is put immediately and is incubated 30min on ice;

(7) 0～4 ℃, the centrifugal 10min of 4000rmp makes cell precipitation, reclaims cell;

(8) pour out liquid in the centrifuge tube, centrifuge tube is inverted in 1min on the filter paper of a sterilization, to flow to end residual liquid as far as possible;

(9) CaCl of ice-cold 0.1M ₂The 2ml suspension cell is made competent cell;

(10) rapidly the suspension branch is installed in the aseptic Eppendorf pipe every pipe 200 μ l.

2.4.2 the mensuration of competence bacillus coli DH 5 alpha transformation efficiency

(1) after the pGEM-T plasmid dilution in 1: 100 with 0.5 μ g/ μ l stand-by (dilution of pGEM-T plasmid concentration is 5ng/ μ l);

(2) add the pGEM-T plasmid 1 μ l that dilutes to the Eppendorf of the good competent cell of above-mentioned packing pipe, the piping and druming mixing is put 30min on ice;

(3) the Eppendorf pipe is put into 42 ℃ of water-bath 90s;

(4) the Eppendorf pipe is placed 2min on ice;

(5) the LB liquid nutrient medium of adding 800 μ l, 37 ℃ are shaken cultivation 1h slowly;

(6) conversion reaction in the pipe is done 1: 10 dilution (pGEM-T plasmid concentration wherein is 2.5ng/ml) with nutrient solution, get wherein that the diluent of 100 μ l is added in the culture dish of the LB solid medium that contains suitable Amp, transformed bacteria evenly is layered on the agar plate surface with aseptic coated with glass device;

(7) flat board is placed room temperature 0.5h so that liquid can be absorbed;

(8) be inverted flat board in 37 ℃ of cultivation 16h, carry out enumeration;

(9) calculate transformation efficiency according to following formula:

The total amount of the sum of transformation efficiency=generation bacterium colony/bed board DNA.For example: transform the competent cell of 100 μ l with the complete plasmid DNA of 0.1ng, in conversion reaction liquid, add 900 μ l nutrient solutions (0.1ng/1ml), allow bacterium recover for some time (1h).Conversion reaction is done 1: 10 dilution (0.01ng/ml) with nutrient solution, and getting wherein, the diluent of 100 μ l is coated with (0.001ngDNA/100 μ l).If can obtain 200 clones, transformation efficiency is 2 * 10 ⁸Cfu/ugDNA, method of calculation are as follows:

200cfu/0.001ng＝2×10 ⁵cfu/ng＝2×10 ⁸cfu/ugDNA

Transformation efficiency 1 * 10 ⁶Cfu/ μ gDNA can satisfy common subclone experiment; 1 * 10 ⁷Cfu/ μ gDNA is used to do more complicated subclone.Result such as Fig. 4 show.

2.4.3 amplification of screening product and glue reclaim purifying

Take turns the ssDNA that obtains of screening through 11, become dsDNA with primer 1 and primer 5 through pcr amplification, reclaim test kit recovery DNA with glue again, the by specification operation steps is carried out.

2.4.4 the ligation of PCR purified product

(1) dna molecular molar mass method of calculation:

Dna molecular mole number (pmol)=dna molecular quality (ng) * 1000/ (the bp number of 660 * dna molecular)

(2) PCR glue recovery product is about 10ng/ μ l by the appraisal of 3% agarose gel electrophoresis.

(3) in Eppendorf tube, add following composition in 1: 3,1: 5,1: 8 ratio:

Above-mentioned substance is mixed, and 4 ℃ of placements are spent the night.

