CN106191318A - A kind of primer identifying chicken parvovirus to and application - Google Patents
A kind of primer identifying chicken parvovirus to and application Download PDFInfo
- Publication number
- CN106191318A CN106191318A CN201610601889.8A CN201610601889A CN106191318A CN 106191318 A CN106191318 A CN 106191318A CN 201610601889 A CN201610601889 A CN 201610601889A CN 106191318 A CN106191318 A CN 106191318A
- Authority
- CN
- China
- Prior art keywords
- chicken parvovirus
- primer
- virus
- sample
- measured
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer identifying chicken parvovirus to and application.The primer of the present invention forms by primer ChPV F and ChPV R, respectively as shown in sequence table 1,2.The present invention also protects described primer to identifying whether virus to be measured is the application in chicken parvovirus, identifies whether sample to be tested contains the application in chicken parvovirus.Two temperature formulas PCR that the present invention sets up can be used for quickly detecting chicken parvovirus, is suitable to mass detection, the most cost-saved and time-consuming, can reduce again pollution, have the highest practical value.
Description
Technical field
The present invention relates to a kind of primer identifying chicken parvovirus to and application.
Background technology
Chicken parvovirus (Chincken parvovirus, ChPV) is to cause one of important pathogen of chicken intestinal disease,
Can cause with diarrhoea, spirit depressing, thermoregulatory dysfunctions, growth retardation, increase food consumption etc. be characterized acute or slow
Property intestinal disease, short and small syndrome, malnutrition syndrome.Chicken parvovirus generally exists in chicken group, mainly encroaches on young bird
Chicken, but, laying hen higher with commercial meat bird infection rate or kind chicken take second place.Since 2010, North America, Poland, Hungary, ground, Crow
The countries such as Asia, Brazil, Korea S have broken out this disease in succession, cause bigger economic loss to poultry husbandry.Therefore, the fast of ChPV is set up
Speed detection method, is the technical guarantee of effective Fang Zhi China ChPV.
At present, the method for identifying virus relies primarily on traditional virus purification, agar gel diffusion test and ELISA etc., but
These methods are generally of time and effort consuming and the most high drawback of sensitivity.
Summary of the invention
It is an object of the invention to provide a kind of primer identifying chicken parvovirus to and application.
The invention provides a kind of primer pair, be made up of primer ChPV-F and primer ChPV-R；
Described primer ChPV-F is following (a1) or (a2)；
(a1) single strand dna shown in sequence 1 of sequence table；
(a2) sequence 1 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 1
The DNA molecular of identical function；
Described primer ChPV-R is following (a3) or (a4)；
(a3) single strand dna shown in sequence 2 of sequence table；
(a4) sequence 2 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had with sequence 2
The DNA molecular of identical function.
The purposes of described primer pair is any one in following (b1) to (b4):
(b1) identify whether virus to be measured is chicken parvovirus；
(b2) preparation is for identifying that whether virus to be measured be the test kit of chicken parvovirus；
(b3) identify whether sample to be tested contains chicken parvovirus；
(b4) preparation is for identifying whether sample to be tested contains the test kit of chicken parvovirus.
The present invention also protects the application of described primer pair, for any one in following (b1) to (b4):
(b1) identify whether virus to be measured is chicken parvovirus；
(b2) preparation is for identifying that whether virus to be measured be the test kit of chicken parvovirus；
(b3) identify whether sample to be tested contains chicken parvovirus；
(b4) preparation is for identifying whether sample to be tested contains the test kit of chicken parvovirus.
The present invention also protects the test kit combined containing described primer；The purposes of described test kit be following (c1) or
(c2):
(c1) identify whether virus to be measured is chicken parvovirus；
(c2) identify whether sample to be tested contains chicken parvovirus.
The present invention also protects the preparation method of described test kit, including the step individually packed by each bar primer.
