CN106636457A - Kit for detecting 4/91-type infectious bronchitis viruses - Google Patents
Kit for detecting 4/91-type infectious bronchitis viruses Download PDFInfo
- Publication number
- CN106636457A CN106636457A CN201610833489.XA CN201610833489A CN106636457A CN 106636457 A CN106636457 A CN 106636457A CN 201610833489 A CN201610833489 A CN 201610833489A CN 106636457 A CN106636457 A CN 106636457A
- Authority
- CN
- China
- Prior art keywords
- ibv
- kit
- type
- sample
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for detecting 4/91-type infectious bronchitis viruses, and belongs to the technical field of RT-PCR (reverse transcription-polymerase chain reaction) detection. The kit comprises a pair of specific primers, and nucleotide sequences of the specific primers are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively. The invention further provides a method for detecting the 4/91-type infectious bronchitis viruses. The kit and detecting method has the advantages of accuracy in detection, high sensibility, high specificity, simplicity, convenience and rapidness and has good detection ability of clinical specimens.
Description
Technical field
The present invention relates to biology field, more particularly to a kind of for detection 4/91 type infective bronchitis disease
The kit of poison and its application.
Background technology
IBV (Infectious bronchitis virus, IBV) belongs to coronaviridae
(Coronaviridae), coronavirus genus (Coronavirus), is have cyst membrane single strand plus RNA virus, its genome length
About 27.6kb.The required structural proteins of 4 kinds of IBV genome encodings：Spike protein (S), memebrane protein (M), nucleocapsid protein (N) and
Small membrane gene (E).Spike protein, memebrane protein are major surface proteins, are to constitute hat on the cyst membrane on virion most top layer
The fine prominent main component of shape virus.The nucleotide sequence amplitude of variation of S genes is larger between IBV difference strains, and some are up to 50%
More than, the amino acid variation of different IBV strains S proteins mostly occurs on S1.Sl albumen is also that IBV serotype specificity antigens are determined
Determine the major protein of cluster, the tissue tropism and its virulence on IBV has certain impact, body can be induced to produce specific antibody.
The discontinuity replicated due to IBV geneome RNAs and the incomplete check and correction mechanism of RNA polymerase so that IBV bases
Because group is extremely susceptible to be mutated, lacks, inserting and homologous recombination between different strain genomes, cause IBV serotypes numerous,
IBV new serotype also continuously emerges, but QX-like types IBV are Major Epidemic strains in world wide, 4/91 type IBV vaccine
There is preferable cross-protection to the epidemic strain, therefore usually need to carry out 4/91 type IBV strain in vaccine in producing
Whether identification, determine containing 4/91 type IBV strain in vaccine, to ensure the immune effect of vaccine.Therefore, 4/91 type IBV is entered
Row specificity identification is the ring of key one for preventing and controlling this disease.Have built up the diagnostic method of various IBV, such as neutralization test,
ELISA, blood clotting and hemagglutination-inhibition test etc., though these methods have belonged to routine techniques, in being specifically applied to IBV detections, or because
Antigenic difference is big between IBV serotypes and sensitiveness is reduced, and causes missing inspection；Or occur because of the conventional serological method defect of itself
False positive, causes flase drop.Traditional virus isolation procedure, the freshness requirement on opportunity and pathological material of disease to collection pathological material of disease is higher,
Need inoculation 9-11 day instar chicken embryos to carry out passing on observation embryo change, and chicken embryo neutralization test carried out with multiple standards positive serum,
And detection cycle often wants more than several weeks, with obvious limitation.
RT-PCR technology is a kind of quick, sensitive, special molecular biology for detection.The eighties technology generation
A kind of new selection is provided to Viral diagnosis, is widely applied in various viruses are detected.In the numerous serotypes of IBV
Sequence homology is higher, constantly has new variant to produce, and is that quick diagnosis IBV serotype brings puzzlement.
The content of the invention
First purpose of the present invention is that the specificity provided for detecting 4/91 type IBV is drawn
Thing pair.
Second object of the present invention is the kit for providing 4/91 type IBV of detection.