2.4.5 connect conversion and the Amp and the complementary screening of α of product

(1) add ligation liquid 10 μ l to the Eppendorf of the good competent cell of above-mentioned packing pipe, the piping and druming mixing is put 30min on ice;

(2) the Eppendorf pipe is put into 42 ℃ of water-bath 90s;

(3) the Eppendorf pipe is placed 2min on ice;

(4) to the LB liquid nutrient medium of each pipe adding 800 μ l, 37 ℃ are shaken cultivation 1h slowly;

(5) above each pipe is got conversion reaction and get 100 μ l with nutrient solution, separate application is to the LB flat board of IPTG/X-gal/Amp;

(6) flat board is placed room temperature 0.5h so that liquid can be absorbed;

(7) be inverted flat board and cultivate 16h in 37 ℃;

(8) take out culture dish and place 6h, blueness is fully manifested, observations such as Fig. 5 at 4 ℃.

2.4.6 select the order-checking of mono-clonal bacterium liquid

Take out culture dish next day, 24 colony inoculations of random choose contain in the LB liquid nutrient medium of Amp in 3ml, 37 ℃ are shaken bacterium and spend the night, drawing transformed bacteria liquid 1ml respectively adds in the centrifuge tube, every pipe adds 30 μ l sterile glycerols, puts upside down mixing, envelope and serves the sea behind the film and give birth to worker Bioisystech Co., Ltd and adopt the universal sequencing primer thing (T7 primer) of carrier to identify and order-checking.Residue bacterium liquid adds 100 μ l sterile glycerols, and it is frozen to put upside down mixing postposition-80 ℃ refrigerator.

2.4.7 adaptive sub-primary structure and secondary structure analysis

With DNAMAN software region sequence is at random analyzed and to be found no homologous sequence, but can be divided into 6 families (family): conserved sequence is contained in family 1 ACCAG, conserved sequence is contained in family 2 ACCGG, conserved sequence is contained in family 3 CCCGC, conserved sequence is contained in family 4 CTCC, conserved sequence is contained in family 5 AAGTTTotally 10 of families 6, no conserved sequence.

The result is as follows:

Family?1

1 N18--CACCACGAGGAACTTCCCGCAA ACCAGCAGATGTGACACGCATAGGTCCT--N18

2 N18-- ACCAGATAGTAAGTGCAATCTAT ACCAGCTTATTCAATTGGC--N18

9 N18--ATCGTTTTTAAGAGAATGAGAGGTGGGGCGCGTCC ACCAGGCCTAAGTCGG--N18

Family?2

6 N18--CGCGGCGGAATCCCCCGGAGC ACCGGAACGGGCGGGAATCTGGCCACTGCTCG--N18

7 N18--GGTCGGGGCAGTCCTCGTAAC ACCGGACTGGGCGGGAATGACCTCTCTGTTC--N18

17?N18--TAGGAGTGGG ACCGGTACAAAAAAATATAACCCACTCAATATAATGCCTCAT--N18

Family?3

10 N18-- CCCGCTGCTTCGGCTCCCCACTCCGCACTGTGTTACTGCCTTAGTCTACTTG--N18

16 N18--ACTGA CCCGCCTGGAGAGATCTCGTCCCAGTTGCAAACCTAACGTCGATTAT--N18

22 N18--GAGCTTCC CCCGCGAGACCGTTAGCGACGTCAATTGGAGTCTATTCACCAGA--N18

Family?4

5 N18--CCGCCCGGTCAGCATCTCTTCCCAACCTATTTTCACTGTGTGG CTCCCTATC--N18

11 N18--ACCTGGTCCTACCCTCTTTACTGGATCAGTC CTCCGCCGAGTATTTTTTGTG--N18

24 N18--AGTTCGGCTCAGAAGGGGTGCTAG CTCCGGGTGTAGCCGGACGCGTGACCGT--N18

Family?5

12 N18--GGCAAGGAAATTCACTCATGGAGTATGTGG AAGTTAAGACGGTTCCGGGGCG--N18

19 N18--CCGTCC AAGTTTTCTACTTCCGTTTAGCAAGTCAATGTTGCGTTGTCTCTG--N18

Family?6

3 N18-AGTTCGGCTCAGAAGGGGTGCTAGCTCCGGGTGTAGCCGGACGCGTGACCGT--N18

4 N18-GAGCTTCCCCCGCGAGACCGTTAGCGACGTCAATTGGAGTCTATTCACCAGA--N18

8 N18-GCCGTCCAAGTTTTCTACTTCCGTTTAGCAAGTCAATGTTGCGTTGTCTCTG--N18

13 N18-GCACCACGAGGAACTTCCCGCAAACCAGCAGATGTGACACGCATAGGTCCT--N18

14 N18-GGTCGGGGCAGTCCTCGTAACACCGGACTGGGCGGGAATGACCTCTCTGTTC--N18

15 N18-CCGCCCGGTCAGCATCTCTTCCCAACCTATTTTCACTGTGTGGCTCCCTATC--N18

18 N18-CCCGCTGCTTCGGCTCCCCACTCCGCACTGTGTTACTGCCTTAGTCTACTTG--N18

20 N18-ACCTGGTCCTACCCTCTTTACTGGATCAGTCCTCCGCCGAGTATTTTTTGTG--N18

21 N18-CATCGTTTTTAAGAGAATGAGAGGTGGGGCGCGTCCACCAGGCCTAAGTCGG--N18

23 N18-GGCAAGGAAATTCACTCATGGAGTATGTGGAAGTTAAGACGGTTCCGGGGCG--N18

All sequences is carried out the minimum energy secondary structure analysis with DNAMAN software, the result shows: the secondary structure of all oligonucleotide aptamers mainly is made up of stem ring and bulge loop structure, be divided into following 5 classes: category-A: stochastic sequence and 3 ' end form several little stem rings, the crotch sample distributes, and basis pontis links to each other with the big bulge loop that 5 ' end forms; Category-B: 5 ' end forms several little stem rings with stochastic sequence, and bifurcation links to each other with the big bulge loop that 3 ' end forms; The C class: 5 ' end, 3 ' end and stochastic sequence form a little stem ring respectively, are connected separately on the big bulge loop; The D class: 5 ' end, 3 ' end and stochastic sequence form 4 little stem rings, are connected separately on the big bulge loop; The E class: 5 ' end, 3 ' end and stochastic sequence form a plurality of little stem ring bewildering array, no bulge loop structure.Concrete secondary structure prediction figure such as Fig. 6.

2.5 24 mensuration of cloning adaptive son and target cell avidity

Get the transformed bacteria of-80 ℃ of order-checkings that refrigerator is frozen, behind plasmid extraction, pcr amplification, purifying, measure the avidity of itself and chronic myelocytic leukemia K562 cell.

2.5.1 respectively clone the bacteria plasmid extracting

Specification sheets operation steps with plasmid extraction kit is carried out.

2.5.2 pcr amplification and amplified production purifying

Primer above-mentioned plasmid extraction product is plain with mark fluorescent and vitamin H carries out pcr amplification, gets PCR product gel electrophoresis observation and sees if there is purpose band limpid in sight, if band is limpid in sight, then is further purified the PCR product, the same 2.2.4 of method.

The PCR reaction system is as follows:

2.5.3 the preparation of fluorescence intensity-ssDNA concentration standard curve

Is the solution of 800ng/ml, 666.7ng/ml, 500ng/ml, 250ng/ml, 125ng/ml, 62.5ng/ml, 31.3ng/ml, 15.6ng/ml, 7.8ng/ml 9 pipe different concns with standard substance (5 '-FITC-88nt-3 ') with selecting the damping fluid dilution, measure the fluorescence intensity (survey and average for three times) of each pipe, draw fluorescence intensity-ssDNA concentration standard curve.

2.5.4 the preparation of fluorescein-labeled ssDNA

2.4.2 chain of middle PCR product 5 ' end contains fluorescein, another chain 5 ' end contains vitamin H.Utilize vitamin H-Streptavidin magnetic bead that dsDNA is unwind and be ssDNA.A ssDNA who contains vitamin H still stays on the Streptavidin magnetic bead and is adsorbed in tube wall, and the ssDNA of another band fluorescein is present in the supernatant, isolate ssDNA and its fluorescence intensity of usefulness fluorescent spectrophotometer assay in the supernatant, check in the content of the ssDNA of its fluorescence intensity correspondence from typical curve, this promptly measures the pure adaptive word bank of combination rate.