The present invention also protects and a kind of identifies that whether virus to be measured be the method for chicken parvovirus, comprises the steps:
(1) genomic DNA of virus to be measured is extracted；
(2) genomic DNA extracted with step (1) is as template, and the primer described in employing is to carrying out PCR amplification, if PCR
Amplified production containing the DNA fragmentation of 297bp-307bp, virus to be measured be or candidate be chicken parvovirus, if PCR expands product
Thing does not contains the DNA fragmentation of 297bp-307bp, virus to be measured for or candidate for non-chicken parvovirus.
The present invention also protects and a kind of identifies that whether virus to be measured be the method for chicken parvovirus, comprises the steps: detection
Whether the genomic DNA of virus to be measured contains the target sequence of described primer pair, if drawn described in described genomic DNA contains
The target sequence of thing pair, virus to be measured are or candidate is chicken parvovirus, if not containing described primer pair in described genomic DNA
Target sequence, virus to be measured be or candidate is non-chicken parvovirus.
The present invention also protects a kind of method identifying whether sample to be tested contains chicken parvovirus, comprises the steps:
(1) STb gene of sample to be tested is extracted；
(2) STb gene extracted with step (1) is as template, and the primer described in employing is to carrying out PCR amplification, if PCR amplification
Product contains or doubtful containing chicken parvovirus containing the DNA fragmentation of 297bp-307bp, sample to be tested, if PCR amplification is produced
Do not contain the DNA fragmentation of 297bp-307bp in thing, sample to be tested does not contains or doubtful does not contains chicken parvovirus.
The present invention also protects a kind of method identifying whether sample to be tested contains chicken parvovirus, comprises the steps: inspection
Survey the target sequence whether containing described primer pair in the STb gene of sample to be tested, if containing described primer pair in described STb gene
Target sequence, sample to be tested contain or doubtful containing chicken parvovirus, if not containing the target sequence of described primer pair in described STb gene
Row, sample to be tested do not contain or doubtful do not contain chicken parvovirus.
The concretely chicken parvovirus of virus to be measured described in any of the above, newcastle disease virus, Marek’s disease poison, H9 hypotype
Bird flu virus, infectious bronchitis virus or infectious laryngotracheitis virus.
The concretely fowl disease material of sample to be tested described in any of the above, such as chicken larynx swab, chicken cloacal swab, fresh chicken
Meat, fresh chicken organ, Carnis Gallus domesticus processed goods, chicken organ processed goods etc..
Described in any of the above, " target sequence of primer pair " concretely size is the DNA fragmentation of 297bp-307bp.Described
DNA fragmentation can be for following (d1) or (d2): the DNA molecular shown in the sequence 3 of (d1) sequence table；(d2) with the sequence 3 of sequence table
There is the DNA molecular of more than 99% homology.
The concretely two temperature formula PCR amplification of PCR amplification described in any of the above.
Described in any of the above, the annealing temperature of PCR amplification is specially 61.4 DEG C.
In the reaction system of PCR amplification described in any of the above, the concentration of ChPV-F and ChPV-R is 10pmol/ μ L.
Described in any of the above PCR amplification reaction system (25 μ L) concretely: 2 × PCR Mix 12.5 μ L, template 1 μ
The each 1 μ L of L, ChPV-F and ChPV-R, finally uses ddH2O complements to 25.0 μ L.
Described in any of the above PCR amplification response procedures concretely: 95 DEG C of denaturations 3min；94 DEG C of degeneration 15s, 61.4
DEG C annealing 30s, carries out 30 circulations, 72 DEG C of extension 10min altogether.
PCR method then have simple to operate quickly, the feature such as high specificity, sensitivity is high, reproducible.Two temperature formulas PCR
It it is the easier detection technique of development on the basis of conventional three temperature formulas PCR.In two temperature formulas PCR, anneal and extend in
Carry out under same temperature, higher than the annealing temperature of Standard PCR, therefore not only increase the specificity of this two temperature formula PCR, and two
Temperature formula PCR saves the time-consuming of cooling that repeatedly heat up, and improves diagnosis efficiency.
Two temperature formulas PCR that the present invention sets up can be used for quickly detecting the infection of ChPV, is suitable to mass detection, both can save
Cost and time-consuming, can reduce again pollution, have the highest practical value.