It is higher in view of sequence homology in the numerous serotypes of IBV, find the difference between each serotype and determine each difference
Different conserved sequence and the technological difficulties that target region is this area are selected from S1 gene hypervariable region, the present invention is with reference to GenBank
Design and screen specificity and draw in the hypervariable region of the 4/91 type IBV-S1 gene order (GenBank accession number is KF377577) for logging in
Thing.IBV-S1 albumen is the maximum structural proteins of IBV degrees of variation.In numerous alternative primers, through repeatedly screening, compare
Test, is matched with excluding primer non-specificity that may be present with other species sequences, the primer pair after finally being optimized.
The preferred specific primer pair that the present invention is provided, its sequence is：
- the TCTGATTGCACTGCTGGTACT-3 ' of upstream primer 5 ' (SEQ ID NO.1)；And downstream primer 5 '-
GCACCCGTAACGTGAGTTG-3’(SEQ ID NO.2)。
Upstream primer is in GenBank accession number between the 20500nt-20520nt of KF377577, downstream primer exists
Between 20858nt-20876nt.Extract sample total serum IgE and carry out after reverse transcription (RT) synthesis cDNA, carrying out using above-mentioned primer
PCR (PCR), using following response procedures：94 DEG C of 5min of initial denaturation, 30 circulation (94 DEG C of 45s, 58 DEG C
45s, 72 DEG C of 25s), eventually pass 72 DEG C of 10min and extend, row agarose gel electrophoresis analysis is entered to PCR primer, using ultraviolet solidifying
Glue imager testing goal band, proves the 4/91 type IBV detection positive if purpose band is amplified, and is otherwise feminine gender.
The invention provides above-mentioned specific primer is to preparing discriminating IBV serotype kit
In application.
The invention provides above-mentioned specific primer is to preparing 4/91 type IBV kit of detection
In application.
Detection reagent containing specific primer pair shown in SEQ ID NO.1-2 belongs to protection scope of the present invention.
Kit containing specific primer pair shown in SEQ ID NO.1-2 belongs to protection scope of the present invention.
Further, the working procedure in its PCR stage of kit of the invention is：94℃5min；94 DEG C of 45s, 58 DEG C
45s, 72 DEG C of 25s, 30 circulations；72℃10min.
The mentioned reagent box of the present invention is that sample to be tested is carried out after RT-PCR detections, if amplified production has 377bp sizes
Band, then in sample to be tested contain 4/91 type IBV.
Present invention also offers it is a kind of detection 4/91 type IBV non-diagnostic purpose method, including with
Lower step：
(1) total serum IgE of sample to be tested is extracted, reverse transcription obtains cDNA；
(2) performing PCR amplification is entered to the cDNA to step (1) using specific primer shown in SEQ ID NO.1-2, according to expansion
Increase result and judge whether there is 4/91 type IBV in sample to be tested.
Wherein, the purpose fragment of the positives sample amplification of step (2) is 377bp.
It is an advantage of the current invention that 1) purpose fragment of amplification is located at the hypervariable region of the S1 albumen of 4/91 type IBV, length is
377bp, sensitiveness is good, easy to operate；2) the method is to other common poultry diease cause of diseases, such as avian influenza virus, NDV, biography
The testing result of metachromia bursal disease virus, Avianreovirus, aviadenovirus and avian infectioun laryngo-tracheitis virus is all feminine gender,
Without cross reaction, show that the method also has good specificity；3) the inventive method carries out 4/ suitable for avian production
The detection of 91 types IBV, it is impossible to the conventional vaccine strain (H120, LDT3 etc.) of amplification and Major Epidemic strain (QX-like, TW-like
Deng), be only capable of expand 4/91 type strain, with high specific, high sensitivity, high efficiency, low cost the characteristics of, can be in 6h to facing
Bed pathological material of disease carries out rapid differential diagnosis, overcomes the time-consuming longer shortcoming of traditional detection method.It is clinical that the method is adapted to high-volume
The detection of sample and analysis, provide for the Rapid＆Early diagnosis of 4/91 type IBV, monitoring and Molecule Epidemiology Investigation research
Reliable technological means.
Description of the drawings
Fig. 1 is optimal amplimer screening electrophoresis result.Point sample order is M：MarkerII；1：Primer 1 (377bp)；2：
Primer 2 (401bp)；3：Primer 3 (518bp).
Fig. 2 is primer 2 specific test result.Point sample order is M：MarkerII；1：4/91 plant；2：JS strains；3：GD strains；
4：H52 strains；5：Conn strains；6：T strains.