2.5.5 respectively clone the mensuration of adaptive son and target cell and neutrophil leucocyte combination rate

By fluorescein-labeled ssDNA: chronic myelocytic leukemia K562 cell=50pmol: 1 * 10 ⁶The ratio of individual chronic myelocytic leukemia K562 cell is carried out association reaction, with the two in selecting damping fluid in conjunction with 30min, change centrifuge tube, centrifugal, draw supernatant and measure fluorescence intensity; Centrifugal with selecting behind the resuspended chronic myelocytic leukemia K562 cell of damping fluid, draw supernatant, measure fluorescence intensity, repeated washing 2 times, flush away not with chronic myelocytic leukemia K562 cell bonded fluorescein-ssDNA.Fluorescence intensity according to each pipe washing supernatant checks in its corresponding concentration from typical curve, takes advantage of volume to obtain the amount of ssDNA, again with the amount addition of each pipe, is the total amount that is not attached to the ssDNA on the chronic myelocytic leukemia K562 cell.Otal investment is deducted unconjugated amount be the amount that is attached to the ssDNA on the chronic myelocytic leukemia K562 cell, divided by total amount, calculate combination rate with the bonded amount; Use the same method and measure the set rate of itself and the normal neutrophil leucocyte of people.The result is as shown in the table:

From last table, find out, in each adaptive son with the target cell combination rate than higher be 5,10,21,22, No. 24 adaptive sons, its combination rate is respectively 40.6%, 45.2%, 40.8%, 42.2%, 41.6%.

2.6 respectively clone adaptive sub-specificity

Measure 5,10,21,22, No. 24 high adaptive sons of demonstration combination rate by the combination rate of each adaptive son and chronic myelocytic leukemia K562 cell and neutrophil leucocyte in the last table higher specificity is all arranged, obviously reduce with the combination rate of the neutrophil leucocyte that extracts in the normal human blood, only be 2.9%, 2.8%, 3.0%, 2.5%, 2.7% respectively, prove that thus these 5 kinds of adaptive sons have higher specificity.

Adaptive sub-primary structure sequencing result table

SEQUENCE?LISTING

＜110〉Lanzhou University

＜120〉single-strand DNA aptamer of detection chronic myelocytic leukemia and preparation method thereof

＜130〉single-strand DNA aptamer of detection chronic myelocytic leukemia and preparation method thereof

<160>5

<170>PatentIn?version?3.5

<210>1

<211>88

<212>DNA

＜213〉leukemia cell

<400>1

ataccagctt?attcaattcc?gcccggtcag?catctcttcc?caacctattt?tcactgtgtg 60

gctccctatc?agatagtaag?tgcaatct 88

<210>2

<211>88

<212>DNA

＜213〉leukemia cell

<400>2

ataccagctt?attcaattcc?cgctgcttcg?gctccccact?ccgcactgtg?ttactgcctt 60

agtctacttg?agatagtaag?tgcaatct 88

<210>3

<211>88

<212>DNA

＜213〉leukemia cell

<400>3

ataccagctt?attcaattca?tcgtttttaa?gagaatgaga?ggtggggcgc?gtccaccagg 60

cctaagtcgg?agatagtaag?tgcaatct 88

<210>4

<211>88

<212>DNA

＜213〉leukemia cell

<400>4

agattgcact?tactatctga?gcttcccccg?cgagaccgtt?agcgacgtca?attggagtct 60

attcaccaga?aattgaataa?gctggtat 88

<210>5

<211>88

<212>DNA

＜213〉leukemia cell

<400>5

agattgcact?tactatctag?ttcggctcag?aaggggtgct?agctccgggt?gtagccggac 60

gcgtgaccgt?aattgaataa?gctggtat 88

Claims (3)

1. single-strand DNA aptamer that detects chronic myelocytic leukemia is characterized in that: this adaptive son has any one of the described nucleotide sequence of SEQ ID No.1 to SEQ ID No.5 in the sequence table.