Accompanying drawing explanation
Fig. 1 is that in embodiment 2, two temperature formula PCR reactions optimize corresponding electrophoretogram.
Fig. 2 is the electrophoretogram that in embodiment 3, specific detection is corresponding.
Fig. 3 is the electrophoretogram that in embodiment 4, sensitivity Detection is corresponding.
Fig. 4 is the electrophoretogram that in embodiment 5, clinical sample detection is corresponding.
Detailed description of the invention
Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiment
Method, if no special instructions, is conventional method.Test material used in following embodiment, if no special instructions, is certainly
Routine biochemistry reagent shop is commercially available.Quantitative test in following example, is respectively provided with three times and repeats experiment, and result is made even
Average.
Chicken parvovirus (chicken parvovirus, be abbreviated as ChPV): list of references: Day J M, Zsak L.
Determination and analysis of the full-length chicken parvovirus genome.[J]
.Virology, 2010,399 (1): 59-64.；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Newcastle disease virus (NDV): list of references: Xie Zhixun, Xie Liji, Liu Jiabo, etc. bird flu and Avian pneumo-encephalitis virus
The foundation [J] of two temperature formula fluorescence quantitative RT-PCR detecting methods. biotechnology communication, 2008,19 (3): 410-413.；The public can
To obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Marek’s disease poison (MDV): list of references: Deng Xianwen, Xie Zhixun, Xie Zhiqin, etc. Chicken Anemia Virus (CAV) is sick
The foundation [J] of LAMP quick visualization detection method. ecology of domestic animals report, 2011,32 (6): 57-60.；The public can be from Guangxi
Zhuang autonomous region veterinary institute obtains.
H9 subtype avian influenza virus (AIV H9): list of references: Xie Zhixun, Xie Liji, Liu Jiabo, etc. bird flu is with new
The foundation [J] of city epidemic disease poison two temperature formula fluorescence quantitative RT-PCR detecting method. biotechnology communication, 2008,19 (3): 410-
413.；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Infectious bronchitis virus (IBV): list of references: Xie Zhixun, Xie Liji, Liu Jiabo, etc. bird flu and new city
The foundation [J] of epidemic disease poison two temperature formula fluorescence quantitative RT-PCR detecting method. biotechnology communication, 2008,19 (3): 410-413.；
The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Infectious laryngotracheitis virus (ILTV): list of references: Xie Zhixun, Xie Liji, Liu Jiabo, etc. bird flu is with new
The foundation [J] of city epidemic disease poison two temperature formula fluorescence quantitative RT-PCR detecting method. biotechnology communication, 2008,19 (3): 410-
413.；The public can obtain from Veterinary Institute of Guangxi Zhuang Autonomous Region.
Embodiment 1, design of primers
Carry out a large amount of sequence analysis, comparison obtains the some primers for identifying chicken parvovirus.Each primer is entered
Row preliminary experiment, compares the performance such as sensitivity, specificity, finally gives the pair of primers for identifying chicken parvovirus.
For identifying that the specific primer of chicken parvovirus forms (5 ' → 3 ') by following two primers:
ChPV-F (sequence 1 of sequence table): GTAAATTCTGTGCCGATTGTG；
ChPV-R (sequence 2 of sequence table): GAAGTCTGGCTCGTCTGGTAA.
Embodiment 2, two temperature formula PCR reaction condition optimization
1, the genomic DNA of chicken parvovirus is extracted.
2, take genomic DNA that step 1 obtains as template, use the primer of embodiment 1 preparation to carrying out two temperature formulas
PCR。
The reaction system (25.0 μ L) of two temperature formulas PCR: 2 × PCR Mix 12.5 μ L, template 1 μ L (3.86ng), ChPV-F
1 μ L each with ChPV-R, finally uses ddH2O complements to 25.0 μ L.In two temperature formula PCR reaction systems, ChPV-F's and ChPV-R is dense
Degree is 10pmol/ μ L.
