CN105177013A - Kit for detecting cerebrovascular diseases - Google Patents

Abstract

The invention discloses a nucleic acid aptamer and kit for specifically detecting cerebrovascular diseases. The nucleic acid aptamer disclosed by the invention has favorable affinity with Lp-PLA2 protein. The nucleic acid aptamer can capture the Lp-PLA2 in blood to prepare the corresponding kit, thereby being beneficial to diagnosis of cerebrovascular diseases and blood screening. When being used for cerebrovascular disease detection, the nucleic acid aptamer has the advantages of high sensitivity and low cost, and is easy for preparation and storage.

Description

A kind of test kit for detecting cerebrovascular disease

Technical field

The present invention relates to a kind of test kit for detecting cerebrovascular disease.

Background technology

One of cerebrovascular disease maximum killer being always acknowledged as harm humans health is also murderous main reason in global range.China dies from the number of also cerebrovascular disease every year up on 3,000,000 W, and existing patient is more than 6,000 ten thousand people.In recent years, along with improving constantly of Living consumption, the continuous deterioration of physical environment, the morbidity of the also cerebrovascular disease of various crowd, M & M are all the trend risen year by year.Especially the elderly sickness rate up to 62%, therefore prophylactic treatment also cerebrovascular disease become very urgent, it is not only related to the healthy living problem of broad masses of the people, also affects the overall condition of whole national national quality to a certain extent.

The pathologic basis of cerebrovascular disease is atherosclerosis.In recent years, research finds that atherosclerosis is a kind of Inflammatory response disease, and the product of inflammatory cell and release thereof is considered to the factor of topmost pro-atherogenic.The participation of Inflammatory response medium is all had in atherosclerosis plaque forming, progress and the process of finally breaking.

Therefore, find a kind of medium that can react this kind of dynamic changing process particularly important, had been found that a kind of new Inflammatory response mark in the world at present, namely lipoprotein is correlated with Rocky lipase A2ization ipoprotein-AssociatedPhospholipaseA2, Lp-PLA2).Therefore, detection Lp-PLA2 can realize the judgement to cerebrovascular disease.

Aptamer (Aptamer, also known as aptamers, aptamer) be can high-affinity, high specific in conjunction with the few nucleic acid molecule (ssDNA or ssRNA) of certain biological leather El target strand.Aptamer be by index concentration Fas lignand system evolution technology (Systemat1cEvolut1onofL1gandsbyExponent1alenr1chment, SELEX) screen from the DNA/RNA library of synthetic obtain can high degree of specificity in conjunction with the single stranded DNA/RNA of target molecules.Report that the target of aptamer comprises metal ion, organic molecule, polypeptide, protein, cell are even organized.The molecular recognition function of aptamer and antibody class are seemingly, there is the target recognition capability quite even stronger with antibody molecule, but there is much excellent characteristic compared with antibody, as molecular weight is little, can manufacture, not easy in inactivation, non-immunogenicity, easily synthesis and mark, between penetrate tissue, good dynamic metabolism, different batches, product can not there are differences and have fine chemical stability fast, has important application prospect in fields such as biological detection, medical diagnosis on disease treatments.

Summary of the invention

The object of this invention is to provide aptamer and the test kit thereof of a kind of specific combination Lp-PLA2.

Aptamer provided by the invention is the single stranded DNA shown in sequence 1-12 of sequence table.

Described aptamer and Lp-PLA2 albumen have good affinity.

Also described aptamer can be carried out modifying or transforming, obtain the derivative of described aptamer.

The derivative of described aptamer can be following any one:

A) by described aptamer deletion or the Nucleotide increasing partial complementarity, the derivative with described aptamer with the aptamer of identical function obtained;

B) described aptamer is carried out Nucleotide replacement or part modification, the derivative with described aptamer with the aptamer of identical function obtained;

C) skeleton of described aptamer is transform as phosphorothioate backbone, the derivative with described aptamer with the aptamer of identical function obtained;

D) aptamer is transform as peptide nucleic acid(PNA), the derivative with described aptamer with the aptamer of identical function obtained;

E) after described aptamer being connected upper fluorescence, radioactivity and therapeutic substance, the derivative with described aptamer with the aptamer of identical function obtained.

Described aptamer can be used for preparing the test kit detecting Lp-PLA2.

Utilize aptamer of the present invention, the Lp-PLA2 in blood can be caught, thus for cerebro-vascular diseases examination.Utilize aptamer of the present invention, part replaces monoclonal antibody to catch Lp-PLA2 and detect, have highly sensitive, cost is low, easy preparation, the advantage of easily preserving.The present invention has very high using value.

Embodiment

Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.