Fig. 3 is the specific test result of primer 3.Point sample order is M：MarkerII；1：4/91 plant；2：JS strains；3：GD strains；
4：H52 strains；5：Conn strains；6：T strains.
Fig. 4 is RT-PCR reaction optimum annealing temperature screening electrophoresis results.Point sample order is M：MarkerII；1：55℃；
2：57℃；3：58℃；4：59℃；5：61℃.
Fig. 5 is that RT-PCR reaction optimum cycle number sieves select electrophoresis result.M：MarkerII；1：28 circulations；2：29 circulations；3：
30 circulations；4：31 circulations；5：32 circulations；6：33 circulations.
Fig. 6 is the Phylogenetic tree drawn according to IBV S1 genes, in figure ● shown for the inventive method detection
The representative IBV strains of different genotype.
Fig. 7 is the electrophoresis result that the different genotype IBV to selecting is detected.Loading sequence
For M：DNA Maker II；P：Positive control (4/91 type IBV)；N：Negative control；1：T strains (kidney type type strain)；2：M41 (M types
Type strain)；3：YN strains (YN-like)；4：JS strains (QX-like)；5：GD strains (TW-like).
Fig. 8 is the electrophoresis result detected to other common poultry diease cause of diseases.Wherein M：DNA Maker II；P：It is positive right
According to (4/91 type IBV)；N：Negative control；1：H5 subtype avian influenza virus；2：H7 subtype avian influenza virus；3：H9 subtype avian influenzas
Virus；4：NDV (NDV)；5：Infectious bursa of Fabricius virus (IBDV)；6：Avianreovirus (REOV)；7：Fowl adenopathy
Malicious (FAdV)；8：Avian infectioun laryngo-tracheitis virus (ILTV).
Fig. 9 is primer specificity testing result, sampfe order disclosed in document：M：Marker II；P：Positive control；N：
Negative control；1：T strains；2：Conn strains；3：H52；4：JS strains；5：GD strains.
Specific embodiment
Following examples further illustrate present disclosure, but should not be construed as limiting the invention.Without departing substantially from
In the case of spirit of the invention and essence, the modification made to the inventive method, step or condition or replacement belong to the present invention
Scope.
If not specializing, the conventional meanses that technological means used is well known to those skilled in the art in embodiment.
Conventional experimental technique in the following example, referring to the molecular cloning that Sambrook etc. writes.Using for instrument is joined
Illustrate according to instrumentation.LEGEND MICRO 17R low temperature desk centrifuges, are Thermo Products；VS-1 turbula shakers
Purchased from Ding Hao sources Science and Technology Ltd.；TL-2010S tissue grinders oscillator is purchased from Ding Hao sources Science and Technology Ltd..Reverse transcriptase
(Reverse Transcriptase) 200U/ μ l (Promega), nucleic acid inhibitor (Rnase Inhibitor) 50U/ μ l
(Takara), the reaction buffer (5 × Reaction Buffer) of 5 times of volumes, dNTP mixtures 2.5mM and random primer
(Random Primer) 500 μ g/ml (Promega), purchased from Beijing Ai Puruisheng Science and Technology Ltd.s；DEPC processes water, is purchased from
The bright person of outstanding talent in Beijing is to remote Co., Ltd.Marker II DNA Ladder are purchased from middle Ke Ruitai (Beijing) bio tech ltd.
Veriti 96-Well Thermal Cycler PCR amplification instruments are Applied Biosystems Products, purchased from Beijing
Sincere luxuriant industrial development in science and technology Co., Ltd；MINI-Smart small desks centrifuge is HERO Products；HW·SYII-KP3
Type electric heating constant temperature tank is purchased from the long bearing instruments and meters company in Beijing.
The biomaterial selected in the embodiment of the present invention is as follows：Avian influenza virus, NDV, gumboro disease
Poison, Avianreovirus, aviadenovirus and avian infectioun laryngo-tracheitis virus, the type of IBV 4/91, T strains
(kidney type type strain), M41 (M type type strains), YN strains (YN-like), JS strains (QX-like), GD strains (TW-like), H52 strain (M
Type type strain) and conn strains (M type type strains) by China Agricultural University's animal medicine institute preservation and offer.