The response procedures of two temperature formulas PCR: 95 DEG C of denaturations 3min；94 DEG C of degeneration 15s, anneal 30s, carries out 30 altogether and follows
Ring, 72 DEG C extend 10min.
It is respectively provided with following annealing temperature:
Annealing temperature I:51.0 DEG C；
Annealing temperature II:51.9 DEG C；
Annealing temperature III:53.5 DEG C；
Annealing temperature IV:56.0 DEG C；
Annealing temperature V:58.9 DEG C；
Annealing temperature VI:61.4 DEG C；
Annealing temperature VII:63.0 DEG C；
Annealing temperature VIII:64.0 DEG C.
The amplified production of two temperature formulas PCR is carried out 1.2% agarose gel electrophoresis and takes pictures.
Arranging the negative control replacing chicken parvovirus genomic DNA with equal-volume water, its corresponding annealing temperature is
61.4℃。
Result is shown in Fig. 1.In Fig. 1, swimming lane 1-8 is corresponding in turn to the amplification of two temperature formulas PCR obtained during annealing temperature I-VIII
Product, M correspondence 100bp DNA Marker, the amplified production of two temperature formulas PCR of N correspondence negative control.According to experimental result, really
Determining optimum annealing temperature is 61.4 DEG C.
According to result above, determine that the optimum response program of two temperature formulas PCR is 95 DEG C of denaturations 3min；94 DEG C of degeneration 15s,
61.4 DEG C of annealing 30s, carry out 30 circulations altogether, and 72 DEG C extend 10min.
Embodiment 3, specificity
1, the genomic DNA of sample to be tested is extracted.Sample to be tested is respectively as follows: chicken parvovirus (ChPV), Marek’s disease poison
(MDV), infectious laryngotracheitis virus (ILTV).
2, extract the total serum IgE of sample to be tested, and reverse transcription becomes cDNA.Sample to be tested is respectively as follows: newcastle disease virus
(NDV), H9 subtype avian influenza virus (AIV H9), infectious bronchitis virus (IBV).
3, each cDNA sample that each genomic DNA sample of step 1 being obtained respectively, step 2 obtain as template,
The primer combination using embodiment 1 preparation carries out two temperature formulas PCR.
Two temperature formulas PCR reaction system (25.0 μ L): 2 × PCRMix 12.5 μ L, template 1 μ L (3.86ng), ChPV-F and
The each 1 μ L of ChPV-R, finally uses ddH2O complements to 25.0 μ L.In two temperature formula PCR reaction systems, the concentration of ChPV-F and ChPV-R
It is 10pmol/ μ L.The negative control using equal-volume water as template is set.
The response procedures of two temperature formulas PCR: 95 DEG C of denaturations 3min；94 DEG C of degeneration 15s, 61.4 DEG C of annealing 30s, carry out 30 altogether
Individual circulation, 72 DEG C extend 10min.
The amplified production of two temperature formulas PCR is carried out 1.2% agarose gel electrophoresis and takes pictures.
Result is shown in Fig. 2.In Fig. 2,1 is two temperature formula pcr amplification products of ChPV genomic DNA, and 2 is two temperature of NDV cDNA
Formula pcr amplification product, 3 is two temperature formula pcr amplification products of MDV genomic DNA, and 4 is the two temperature formulas PCR expansions of AIV H9 cDNA
Volume increase thing, 5 is the two temperature formula pcr amplification products of IBV cDNA, and 6 is two temperature formula pcr amplification products of ILTV genomic DNA, M pair
Answer two temperature formula pcr amplification products of 100bp DNA Marker, N correspondence negative control.Result shows, ChPV amplifies 302bp
Specific band (through order-checking, as shown in the sequence 3 of sequence table), and NDV, MDV, AIV H9, IBV, ILTV are all without specificity
Band occurs.
Embodiment 4, sensitivity
1, the genomic DNA of chicken parvovirus is extracted.
2, ddH is used2The Genomic DNA solution that O10 times of gradient dilution step 1 obtains, obtains each diluent.
