CN105177012A - Drug for treating heart diseases and kit of drug - Google Patents

Abstract

The invention discloses a drug for treating heart diseases and a kit of the drug. An aptamer provided by the invention has better affinity with a TWF-1 protein. By using the aptamer, TWF-1 in the blood can be captured and is prepared into a corresponding drug so as to be beneficial to the treatment of heart diseases.

Description

One is used for the treatment of cardiopathic medicine and test kit thereof

Technical field

The present invention relates to one and be used for the treatment of cardiopathic medicine and test kit thereof.

Background technology

Heart trouble is the general name of heart disease, comprises the various heart troubles such as rheumatic heart disease, congenital heart disease, hypertensive heart disease, coronary heart disease, cardiomyopathy.Heart trouble is one of principal disease of current harm humans health.

Heart is being subject to various physiological stimulation, can produce hypertrophica growth to maintain cardiac blood work output when tissue injury or endocrine disturbance.Myocardial hypertrophy is functionally an initial adaptation reaction, but the myocardial hypertrophy continued can cause heart failure and sudden death.Myocardial hypertrophy is a complicated pathologic process, along with myocardial cell's protein content increase, fetus period gene again express, myocardial cell's cytoskeleton rearrangement.Fibril framework has played important function in myocardiac pathogenic process, not only participates in maintaining cellular form integrity and mechanical resistance, and take part in extracellular signal to the conduction in born of the same parents to regulate expression and the function of expression of cardiac gene.

There are some researches show, suppress TWF-1, effectively can treat heart trouble, particularly myocardial hypertrophy or heart failure.Therefore, develop a kind of TWF-1 inhibitor, for treatment heart trouble, there is fabulous application prospect.

Aptamer (Aptamer, also known as aptamers, aptamer) be can high-affinity, high specific in conjunction with the few nucleic acid molecule (ssDNA or ssRNA) of certain biological leather El target strand.Aptamer be by index concentration Fas lignand system evolution technology (Systemat1cEvolut1onofL1gandsbyExponent1alenr1chment, SELEX) screen from the DNA/RNA library of synthetic obtain can high degree of specificity in conjunction with the single stranded DNA/RNA of target molecules.Report that the target of aptamer comprises metal ion, organic molecule, polypeptide, protein, cell are even organized.The molecular recognition function of aptamer and antibody class are seemingly, there is the target recognition capability quite even stronger with antibody molecule, but there is much excellent characteristic compared with antibody, as molecular weight is little, can manufacture, not easy in inactivation, non-immunogenicity, easily synthesis and mark, between penetrate tissue, good dynamic metabolism, different batches, product can not there are differences and have fine chemical stability fast.

Summary of the invention

The object of this invention is to provide aptamer and the pharmaceutical composition thereof of a kind of specific combination TWF-1.

Aptamer provided by the invention is the single stranded DNA shown in sequence 1-13 of sequence table.

Described aptamer and TWF-1 albumen have good affinity, and inhibit the avtive spot of TWF-1 albumen, thus suppress its functionally active.

Also described aptamer can be carried out modifying or transforming, obtain the derivative of described aptamer.

The derivative of described aptamer can be following any one:

A) by described aptamer deletion or the Nucleotide increasing partial complementarity, the derivative with described aptamer with the aptamer of identical function obtained;

B) described aptamer is carried out Nucleotide replacement or part modification, the derivative with described aptamer with the aptamer of identical function obtained;

C) skeleton of described aptamer is transform as phosphorothioate backbone, the derivative with described aptamer with the aptamer of identical function obtained;

D) aptamer is transform as peptide nucleic acid(PNA), the derivative with described aptamer with the aptamer of identical function obtained;

E) after described aptamer being connected upper fluorescence, radioactivity and therapeutic substance, the derivative with described aptamer with the aptamer of identical function obtained.

Described aptamer can be used for the medicine preparing TWF-1 inhibitor.

Utilize aptamer of the present invention, can specific binding TWF-1 albumen, thus for cardiopathic treatment.Utilize aptamer of the present invention, have highly sensitive, cost is low, easy preparation, the advantage of easily preserving.The present invention has very high using value.

Embodiment

Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.

The screening of embodiment 1, aptamer and preparation

Design the random nucleic acid library that two ends comprise about 20 Nucleotide, centre comprises 39 Nucleotide as follows:

5 '-AACCTTGACTGCAACGTCA (N39) GGCACGTGACAGACGTCA-3 '; N39 represents 39 random nucleotides.