2. a kind of single-strand DNA aptamer that detects chronic myelocytic leukemia according to claim 1 is characterized in that:

The secondary structure of the described nucleotide sequence of described SEQ ID No.1 is:

The secondary structure of the described nucleotide sequence of described SEQ ID No.2 is:

The secondary structure of the described nucleotide sequence of described SEQ ID No.3 is:

The secondary structure of the described nucleotide sequence of described SEQ ID No.4 is:

The secondary structure of the described nucleotide sequence of described SEQ ID No.5 is:

3. the preparation method of the single-strand DNA aptamer of a detection chronic myelocytic leukemia as claimed in claim 1, it is characterized in that: this method is carried out according to the following step:

1. with chronic myelocytic leukemia K562 cell inoculation in the RPMI-1640 nutrient solution that contains 10% calf serum, place 37 ℃, saturated humidity, 5%CO ₂Incubator in cultivate, go down to posterity every other day once;

2. make up single-stranded DNA banks:

5’-ATACCAGCTTATTCAATT-N52-AGA?TAGTAAGTGCAATCT-3’，

Wherein N represents any one among base A, G, C, the T, makes up 5 primers, is respectively:

P1 5’-ATACCAGCTTATTCAATT-3’

P2 5’-FITC-ATACCAGCTTATTCAATT-3’

P3 5’-Dig-ATACCAGCTTATTCAATT-3’

P4 5’-Bio-AGATTGCACTTACTATCT-3’

P5 5’-AGATTGCACTTACTA?TCT-3’

3. the library of ssDNA at random with 10 μ g is added in 400 μ l, 2 * binding buffer liquid, in 99 ℃ of sex change 5min, places 0 ℃ of 10min on ice then immediately; Add 3%BSA 13.5 μ l and reduce background; Again 1 * 106 people's chronic myelocytic leukemia K562 cell is added to mixing in the above-mentioned solution, 37 ℃ of water-bath 30min; The centrifugal 5min of 3000rpm removes supernatant, adds the 400 μ l binding buffer liquid mixings centrifugal 5min of 3000rpm again, 6 times repeatedly; Last gained precipitation adds 100 μ l ddH ₂O, 100 ℃ of heating 10min; The centrifugal 5min of 10000rpm gets supernatant, through phenol: the chloroform extracting, ethanol sedimentation is dissolved in ssDNA in the 20 μ l TE damping fluids;

4. the ssDNA that above-mentioned screening process is obtained becomes the dsDNA of an end band vitamin H with upstream primer P1 and the biotin labeled primer P4 in downstream through pcr amplification, and the PCR reaction system is: template m μ l, 10 * PCR Butter, 5 μ l, MgCl ₂3 μ l, dNTPs 5 μ l, Taq DNA polymerase 2U, upstream primer, each 25pmol of the biotin labeled primer of downstream 5 ' end add deionized water to 50 μ l; The PCR reaction conditions is: 94 ℃ of pre-sex change 2min, and the sex change 30s that carries out 94 ℃ of n circulations then, 45 ℃ of annealing 1min, 72 ℃ are extended 30s, and last 72 ℃ are extended 5min; Several the wheel in the screening process of beginning, ssDNA library and cell concentration are thrown in a lot; Several the wheel in the screening subsequently, because the adaptive son enrichment of high specific, in order to improve the preciseness of screening, binding time reduces to 20min by 30min; The template amount also reduces to 0.5 μ l by 2 μ l; Yet the PCR cycle number but is increased to 16 circulations by 11 original circulations;

5. the pcr amplification product electrophoresis is identified and purifying: with 3% the sepharose that contains concentration 0.25 μ l EB, take turns in the PCR product that screens product every, get 5-10 μ l and be splined on 80V, carry out electrophoresis, take out gel behind the 30min, observe and photograph with the gel images analytical system, the PCR product reclaims the test kit purifying with UNIQ-10 pillar PCR product;

