CN106167806A - Tubercule bacillus 16kD 38kD 19kD tri-fusion protein construction and qualification - Google Patents

Abstract

The invention provides a kind of mycobacterium tuberculosis three recombination fusion protein 16kD 38kD 19kD, and be applied to phthisical clinical diagnosis.Select three strong antigen epi-positions of mycobacterium tuberculosis, utilize PCR method, with H₃₇RV is a kind of mycobacterium tuberculosis three recombination fusion protein that template builds, utilize DNA hydrogel cell free in vitro protein expression system expressed fusion protein, utilize metal chelate affinity chromatography technology that the recombiant protein obtained is purified, last with it as antigen, utilize dot immuno gold filtration assay technology to prepare novel mycobacterium tuberculosis Serologic detection test kit.Compared with the similar test kit on market, there is high specificity, sensitivity advantages of higher, provide more reliable instrument for examination lungy and diagnosis, also can be used for preparing protein chip, vaccine, monoclonal antibody and multi-resistance etc..

Description

Tubercule bacillus 16kD-38kD-19kD tri-fusion protein construction and qualification

Technical field

The present invention relates to genetic engineering field, more particularly to the structure of a kind of mycobacterium tuberculosis three recombination fusion protein Build and apply.

Background technology

Tuberculosis is to be infected by mycobacterium tuberculosis (Mycobacterium tuberculosis, TB) to cause chronic sense Catching an illness, tulase may invade the various organ of Whole Body, but mainly invades lungs, referred to as pulmonary tuberculosis.Along with tuberculosis branch The impact of the multiple factors such as the popular propagation of bacillus persister, the reduction of bacillus calmette-guerin vaccine immune effect and movement of population, whole world knot The development of core disease epidemic situation is increasingly serious, and research shows, by the crowd of tubercle bacillus affection, the people of 10 % can develop into tuberculosis.As Fruit does not take effective control measure, and at following 10 years, China may have the infected of nearly 50,000,000 that tuberculosis occurs.Mesh Before, the phthisical cure rate of China has reached 90 more than %, but current diagnosis lungy also rely primarily on sputum smear examination and Sputum tuberculomyces culture tuberculosis results of imaging, the shortcoming of sputum tuberculomyces culture maximum is then that incubation time is long, it is generally required to 4-6 week.Additionally, due to pulmonary tuberculosis modal symptom in early days is cough and expectoration, patient and doctor is easily made to be mistaken for sense Emit or tracheitis and cause mistaken diagnosis, and delay best occasion for the treatment.Therefore, new, quick, simple, convenient, sensitivity is developed High diagnosis of tuberculosis method is for popular significant in China of Stop TB.

Serologic detection refers to the antigen antibody reaction carried out in vitro, and its ultimate principle is can be with corresponding based on antigen The characteristic that antibody specificity combines, utilizes known antigen checks in serum or other sample such as yolk, milk whether contain Corresponding antibody.In detection lungy, owing to tubercle bacillus antigen is complicated, antibody species specificity is difficult to determine, the quickest Perception is relatively low, and serodiagnosis is now only used as auxiliary diagnosis and differential diagnosis lungy.Antitubercle sera diagnostic reagent at present Box is mainly TB-DOT and Rapid Test, is all based on single tubercule bacillus recombinant antigen (38kD antigen) principle, but Substantial amounts of document and clinical data show, owing to tuberculosis patient antibody response exists heterogeneity, single antigen for serology There is the defect that sensitivity is low and false positive rate is higher in diagnosis.Very universal owing to infecting tulase in crowd, Healthy People also can Carrying the anti-tubercle bacillus antibody of reduced levels, therefore the sensitivity of detectable is too high, it may appear that false positive, and too low can make The tuberculosis patient of low-level antibody is failed to pinpoint a disease in diagnosis, so, the testing result about tuberculosis antibody differs greatly at present, should in clinic The evaluation used is the most inconsistent.

For the problems referred to above, set up tuberculosis rapid diagnosis technology it is crucial that find the specificity having kind and have More strongly immunogenic antigen of mycobacterium tuberculosis, and build the scientific and rational combination of a series of specific antigen or contain The fusion protein of tubercule bacillus critical epitopes, improves the sensitivity of diagnosis on the basis of ensureing relatively high specific.