3, take each diluent that step 2 obtains as template, use the primer of embodiment 1 preparation to carrying out two temperature formulas
PCR。
The reaction system (25.0 μ L) of two temperature formulas PCR: 2 × PCR Mix 12.5 μ L, template 1 μ L, ChPV-F and ChPV-R
Each 1 μ L, finally uses ddH2O complements to 25.0 μ L.In two temperature formula PCR reaction systems, the concentration of ChPV-F and ChPV-R is
10pmol/μL.The negative control using equal-volume water as template is set.
The dilution factor of the diluent owing to using is different, forms the most different reaction systems:
In reaction system 1, the initial content of chicken parvovirus DNA is 3.86ng；
In reaction system 2, the initial content of chicken parvovirus DNA is 386pg；
In reaction system 3, the initial content of chicken parvovirus DNA is 38.6pg；
In reaction system 4, the initial content of chicken parvovirus DNA is 3.86pg；
In reaction system 5, the initial content of chicken parvovirus DNA is 386fg；
In reaction system 6, the initial content of chicken parvovirus DNA is 38.6fg；
In reaction system 7, the initial content of chicken parvovirus DNA is 3.86fg；
In reaction system 8, the initial content of chicken parvovirus DNA is 0.37fg.
The response procedures of two temperature formulas PCR: 95 DEG C of denaturations 3min；94 DEG C of degeneration 15s, 61.4 DEG C of annealing 30s, carry out 30 altogether
Individual circulation, 72 DEG C extend 10min.
The amplified production of two temperature formulas PCR is carried out 1.2% agarose gel electrophoresis and takes pictures.
Result is shown in Fig. 3.In Fig. 3, the amplified production of two temperature formulas PCR, M when swimming lane 1-8 is corresponding in turn to use reaction system 1-8
Corresponding 100bp DNA Marker, the amplified production of two temperature formulas PCR of N correspondence negative control.Result shows, mental retardation detects
38.6fg ChPV.
Embodiment 5, clinical sample detect
Sample to be tested is: 60 parts of fowl disease material (double cotton swab of chicken larynx, cloaca that in October, 2014, in December ,-2015 gathered
Son).
1, the STb gene of sample to be tested is extracted.
2, STb gene step 1 obtained is as template, uses the primer combination of embodiment 1 preparation to carry out two temperature formulas PCR.
The reaction system (25.0 μ L) of two temperature formulas PCR: 2 × PCR Mix 12.5 μ L, template 1 μ L (3.86ng), ChPV-F
1 μ L each with ChPV-R, finally uses ddH2O complements to 25.0 μ L.In two temperature formula PCR reaction systems, ChPV-F's and ChPV-R is dense
Degree is 10pmol/ μ L.The negative control using equal-volume water as template is set.
The response procedures of two temperature formulas PCR: 95 DEG C of denaturations 3min；94 DEG C of degeneration 15s, 61.4 DEG C of annealing 30s, carry out 30 altogether
Individual circulation, 72 DEG C extend 10min.
The amplified production of two temperature formulas PCR is carried out 1.2% agarose gel electrophoresis and takes pictures.
Partial detection is shown in Fig. 4.In Fig. 4, M correspondence 100bp DNA Marker, two temperature formulas of N correspondence negative control
The amplified production of PCR, swimming lane 1-16 is corresponding in turn to testing result (swimming lane 3,4,5,6,7 and 9 display of in 60 parts of fowl disease material 16 parts
ChPV positive findings).Statistical result, detects 12 parts of ChPV positive pathological material of diseases altogether in 60 parts of fowl disease material.Five duplicate detection, as a result one
Cause.Specific band in the swimming lane of display ChPV positive findings is reclaimed and checked order, and its sequencing result is high with the homology of sequence 3
Reach 99%.
Claims (8)
1. primer pair, is made up of primer ChPV-F and primer ChPV-R；
Described primer ChPV-F is following (a1) or (a2)；
(a1) single strand dna shown in sequence 1 of sequence table；
(a2) sequence 1 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had identical with sequence 1
The DNA molecular of function；
Described primer ChPV-R is following (a3) or (a4)；
(a3) single strand dna shown in sequence 2 of sequence table；
(a4) sequence 2 through the replacement of one or several nucleotide and/or disappearance and/or interpolation and is had identical with sequence 2
The DNA molecular of function.