Embodiment 1 is used for the design of the specific primer of 4/91 type IBV of detection
The high change of the 4/91 type IBV-S1 gene order (GenBank accession number is KF377577) logged in reference to GenBank
Design and screen specific primer in area.In numerous alternative primers, through repeatedly screening, Comparability test, with exclude primer with
The non-specific matching that may be present of other species sequences, Jing repeated screenings and checking, finally obtain 3 groups of alternative primer pairs, after
It is continuous that three groups of primer pairs are tested, select optimized primer pair.Primer 1,2,3 in table 1 is for same target base
The primer of cause, three's is positioned adjacent to.Each primer amplification electrophoresis result is as shown in Figure 1,2 and 3.As a result show, primer 2 and 3 energy
Other type IBV strains are amplified, specificity is poor, shows that primer 2 can expand JS strains, GD strains, conn strains, T strains, Fig. 3 in Fig. 2
Display can amplify H52 strains, the purpose band of conn strains, poor specificity, therefore cast out primer 2 and 3.Primer 1 expands purpose band
It is most bright, and without non-specific miscellaneous band, therefore selecting primer 1 to be optimal primer, upstream primer is KF377577 in GenBank accession number
20500nt-20520nt between, downstream primer is between 20858nt-20876nt.
Table 1 is used for the alternative primer sequence of 4/91 type IBV of detection
The preferred specific primer pair that the present invention is provided, as the 1st in table 1 group primer pair, its sequence is：Draw upstream
- the TCTGATTGCACTGCTGGTACT-3 ' of thing 5 ' (SEQ ID NO.1)；And downstream primer 5 '-
GCACCCGTAACGTGAGTTG-3’(SEQ ID NO.2)。
Embodiment 2 detects groping for the RT-PCR detection method optimum annealing temperature of 4/91 type IBV
1st, the pretreatment of detection sample
(1) tissue sample is processed：Take 100mg organs and tissues sample to add 0.5ml sterile salines and entered with mill
Row grinding is suspended, and supernatant is taken for testing and analyzing after tissue suspension 3000rpm centrifugation 30min.
(2) allantoic fluid sample is processed：Sample 3000rpm is centrifuged and takes supernatant after 30min for testing and analyzing.
2nd, the extraction of sample total serum IgE
Extracted with reference to Trizol RNA extracts kits (Invitrogen) specifications.
3rd, reverse transcription is cDNA
Following ingredients are added in 0.2ml centrifuge tubes：The μ l of RNA solution 4, the μ l of random primer 1, gently mix, 70 DEG C of water-baths
5min, ice bath 2min, then sequentially add following ingredients：The μ l of 5 × reaction buffer 4, the μ l of dNTP mixtures 2, nucleic acid enzyme level
The μ l of agent 1, the μ l of reverse transcriptase 0.5, DEPC process the μ l of water 7.5, gently mix, 37 DEG C of effect 1h, obtain sample cDNA.
4th, PCR detections
The primer pair (the 1st group of primer) finally determined using embodiment 1 enters performing PCR.
The different annealing temperature gradient (55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C and 59 DEG C) of design carries out RT- to 4/91 type IBV
PCR。
Following ingredients are added in 0.2ml centrifuge tubes：
After gently mixing, reacted as follows respectively with different annealing temperatures：94 DEG C of denaturations 5min, 94 DEG C of 45s,
(55 DEG C, 57 DEG C, 58 DEG C, 59 DEG C and 61 DEG C) 45s, 72 DEG C of 25s, carry out 30 circulations, and circulation terminates 72 DEG C of extension 10min.
After PCR reactions terminate, 1.2% Ago-Gel is prepared and according to being mixed into reference to ratio with 1 × TAE electrophoretic buffers
Fluorescent dye Gelsafe, takes 7 μ l PCR primers and adds in gel pore, selects suitable voltage (4V/cm-10V/cm) to carry out electricity
Swimming, electrophoresis time is 25-35min, and gel piece is placed in ultraviolet gel imaging instrument and observes and take pictures by electrophoresis after terminating, according to electricity
Can swimming result determine and amplify in sample purpose band, prove to treat test sample if purpose band length is amplified for 377bp
Product are that the detection of 4/91 type IBV is positive, otherwise negative for detection.