6. magnetic bead separates the secondary library of preparation: get 100 μ l magnetic beads in the mid-magnetic force frame of 1.5ml Eppendorf tube 1～2min, inhale and abandon supernatant; Take down Eppendorf tube, add the resuspended magnetic bead of 100ul 2 * lavation buffer solution; Replacement magnetic force frame 1～2min inhales and abandons lavation buffer solution, adds 200 μ l, 2 * lavation buffer solution, adds 37 ℃ of water-bath 15min of the biotinylated dsDNA of 200 μ l again; Last magnetic force frame 1～2min inhales and abandons supernatant; With 200 μ l, 1 * lavation buffer solution flushing 2～3 times; Add 50 μ l 150mM NaOH in 37 ℃ of water-bath 15min, dsDNA is unwind; Last magnetic force frame, a ssDNA who contains vitamin H still stays on the Streptavidin magnetic bead and is adsorbed in tube wall, and another ssDNA that does not contain vitamin H then is present in the supernatant, isolates the ssDNA in the supernatant and measures the A value, and this is the ssDNA storehouse of next round screening;

7. neutrophil leucocyte is counter sieves: extract neutrophil leucocyte with the neutrophil leucocyte extracting solution from the crowd's blood of normally having a medical check-up, magnetic bead is separated the ssDNA storehouse 99 ℃ of heating 5min that obtains carry out sex change, place 0 ℃ of 10min then immediately; To add above-mentioned solution behind 1 * 106 neutrophil leucocyte supernatant, 37 ℃ of water-bath 30min of damping fluid 400 μ l bring Selection In; With the centrifugal 2min of mixed solution 3000rpm, get supernatant, be used for next round SELEX screening;

The analysis of 8. adaptive sub-cloning and sequencing and one-level, secondary structure: repeat to screen 13 take turns after, connect the pGEM-T plasmid vector after the adaptive son that screening is obtained reclaims purifying, after the white screening of indigo plant, 24 clones of random choose carries out sequencing; And adaptive subsequence is carried out primary structure homology analysis and secondary structure prediction with DNAMAN software;

9. clone the mensuration of adaptive son and target cell avidity: is the solution of different concns with standard substance 5 '-FITC-88nt-3 ' with selecting the damping fluid dilution, measures the fluorescence intensity of each pipe, draws fluorescence intensity-ssDNA concentration standard curve; Get the transformed bacteria of order-checking, after the extracting of plasmid extraction test kit, primer plain with mark fluorescent and vitamin H carries out pcr amplification, and then separates with vitamin H-Streptavidin magnetic bead, obtains being marked with the single stranded DNA of fluorescein, measures its fluorescence intensity; In fluorescein-labeled ssDNA: chronic myelocytic leukemia K562 cell=50pmol: the ratio of 1 * 106 chronic myelocytic leukemia K562 cell is carried out association reaction, with the two in selecting damping fluid in conjunction with 30min, change centrifuge tube, centrifugal, draw supernatant and measure fluorescence intensity; Centrifugal with selecting behind the resuspended chronic myelocytic leukemia K562 cell of damping fluid, draw supernatant, measure fluorescence intensity, repeated washing 2 times, flush away not with chronic myelocytic leukemia K562 cell bonded fluorescein-ssDNA; Fluorescence intensity according to each pipe washing supernatant checks in its corresponding concentration from typical curve, takes advantage of volume to obtain the amount of ssDNA, again with the amount addition of each pipe, is the total amount that is not attached to the ssDNA on the chronic myelocytic leukemia K562 cell; Otal investment is deducted unconjugated amount be the amount that is attached to the ssDNA on the chronic myelocytic leukemia K562 cell, divided by total amount, calculate combination rate with the bonded amount; Use the same method and measure the combination rate of adaptive son and the normal neutrophil leucocyte of people; Higher with chronic myelocytic leukemia K562 cell combination rate, and with the normal neutrophil leucocyte combination rate of people low be exactly can with the adaptive son of chronic myelocytic leukemia cell-specific bonded DNA.

Images