Summary of the invention

(1) to solve the technical problem that

The present invention seeks to build mycobacterium tuberculosis 16kD-38kD-19kD tri-recombination fusion protein, utilize the immunity of speckle gold Diafiltration techniques (DIGFA) produces the novel mycobacterium tuberculosis Serologic detection test kit that specificity is high, false positive is low, for tuberculosis A kind of methods for clinical diagnosis reliably, easily and fast of sick offer.

(2) technical scheme

The present invention obtains tubercule bacillus H according to ncbi database retrieval₃₇Rv reference culture 16kD, 19kD and 38kD gene sequence Row, design synthetic primer, after PCR, TA clone, and enzyme action purification 3 fragment gene fragment, recombinate successively with pET28a carrier, First build pET28a-16kD recombiant plasmid, continue enzyme action on the basis of identifying successfully and be connected with 38kD fragment, after identifying successfully, Enzyme action is connected with 19kD fragment further, and enzyme action is identified, final acquisition pET-28a-16kD-38kD-19kD recombinant expression carrier, Order-checking identifies that 16kD-38kD-19kD restructuring fusion sequence is recombinated successfully.

Present invention application DNA-hydrogel cell free in vitro protein expression system expresses recombination fusion protein.First X-is synthesized DNA, applicationApa IEnzyme action carries out linearisation to fusion protein plasmid, with nuclease free water, T4 DNA ligase, T4 DNA even Connect the composition DNA gel reaction mixtures such as enzyme buffer liquid；It is then based on magnetic agitation mode and prepares DNA gel microparticle, and right It is purified and identifies；Last according to RTS 100E.coliTest kit prepares the acellular reactant liquor of commercialization, determines The optimal incubation time of acellular reaction, X-DNA and the optimum concentration of gene masterplate.The final one that obtains expresses tuberculosis branch The DNA-hydrogel acellular albumen expression system of bacillus 16kD-38kD-19kD tri-recombination fusion protein.

Applied metal of the present invention chelating affinity chromatography medium technology (metal chelate chromatography) purification The recombination fusion protein obtained in above-mentioned steps, carries out determined amino acid sequence, applies BCA simultaneously fusion protein after purification Method measures fusion protein concentration, and application ELISA method measures fusion protein activity.The final acquisition purity tuberculosis branch more than 96 % Bacillus 16kD-38kD-19kD tri-fusion protein.

The high-purity recombination fusion protein of above-mentioned acquisition is coated on nitrocellulose filter by the present invention, uses colloid gold label Staphylococcal protein A (SPA), then assembles percolating device, sets up and optimizes dot immuno gold filtration assay detection system, finally obtaining Novel mycobacterium tuberculosis serological diagnostic kit based on dot immuno gold filtration assay technology.Clinical serum pattern detection is tested Showing, the sensitivity of this test kit is (94.5 %), and false positive is (2.7 %).

(3) effective benefit

Diagnostic kit prepared by the mycobacterium tuberculosis 16kD-38kD-19kD recombination fusion protein using the present invention to provide, with Similar test kit on market is compared, and has high specificity, sensitivity advantages of higher, has better met mycobacterium tuberculosis sense The needs of dye clinical diagnosis.

Accompanying drawing explanation

Fig. 1 is the structure flow chart of expression vector pET-16kD-38kD-19kD；

Fig. 2 is the restriction enzyme digestion and electrophoresis figure of expression vector pET-16kD-38kD-19kD, A: single-gene enzyme action point electrophoretogram, 1: Marker, 2:16kD, 3:38kD, 4:19kD；B: fusion gene restriction enzyme digestion and electrophoresis figure, 1:Marker, 2: the recombiant plasmid before enzyme action, 3:16kD, 4:16kD+38kD, 5:16kD+38kD+19kD；

Fig. 3 is 4 oligonucleotide sequences and inspection electrophoretogram, 1:X1,2:X1+X2,3:X1+X2+X3, the 4:X1+X2+ of X-DNA X3+X4；

Fig. 4 is the metal chelate chromatography affinity purification gel electrophoresis figure of DNA-hydrogel protein expression system expressing protein, 1: Marker, 2: before purification, 3: after purification.