By single-stranded DNA banks amplification for double-stranded DNA, product is through 2% agarose gel electrophoresis and cut glue and reclaim purifying; With the double-stranded DNA reclaimed for template, in-vitro transcription goes out single stranded RNA random library, and transcription product is through PAGE purifying.75 μ gRNA libraries are removed and membrane-bound RNA molecule through anti-sieve of nitrocellulose filter, and then with 2ugTWF-1 albumen (being obtained by the eukaryotic expression of routine), 37 ° of C hatch 30min, and reaction solution filters through nitrocellulose filter, washing filter membrane; Then filter membrane is shredded, be placed in elution buffer (6mol/L urea, 0.55mol/L ammonium acetate, l.5mmol/LEDTA, 0.15%SDS) and boil 5min, centrifugal, get supernatant, dehydrated alcohol precipitated rna, and be again dissolved in 20 μ 1DEPC water; Take RNA as template RT-PCR amplifying doulbe-chain DNA, primer is: AACCTTGACTGCAACGTCA and TGACGTCTGTCACGTGCC, and in-vitro transcription goes out RNA library and screens for next round; Often take turns RT-PCR in screening process and obtain double-stranded DNA library, with this double-stranded DNA for template in-vitro transcription goes out RNA aptamer storehouse, screening is carried out 11 altogether and is taken turns.Obtain 13 aptamers, its sequence is respectively shown in SEQIDNO:1-13.Concrete sequence is as follows:

TWF-1-1：

AACCTTGACTGCAACGTCATTATCAATCGCCATACCCATCCAGTAACCTCTCATACCTGGCACGTGACAGACGTCA（SEQIDNO:1）

TWF-1-2：

AACCTTGACTGCAACGTCAACAACAATCTGTACTCCACAATTCGAATCACTACATCATGGCACGTGACAGACGTCA（SEQIDNO:2）

TWF-1-3：

AACCTTGACTGCAACGTCAATATTAACCGCCACTAATCTCCTCATCGCTACTATAACC

GGCACGTGACAGACGTCA（SEQIDNO:3）

TWF-1-4：

AACCTTGACTGCAACGTCATTCGCCTTATCCCTACAATCCATAAATCACGCAACACAAGGCACGTGACAGACGTCA（SEQIDNO:4）

TWF-1-5：

AACCTTGACTGCAACGTCAATACAACTACAACGCTCTATACATCTTGTATCAACACTAGGCACGTGACAGACGTCA（SEQIDNO:5）

TWF-1-6：

AACCTTGACTGCAACGTCAACCCAATCACGACAACTTCAATCCACCACATAAGAATCTGGCACGTGACAGACGTCA（SEQIDNO:6）

TWF-1-7：

AACCTTGACTGCAACGTCAACGCATACACCACCTTTACCTAATCCACGTTATATAACT

GGCACGTGACAGACGTCA（SEQIDNO:7）

TWF-1-8：

AACCTTGACTGCAACGTCATATCGCCCATCATCATTATCATCAAACGTTTACATACCA

GGCACGTGACAGACGTCA（SEQIDNO:8）

TWF-1-9：

AACCTTGACTGCAACGTCAATATATATTCTACCCCGTCTAAAACCAAAGACTCTTCAA

GGCACGTGACAGACGTCA（SEQIDNO:9）

TWF-1-10：

AACCTTGACTGCAACGTCATTATAACATTCAGAACTTTACTATTAATGCATCTCCATCGGCACGTGACAGACGTCA（SEQIDNO:10）

TWF-1-11：

AACCTTGACTGCAACGTCATATCACACACCTACACCTCCTTATTCGCCAACTATTTATGGCACGTGACAGACGTCA（SEQIDNO:11）

TWF-1-12：

AACCTTGACTGCAACGTCAATCGCCCTATCATCTCACTCGCCCTATCCACAATATTTAGGCACGTGACAGACGTCA（SEQIDNO:12）

TWF-1-13：

AACCTTGACTGCAACGTCAATCGATCAACCTAATTATTTATCAACACAGTCACACCATGGCACGTGACAGACGTCA（SEQIDNO:13）

The performance measurement of embodiment 2TWF-1 protein binding aptamer

RNA aptamer is got respectively 1.5 μ g, digest lh with calf intestinal alkaline phosphatase (CIP) 37 ° of C, purifying reclaims dephosphorylized RNA; By T4 polynucleotide kinase mark [γ-32P] ATP in dephosphorylized RNA molecule end.The radiolabeled RNA aptamer of 10nmol hatches 30min with TWF-137 ° of C of different concns (1-200nM) respectively, each group reaction liquid filters through nitrocellulose filter, washing filter membrane, dry filter membrane, liquid scintillation counter measures exit dose residual on filter membrane, and same sample is parallel does twice mensuration.Calculate the dissociation constant of each aptamer and Lp-PLA2.Result is as shown in the table:

Title	Dissociation constant Kd (unit nM)
		TWF-1-1	5.6
TWF-1-2	5.8
		TWF-1-3	6.2
TWF-1-4	6.3
		TWF-1-5	6.7
TWF-1-6	6.0
		TWF-1-7	5.8
TWF-1-8	5.9
		TWF-1-9	6.3
TWF-1-10	6.7
		TWF-1-11	6.8
TWF-1-12	6.9
		TWF-1-13	6.4
PBS blank	Without binding ability

Aptamer specificity analyses and stability analysis described in embodiment 3

Adopt human serum albumin respectively, immune globulin, IgG albumen, escherichia coli outer membrane protein A, carries out specific detection with 13 aptamers, finds through binding tests, these aptamers do not combine with these albumen, and only keep higher specificity with TWF-1 protein binding.

By described aptamer, get 0.3ug, be placed in the serum of normal temperature, the aqueous solution respectively, place two weeks.Detected by RT-PCR, find its Stability Analysis of Structures of placement of two weeks, be not degraded.

Aptamer described in embodiment 4 is used for cardiopathic treatment

First by PE process neonatal cardiac myocytes, inducing cardiomyocytes is plump, then by above-mentioned 13 aptamers conventionally this cell of transfection, with transfection AACCTTGACTGCAACGTCA negative control myocardial cell in contrast.Found that, compared with control group, in the cell of 13 aptamer transfections, the expression of TWF-1 significantly declines, and myocardial cell reduces more than 50%.

These are only the preferred embodiments of the present invention; be not limited to the present invention; for a person skilled in the art, all any amendments done within the spirit and principles in the present invention, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.

Sequence table

< 110 > Du protects chivalrous

< 120 > mono-kind is used for the treatment of cardiopathic medicine and test kit thereof

〈160〉13

〈210〉1

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-1

AACCTTGACTGCAACGTCATTATCAATCGCCATACCCATCCAGTAACCTCTCATACCTGGCACGTGACAGACGTCA

〈210〉2

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-2

AACCTTGACTGCAACGTCAACAACAATCTGTACTCCACAATTCGAATCACTACATCATGGCACGTGACAGACGTCA

〈210〉3

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-3

AACCTTGACTGCAACGTCAATATTAACCGCCACTAATCTCCTCATCGCTACTATAACC

GGCACGTGACAGACGTCA

〈210〉4

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-4

AACCTTGACTGCAACGTCATTCGCCTTATCCCTACAATCCATAAATCACGCAACACAAGGCACGTGACAGACGTCA

〈210〉5

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-5

AACCTTGACTGCAACGTCAATACAACTACAACGCTCTATACATCTTGTATCAACACTAGGCACGTGACAGACGTCA

〈210〉6

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-6

AACCTTGACTGCAACGTCAACCCAATCACGACAACTTCAATCCACCACATAAGAATCTGGCACGTGACAGACGTCA

〈210〉7

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-7

AACCTTGACTGCAACGTCAACGCATACACCACCTTTACCTAATCCACGTTATATAACT

GGCACGTGACAGACGTCA

〈210〉8

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-8

AACCTTGACTGCAACGTCATATCGCCCATCATCATTATCATCAAACGTTTACATACCA

GGCACGTGACAGACGTCA

〈210〉9

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-9

AACCTTGACTGCAACGTCAATATATATTCTACCCCGTCTAAAACCAAAGACTCTTCAA

GGCACGTGACAGACGTCA

〈210〉10

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-10

AACCTTGACTGCAACGTCATTATAACATTCAGAACTTTACTATTAATGCATCTCCATCGGCACGTGACAGACGTCA

〈210〉11

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-11

AACCTTGACTGCAACGTCATATCACACACCTACACCTCCTTATTCGCCAACTATTTATGGCACGTGACAGACGTCA

〈210〉12

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-12

AACCTTGACTGCAACGTCAATCGCCCTATCATCTCACTCGCCCTATCCACAATATTTAGGCACGTGACAGACGTCA

〈210〉13

〈211〉76

〈212〉DNA

< 213 > artificial sequence

〈400〉TWF-1-13

AACCTTGACTGCAACGTCAATCGATCAACCTAATTATTTATCAACACAGTCACACCATGGCACGTGACAGACGTCA

Claims (5)

1. aptamer, is characterized in that: can be combined with TWF-1 protein-specific.

2. aptamer as claimed in claim 1, shown in arbitrary in the sequence 1-13 that its sequence is sequence table.

3., for a medicine for disease treatment, it contains aptamer described in any one of claim 1-2 and pharmaceutically acceptable carrier.

4. the application of aptamer described in any one of claim 1-2 in the cardiopathic medicine of preparation treatment.

5. treat a cardiopathic test kit, it comprises the aptamer described in any one of claim 1-2.