Electrophoresis result as shown in figure 4,58 DEG C for amplification purpose band it is most bright, with reference to annealing temperature it is too high be unfavorable for primer with
Template is combined, so selecting 58 DEG C to be optimum annealing temperature.
Embodiment 3 detects that the RT-PCR detection method optimum cycle number of 4/91 type IBV is groped
The pretreatment of detection sample, the extraction of sample total serum IgE, reverse transcription are cDNA referring to the corresponding method of embodiment 2.Profit
The condition determined with embodiment 1 and 2,6 different periods (28,29,30,31,32 and 33) of design are carried out to 4/91 type IBV
RT-PCR。
Composition is added in 0.2ml centrifuge tubes with embodiment 2.After gently mixing, reacted as follows：94 DEG C of denaturations
5min, 94 DEG C of 45s, 58 DEG C of 45s, 72 DEG C of 25s, carry out different periods (28,29,30,31,32 and 33), and circulation terminates 72
DEG C extend 10min.Referring to embodiment 2, electrophoresis result is as shown in figure 5,30 periods expand purpose bar to PCR primer electrophoresis experiment
Counterband tape is similar to more period brightness, and without non-specific miscellaneous band, energy is time-consuming, improve detection efficiency, therefore selects
It is optimum cycle number to select it.
Embodiment 4 detects the foundation of the RT-PCR detection method of 4/91 type IBV
The pretreatment of detection sample, the extraction of sample total serum IgE, reverse transcription are cDNA referring to the corresponding method of embodiment 2.
Add in 0.2ml centrifuge tubes, composition is referring to embodiment 2.
After gently mixing, using following response procedures：94 DEG C of 5min of initial denaturation, 30 circulation (94 DEG C of 45s, 58 DEG C
45s, 72 DEG C of 25s), eventually pass 72 DEG C of 10min and extend, after PCR reactions terminate, with 1 × TAE electrophoretic buffers 1.2% is prepared
Ago-Gel is simultaneously mixed into fluorescent dye Gelsafe according to reference to ratio, takes 7 μ l PCR primers and adds in gel pore, selects to close
Suitable voltage (4V/cm-10V/cm) carries out electrophoresis, and electrophoresis time is 25-35min, and electrophoresis is placed in gel piece after terminating ultraviolet
Observe in gel imaging instrument and take pictures, determined according to electrophoresis result and can amplify in sample purpose band, if amplifying mesh
Band length then to prove testing sample for 377bp positive for 4/91 type IBV, be otherwise feminine gender.
Embodiment 5 detects the evaluating characteristics of the RT-PCR detection method of 4/91 type IBV
1st, different genotype specificity of infectious bronchitis virus detection
The method set up according to embodiment 4 is carried out.
Using said method different genotype IBV (as shown in Figure 6) is detected respectively, electrophoresis result as shown in fig. 7,
As a result illustrate, the method that the embodiment of the present invention 4 is set up only can detect 4/91 type IBV and examine the IBV for not measuring other serotypes, because
And IBV genotype identifications can be carried out to detection sample, show that this method has good Sensitivity and Specificity.2nd, fowl is common
The specific detection of cause of disease
Using the method for building up of embodiment 4 to other common poultry diease cause of diseases, avian influenza virus, NDV, infectiousness
Bursal disease virus, Avianreovirus, aviadenovirus and avian infectioun laryngo-tracheitis virus detected, as a result as shown in figure 8,
As a result show, in addition to positive control, other experimental subjects are all feminine gender, show this method in other common cause of diseases of detection bird
During body, the method that embodiment 4 is set up has good specificity for 4/91 type IBV.
3rd, compared with prior art
Prior art describe the foundation of avian infectious bronchitis virus 793B RT-PCR detection methods and application (in
Shen Ye, Diao Youxiang, etc., Chinese animal doctor's journal, in July, 2007), the primer sequence of employing is as follows：Upstream
ACGAATTCATGTTGGGCAAACCGCT；Downstream ATGTCGACAAGTATCAACGCCACC, avian infectious bronchitis virus
793B namely the types of IBV 4/91.Applicant carries out specific detection experiment using above-mentioned primer, finds above-mentioned primer except examining
Measure the types of IBV 4/91, additionally it is possible to detect IBV T strains (kidney type type strain), it is seen that the specificity of above-mentioned primer is not as the present invention
Primer specificity is strong.As a result Fig. 9 is seen.