2. the application of the primer pair described in claim 1, for any one in following (b1) to (b4):
(b1) identify whether virus to be measured is chicken parvovirus；
(b2) preparation is for identifying that whether virus to be measured be the test kit of chicken parvovirus；
(b3) identify whether sample to be tested contains chicken parvovirus；
(b4) preparation is for identifying whether sample to be tested contains the test kit of chicken parvovirus.
3. contain the test kit of primer combination described in claim 1；The purposes of described test kit is following (c1) or (c2):
(c1) identify whether virus to be measured is chicken parvovirus；
(c2) identify whether sample to be tested contains chicken parvovirus.
4. the preparation method of test kit described in claim 3, including the step individually packed by each bar primer.
5. identify that whether virus to be measured be a method for chicken parvovirus, comprise the steps:
(1) genomic DNA of virus to be measured is extracted；
(2) genomic DNA extracted with step (1) is as template, use the primer described in claim 1 to carrying out PCR amplification, as
Really pcr amplification product containing the DNA fragmentation of 297bp-307bp, virus to be measured is or candidate is chicken parvovirus, if PCR
Amplified production does not contains the DNA fragmentation of 297bp-307bp, virus to be measured for or candidate for non-chicken parvovirus.
6. identify that whether virus to be measured be a method for chicken parvovirus, comprise the steps: to detect the gene of virus to be measured
Whether group DNA contains the target sequence of primer pair described in claim 1, if containing claim 1 institute in described genomic DNA
State the target sequence of primer pair, virus to be measured for or candidate for chicken parvovirus, want if described genomic DNA does not contains right
Ask the target sequence of primer pair described in 1, virus to be measured for or candidate for non-chicken parvovirus.
7. identify the method whether sample to be tested contains chicken parvovirus, comprise the steps:
(1) STb gene of sample to be tested is extracted；
(2) STb gene extracted with step (1) is as template, use the primer described in claim 1 to carrying out PCR amplification, if
Pcr amplification product contains or doubtful containing chicken parvovirus containing the DNA fragmentation of 297bp-307bp, sample to be tested, if
Do not contain the DNA fragmentation of 297bp-307bp in pcr amplification product, sample to be tested does not contains or doubtful does not contains chicken parvovirus.
8. identify the method whether sample to be tested contains chicken parvovirus, comprise the steps: to detect the total of sample to be tested
Whether DNA contains the target sequence of primer pair described in claim 1, if containing primer described in claim 1 in described STb gene
To target sequence, sample to be tested contains or doubtful containing chicken parvovirus, if not containing claim 1 institute in described STb gene
State the target sequence of primer pair, sample to be tested does not contains or doubtful does not contains chicken parvovirus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610601889.8A CN106191318A (en) | 2016-07-27 | 2016-07-27 | A kind of primer identifying chicken parvovirus to and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610601889.8A CN106191318A (en) | 2016-07-27 | 2016-07-27 | A kind of primer identifying chicken parvovirus to and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106191318A true CN106191318A (en) | 2016-12-07 |
Family
ID=57496738
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610601889.8A Pending CN106191318A (en) | 2016-07-27 | 2016-07-27 | A kind of primer identifying chicken parvovirus to and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106191318A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241263A (en) * | 2019-07-02 | 2019-09-17 | 广西壮族自治区兽医研究所 | Identify the primer sets and its application of chicken parvovirus and fowl ephritis virus |
| CN110592281A (en) * | 2019-09-26 | 2019-12-20 | 广西壮族自治区兽医研究所 | Primer group for identifying chicken parvovirus and chicken infectious anemia virus and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017903A (en) * | 2014-06-19 | 2014-09-03 | 广西壮族自治区兽医研究所 | H3 avian influenza virus two-temperature type RT-PCR detection kit and primer pair thereof |