The screening of embodiment 1, aptamer and preparation

Design the random nucleic acid library that two ends comprise about 20 Nucleotide, centre comprises 40 Nucleotide as follows:

5 '-CTGACTAACCGGTAACCG (N40) AATTGCACGATCCAACGTT-3 '; N40 represents 40 random nucleotides.

By single-stranded DNA banks amplification for double-stranded DNA, product is through 2% agarose gel electrophoresis and cut glue and reclaim purifying; With the double-stranded DNA reclaimed for template, in-vitro transcription goes out single stranded RNA random library, and transcription product is through PAGE purifying.75 μ gRNA libraries are removed and membrane-bound RNA molecule through anti-sieve of nitrocellulose filter, and then with 2ugLp-PLA2 albumen (bought can be obtained by business), 37 ° of C hatch 30min, and reaction solution filters through nitrocellulose filter, washing filter membrane; Then filter membrane is shredded, be placed in elution buffer (6mol/L urea, 0.55mol/L ammonium acetate, l.5mmol/LEDTA, 0.15%SDS) and boil 5min, centrifugal, get supernatant, dehydrated alcohol precipitated rna, and be again dissolved in 20 μ 1DEPC water; Take RNA as template RT-PCR amplifying doulbe-chain DNA, in-vitro transcription goes out RNA library and screens for next round; Often take turns RT-PCR in screening process and obtain double-stranded DNA library, with this double-stranded DNA for template in-vitro transcription goes out RNA aptamer storehouse, screening is carried out 12 altogether and is taken turns.Obtain 12 aptamers, its sequence is respectively shown in SEQIDNO:1-12.Concrete sequence is as follows:

Lp-PLA2-1：

CTGACTAACCGGTAACCGATAATATGTTCCACACACGTCCACACTTTCCCTACAATTCAATTGCACGATCCAACGTT（SEQIDNO:1）

Lp-PLA2-2：

CTGACTAACCGGTAACCGACTTATCATCATATGTCCTCCACTTGAATCAACATTTCTTAATTGCACGATCCAACGTT（SEQIDNO:2）

Lp-PLA2-3：

CTGACTAACCGGTAACCGATCTACAGATTAATCTCATGATTTACAATACTCTCCATCCAATTGCACGATCCAACGTT（SEQIDNO:3）

Lp-PLA2-4：

CTGACTAACCGGTAACCGTCTTTATCTTCACCTAAGATATCCCAACCCATCACCATCCAATTGCACGATCCAACGTT（SEQIDNO:4）

Lp-PLA2-5：

CTGACTAACCGGTAACCGCATACGCTACGCTTATTTGCCTACACATCCCTCAACCACAAATTGCACGATCCAACGTT（SEQIDNO:5）

Lp-PLA2-6：

CTGACTAACCGGTAACCGATACATCTTAGTAGATCTATATTATACTACTACTACTTACAATTGCACGATCCAACGTT（SEQIDNO:6）

Lp-PLA2-7：

CTGACTAACCGGTAACCGCCCACTTATGAAGTTCCACTAAGCTCTCCAATACCATTTAAATTGCACGATCCAACGTT（SEQIDNO:7）

Lp-PLA2-8：

CTGACTAACCGGTAACCGCATTCTTAATCTCTATGACATACATACTGCTCTTATACCAAATTGCACGATCCAACGTT（SEQIDNO:8）

Lp-PLA2-9：

CTGACTAACCGGTAACCGCTACATTATATCTCCATCAGTCACCTCCACCCTACCCTTCAATTGCACGATCCAACGTT（SEQIDNO:9）

Lp-PLA2-10：

CTGACTAACCGGTAACCGAAACATCTACTTAACGCCACTTTCTATTTAGATACAACAAAATTGCACGATCCAACGTT（SEQIDNO:10）

Lp-PLA2-11：

CTGACTAACCGGTAACCGTTACCGTCCACCGACTACTACTTAATTTCACAACAAATCTAATTGCACGATCCAACGTT（SEQIDNO:11）

Lp-PLA2-12：

CTGACTAACCGGTAACCGACTATGTATCATGATTCACTTCTTCATTCATAATACCATCAATTGCACGATCCAACGTT（SEQIDNO:12）

The performance measurement of embodiment 2Lp-PLA2 protein binding aptamer

RNA aptamer is got respectively 1.5 μ g, digest lh with calf intestinal alkaline phosphatase (CIP) 37 ° of C, purifying reclaims dephosphorylized RNA; By T4 polynucleotide kinase mark [γ-32P] ATP in dephosphorylized RNA molecule end.The radiolabeled RNA aptamer of 10nmol hatches 30min with Lp-PLA237 ° of C of different concns (1-200nM) respectively, each group reaction liquid filters through nitrocellulose filter, washing filter membrane, dry filter membrane, liquid scintillation counter measures exit dose residual on filter membrane, and same sample is parallel does twice mensuration.Calculate the dissociation constant of each aptamer and Lp-PLA2.Result is as follows:

Title	Dissociation constant Kd (unit nM)
		Lp-PLA2-1	3.5
Lp-PLA2-2	4.2
		Lp-PLA2-3	4.5
Lp-PLA2-4	3.8
		Lp-PLA2-5	3.7
Lp-PLA2-6	4.6
		Lp-PLA2-7	5.4
Lp-PLA2-8	5.3
		Lp-PLA2-9	4.7
Lp-PLA2-10	4.9
		Lp-PLA2-11	3.6
Lp-PLA2-12	4.8
		PBS blank	Without binding ability

Aptamer specificity analyses and stability analysis described in embodiment 3

Adopt human serum albumin respectively, immune globulin, vibrio cholerae VgrG3C albumen, escherichia coli outer membrane protein A, specific detection is carried out with 12 aptamers, find through binding tests, these aptamers do not combine with these albumen, and only keep higher specificity with Lp-PLA2 protein binding.

By described aptamer, get 0.2ug, be placed in the serum of normal temperature, the aqueous solution respectively, place two weeks.Detected by RT-PCR, find its Stability Analysis of Structures of placement of two weeks, be not degraded.

The diagnosis of aptamer disease described in embodiment 4

By 12 aptamers respectively with the blood mixing 30min of 10 cerebrovascular stenosis Diseases and normal people, be separated by vitamin H, the content of quantitative analysis Lp-PLA2 albumen wherein, find by analyzing, in 10 cerebrovascular stenosis Diseases, the content of Lp-PLA2 albumen significantly increases relative to normal people.

These are only the preferred embodiments of the present invention; be not limited to the present invention; for a person skilled in the art, all any amendments done within the spirit and principles in the present invention, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.

Sequence table

< 110 > Li Meng

< 120 > mono-kind is for detecting the test kit of cerebrovascular disease

〈160〉12

〈210〉1

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-1

CTGACTAACCGGTAACCGATAATATGTTCCACACACGTCCACACTTTCCCTACAATTCAATTGCACGATCCAACGTT

〈210〉2

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-2

CTGACTAACCGGTAACCGACTTATCATCATATGTCCTCCACTTGAATCAACATTTCTTAATTGCACGATCCAACGTT

〈210〉3

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-3

CTGACTAACCGGTAACCGATCTACAGATTAATCTCATGATTTACAATACTCTCCATCCAATTGCACGATCCAACGTT

〈210〉4

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-4

CTGACTAACCGGTAACCGTCTTTATCTTCACCTAAGATATCCCAACCCATCACCATCCAATTGCACGATCCAACGTT

〈210〉5

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-5：

CTGACTAACCGGTAACCGCATACGCTACGCTTATTTGCCTACACATCCCTCAACCACAAATTGCACGATCCAACGTT

〈210〉6

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-6

CTGACTAACCGGTAACCGATACATCTTAGTAGATCTATATTATACTACTACTACTTACAATTGCACGATCCAACGTT

〈210〉7

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-7

CTGACTAACCGGTAACCGCCCACTTATGAAGTTCCACTAAGCTCTCCAATACCATTTAAATTGCACGATCCAACGTT

〈210〉8

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-8

CTGACTAACCGGTAACCGCATTCTTAATCTCTATGACATACATACTGCTCTTATACCAAATTGCACGATCCAACGTT

〈210〉9

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-9

CTGACTAACCGGTAACCGCTACATTATATCTCCATCAGTCACCTCCACCCTACCCTTCAATTGCACGATCCAACGTT

〈210〉10

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-10

CTGACTAACCGGTAACCGAAACATCTACTTAACGCCACTTTCTATTTAGATACAACAAAATTGCACGATCCAACGTT

〈210〉11

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-11

CTGACTAACCGGTAACCGTTACCGTCCACCGACTACTACTTAATTTCACAACAAATCTAATTGCACGATCCAACGTT

〈210〉12

〈211〉77

〈212〉DNA

< 213 > artificial sequence

〈400〉Lp-PLA2-12

CTGACTAACCGGTAACCGACTATGTATCATGATTCACTTCTTCATTCATAATACCATCAATTGCACGATCCAACGTT

Claims (4)

1. aptamer, is characterized in that: can combine by Lp-PLA2 protein-specific.

2. aptamer as claimed in claim 1, shown in the sequence 1-12 that its sequence is sequence table is arbitrary.

3., for detecting a test kit for cerebrovascular disease, it contains aptamer described in any one of claim 1-2.

4. the application of aptamer described in any one of claim 1-2 in the test kit of preparation cerebrovascular disease detection.