Although above with a general description of the specific embodiments the present invention is described in detail,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, without departing from theon the basis of the spirit of the present invention these modifications or improvements, belong to the scope of protection of present invention.
Claims (10)
1. it is a kind of for detect 4/91 type IBV specific primer pair, it is characterised in that the primer
To target gene for IBV S1 genes hypervariable region.
2. it is a kind of for detect 4/91 type IBV specific primer pair, it is characterised in that its nucleotides
Sequence contains the sequence as shown in SEQ ID NO.1-2.
3. specific primer described in claim 1 or 2 is in discriminating IBV serotype kit is prepared
Application.
4. specific primer described in claim 1 or 2 is in 4/91 type IBV kit of detection is prepared
Application.
5. containing the detection reagent of specific primer pair described in claim 1 or 2.
6. containing the kit of specific primer pair described in claim 1 or 2.
7. kit as claimed in claim 6, it is characterised in that its working procedure is：94℃5min；94 DEG C of 45s, 58 DEG C
45s, 72 DEG C of 25s, 30 circulations；72℃10min.
8. kit as claimed in claims 6 or 7, it is characterised in that carry out to sample to be tested after RT-PCR detections, amplification is produced
If thing has the band of 377bp sizes, 4/91 type IBV is contained in sample to be tested.
9. it is a kind of detection 4/91 type IBV non-diagnostic purpose method, it is characterised in that including following step
Suddenly：
(1) total serum IgE of sample to be tested is extracted, reverse transcription obtains cDNA；
(2) performing PCR amplification is entered to the cDNA to step (1) using specific primer described in claim 1 or 2, according to amplification knot
Fruit judges whether there is 4/91 type IBV in sample to be tested.
10. method as claimed in claim 9, it is characterised in that the purpose fragment of the positives sample amplification of step (2) is
377bp。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610833489.XA CN106636457A (en) | 2016-09-19 | 2016-09-19 | Kit for detecting 4/91-type infectious bronchitis viruses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610833489.XA CN106636457A (en) | 2016-09-19 | 2016-09-19 | Kit for detecting 4/91-type infectious bronchitis viruses |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636457A true CN106636457A (en) | 2017-05-10 |
Family
ID=58852021
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610833489.XA Pending CN106636457A (en) | 2016-09-19 | 2016-09-19 | Kit for detecting 4/91-type infectious bronchitis viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636457A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108315488A (en) * | 2018-04-17 | 2018-07-24 | 山东新希望六和集团有限公司 | Primer, RT-PCR detection kit and method, application for identifying avian infectious bronchitis virus strain type |
| CN116024388A (en) * | 2023-01-05 | 2023-04-28 | 福建圣泽生物科技发展有限公司 | RT-PCR detection kit for infectious bronchitis virus GVI-1 genotype and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6214538B1 (en) * | 1992-07-30 | 2001-04-10 | University Of Georgia Research Foundation | Differentiation of avian infectious bronchitis virus serotypes |
| CN102719567A (en) * | 2012-07-05 | 2012-10-10 | 广东温氏食品集团有限公司 | PCR (Polymerase Chain Reaction) detection primer and method for H120 strain of avian infectious bronchitis virus |
| CN102643931B (en) * | 2012-04-17 | 2013-12-18 | 中国农业大学 | Reverse transcription-polymerase chain reaction (RT-PCR) method for verifying avian infectious bronchitis virus (IBV) epidemic strains and vaccine strains |
| CN105039585A (en) * | 2015-03-08 | 2015-11-11 | 江苏省家禽科学研究所 | Primer used in RT-PCR detection of chicken infectious bronchitis virus, kit comprising the primer and detection method thereof |
| CN105463136A (en) * | 2016-01-18 | 2016-04-06 | 浙江大学 | Kit for RT-PCR typing detection of avian infectious bronchitis virus |
-
2016
- 2016-09-19 CN CN201610833489.XA patent/CN106636457A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6214538B1 (en) * | 1992-07-30 | 2001-04-10 | University Of Georgia Research Foundation | Differentiation of avian infectious bronchitis virus serotypes |