| CN105567877A (en) * | 2016-03-09 | 2016-05-11 | 广西壮族自治区兽医研究所 | Primer combination for identifying ChPV (Chicken Parvovirus) and ARV (Avian Reoviruses) and application thereof |
-
2016
- 2016-07-27 CN CN201610601889.8A patent/CN106191318A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017903A (en) * | 2014-06-19 | 2014-09-03 | 广西壮族自治区兽医研究所 | H3 avian influenza virus two-temperature type RT-PCR detection kit and primer pair thereof |
| CN105567877A (en) * | 2016-03-09 | 2016-05-11 | 广西壮族自治区兽医研究所 | Primer combination for identifying ChPV (Chicken Parvovirus) and ARV (Avian Reoviruses) and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| LASZLO ZSAK等: "Development of a Polymerase Chain Reaction Procedure for Detection of Chicken and Turkey Parvoviruses", 《AVIAN DISEASES》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241263A (en) * | 2019-07-02 | 2019-09-17 | 广西壮族自治区兽医研究所 | Identify the primer sets and its application of chicken parvovirus and fowl ephritis virus |
| CN110592281A (en) * | 2019-09-26 | 2019-12-20 | 广西壮族自治区兽医研究所 | Primer group for identifying chicken parvovirus and chicken infectious anemia virus and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105567877B (en) | A kind of the primer combination and its application of identification chicken parvovirus and Avianreovirus | |
| CN105039586A (en) | Primer and kit for detecting duck type-II adenovirus | |
| CN108866244A (en) | Detect RPA primer and probe, kit and its method of prawn irido virus | |
| CN106282416B (en) | A kind of the multi-fluorescence immunoassay primer, kit and method of 5 kinds of fowl immunosupress cause of diseases of quick differentiation | |
| CN105936935B (en) | PCR detection kit for rapidly identifying specific serotype salmonella | |
| CN107099617A (en) | A kind of real-time fluorescence quantitative PCR detection method of avian infectious laryngotracheitis virus | |
| CN110241263A (en) | Identify the primer sets and its application of chicken parvovirus and fowl ephritis virus | |
| CN106282417B (en) | A kind of quick multi-fluorescence immunoassay primer, kit and method for distinguishing CAV, MDV, REV, IBDV | |
| Xie et al. | Development of a reverse transcription loop-mediated isothermal amplification assay for visual detection of avian reovirus | |
| CN106191318A (en) | A kind of primer identifying chicken parvovirus to and application | |
| CN106755572A (en) | I types DHV and duck plague virus double fluorescent quantitative PCR method | |
| CN110373496A (en) | Kit and detection method for the detection of 8 type aviadenovirus of I subgroup serum | |
| CN106191319B (en) | A kind of multi-fluorescence immunoassay method of 6 kinds of fowl respiratory pathogens of quick differentiation | |
| CN105002284A (en) | Haemophilus paragallinarum fluorogenic quantitative PCR detection method | |
| CN105525038B (en) | Newcastle disease virus is strong, weak malicious one-step method real-time fluorescent RT-PCR detection kit | |
| CN106435034A (en) | Specific primer combination for identifying chicken parvovirus and application thereof | |
| CN108998575B (en) | Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus | |
| CN106939357A (en) | H4 hypotypes, H6 hypotypes and the triple RT PCR primer combinations of H9 hypotypes AIV, kit and its application | |
| CN103667538B (en) | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens | |
| CN106086241B (en) | A kind of primer, kit and the method for the multi-fluorescence immunoassay of 4 kinds of fowl respiratory pathogens of quick differentiation | |
| CN108866245B (en) | Establishment of triple PCR detection method for chicken parvovirus, avian influenza virus and newcastle disease virus | |
| CN110257560B (en) | Reagent for bluetongue virus type 8 detection, detection method and application | |
| Selim et al. | Development of real time reverse transcription loop-mediated isothermal amplification assay for rapid detection of genotype VII of Newcastle disease viruses | |
| CN106636457A (en) | Kit for detecting 4/91-type infectious bronchitis viruses | |
| Zhang et al. | Progress in research on the molecular biological detection techniques of avian encephalomyelitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161207 |