| CN102643931B (en) * | 2012-04-17 | 2013-12-18 | 中国农业大学 | Reverse transcription-polymerase chain reaction (RT-PCR) method for verifying avian infectious bronchitis virus (IBV) epidemic strains and vaccine strains |
| CN102719567A (en) * | 2012-07-05 | 2012-10-10 | 广东温氏食品集团有限公司 | PCR (Polymerase Chain Reaction) detection primer and method for H120 strain of avian infectious bronchitis virus |
| CN105039585A (en) * | 2015-03-08 | 2015-11-11 | 江苏省家禽科学研究所 | Primer used in RT-PCR detection of chicken infectious bronchitis virus, kit comprising the primer and detection method thereof |
| CN105463136A (en) * | 2016-01-18 | 2016-04-06 | 浙江大学 | Kit for RT-PCR typing detection of avian infectious bronchitis virus |
Non-Patent Citations (1)
| Title |
|---|
| 药立波: "《医学分子生物学实验技术》", 31 March 2014, 人民卫生出版社 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108315488A (en) * | 2018-04-17 | 2018-07-24 | 山东新希望六和集团有限公司 | Primer, RT-PCR detection kit and method, application for identifying avian infectious bronchitis virus strain type |
| CN108315488B (en) * | 2018-04-17 | 2022-09-13 | 青岛嘉智生物技术有限公司 | Primer for identifying type of avian infectious bronchitis virus strain, RT-PCR detection kit, method and application |
| CN116024388A (en) * | 2023-01-05 | 2023-04-28 | 福建圣泽生物科技发展有限公司 | RT-PCR detection kit for infectious bronchitis virus GVI-1 genotype and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104513865B (en) | Reverse transcription PCR detects test kit and the detection method thereof of Chikungunya virus | |
| CN106399590A (en) | General nucleic acid isothermal detection reagent of respiratory tract infection associated adenoviruses | |
| CN104232798B (en) | The multiple fluorescence quantitative PCR method of DHAV detection and Gene A type and the discriminating of C type and test kit | |
| CN106167833B (en) | A kind of while 8 kinds of entomophila encephalitis viruses of detection RT-PCR primers and probe combinations and kit | |
| CN110453011A (en) | A kind of method and application based on CRISPR/Cas12a fast accurate detection African swine fever virus | |
| CN110358866A (en) | Novel goose astrovirus SYBR Green dye method fluorescent quantificationally PCR detecting kit | |
| CN109762942A (en) | A kind of dual isothermal nucleic acid amplification method containing internal reference of quick detection Respiratory Syncytial Virus(RSV) | |
| CN105936946A (en) | One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof | |
| CN106086236A (en) | Detect test kit and the method for influenza virus H1, H3, H5, H7 simultaneously | |
| CN106399588B (en) | kit for detecting avian leukosis virus J subgroup | |
| CN107828914A (en) | Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent | |
| CN109913591A (en) | A type Sai Nika virus fluorescent quantitative RT-PCR detection method and kit based on TaqMan probe method | |
| CN103397105A (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN105002298B (en) | A kind of fluorescent quantitative PCR detection method of huichun viremia virus | |
| CN106435021A (en) | Kit for detecting Newcastle disease viruses of chicken with different genotypes | |
| CN106435020B (en) | For detecting the universal kit of different genotype infectious bronchitis virus | |
| CN110373496A (en) | Kit and detection method for the detection of 8 type aviadenovirus of I subgroup serum | |
| CN106119423A (en) | The general PCR primer of detection Avianreovirus and detection kit thereof | |
| CN108330211A (en) | A group rotavirus/astrovirus/intestinal adenovirus nucleic acid multiple fluorescence PCR detection reagent box and application thereof | |
| CN110438260A (en) | A kind of African swine fever virus nucleic acid test strips detection kit | |
| CN110343784A (en) | The composition and kit of quadruple influenza nucleic acids detection based on melting curve | |
| CN106636457A (en) | Kit for detecting 4/91-type infectious bronchitis viruses | |
| CN105950785A (en) | Ternary fluorescence RT-PCR detection kit of avian influenza virus, new castle disease virus and infectious bronchitis virus, primers and probes | |
| CN108384893A (en) | Real-time fluorescence quantitative RT-PCR kit for detecting foot and mouth disease virus and Sai Nika paddy viruses and its application | |
| CN103993102A (en) | Multiple fluorescent PCR method and kit for simultaneous detection of human adenovirus, human mycoplasma pneumonia and bocavirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170510 |