Detailed description of the invention

Following example are used for illustrating the present invention, but are not limited to protection scope of the present invention.

Embodiment 1: the preparation of mycobacterium tuberculosis 16kD-38kD-19kD recombination fusion protein and purification

1.1 gene fusion

Analyze TB H37Rv genom sequence by computer, select its strong antigen epi-position 16kD(GENEBANK locus: NP_214765), 38kD albumen (GENEBANK locus:HG813240) and 19kD(GENEBANK locus:CP007027) DNA sequence is template, and design amplimer is:

16kD amplimer:

16-38-19a:GGAAGGCATATGAACAATCTCGCATTGTGGTCGC

16-38-19b:TTATTAGGATCCTCCGCCACCCTTCGTGATGGCGATG

19kD amplimer:

16-38-19c:AATAGAATTCGGAGGTGGCGGTAGTGTGAAGCGTGGACTGA

16-38-19d:GTCCGGAAGCTTTTAGGAACAGGTCACCTCGATTTCG

38kD amplimer:

16-38-19e:GCTGACGGATCCGTGAAAATTCGTTTGCATAC

16-38-19f:GTATTAGAATTCGCTGGAAATCGTCGCGATC

50 ml amplification system: ddH₂O 31.5 ml, 10 × buffer 5.0 ml, 4 × dNTP 4.0 ml, upstream and downstream primer Mixed liquid 4.0 ml, DNA 1.5 ml, Taqplus 0.2 ml(1 U).

Take Mycobacterium tuberculosis H₃₇R_VThalline, add 100 ml E.C. 3.4.21.64s (10 mg/ml), put 56 DEG C of water-baths and digest 4 h, Purify by conventional phenol/chloroform method, carry out PCR amplification with above-mentioned primer.Wherein, 16kD forward primer increasesNdeI restriction enzyme site, Downstream increasesBamHI restriction enzyme site；38kD forward primer increasesBamHI restriction enzyme site, downstream increasesEcoRI Restriction enzyme site；19kD forward primer increasesEcoRI restriction enzyme site, downstream increasesHind III restriction enzyme site.

Being modified by cloned sequence, product cuts after purification through agarose gel electrophoresis, will press containing the blob of viscose of DNA band DNA fast purifying test kit (purchased from green skies company, name of product: PCR/DNA purification kit) description operates, and returns Receive DNA.Plasmid DNA and 16kD, 38kD, 19kD fragment are all through inscribe enzyme action, 50 ml system: 10 × buffer 5.0 ml, DNA 12 ml,Hind III HeNdeEach 15 U of I, ddH₂O mends to 50 ml；37 DEG C of water-bath 6 h.50 ml digestion products are through fine jade Sepharose is separated by electrophoresis, cutting DNA band agar block, utilizes DNA fast purifying test kit to reclaim DNA.

16kD, 38kD and 19kD genetic fragment is cloned into pET28a plasmid successively (haveHindIII HeNde I Restriction enzyme site, purchased from Dalian treasured biological engineering company limited), first build pET28a-16kD recombiant plasmid, identify successfully base Continuing enzyme action on plinth to be connected with 38kD fragment, after identifying successfully, further enzyme action is connected with 19kD fragment, and enzyme action is identified.20 ml Linked system: ddH₂O 15.0 ml, 10 × buffer 2.0 ml, pET28a 2.0 ml, genetic fragment 1.0 ml, T4 DNA Ligase 20 U.Plasmid self connects comparison, 20 ml coupled reaction system: ddH₂O 16.0 ml, 10 × buffer 2.0 Ml, pET28a 2.0 ml, T4 DNA ligase 20 U.After above-mentioned sample-adding, mixing, the most centrifugal, 14 DEG C-16 DEG C connected Night.Transformed E .coli is coated with LB flat board (containing 15 μ g/ml kanamycin), and incubated overnight, picking monoclonal, upgrading grain is also carried out Order-checking, determines the clone that sequence is correct.The enzyme action of recombiant plasmid (Nde Ⅰ/HindIII) electrophoretogram is as shown in Figure 2.

1.2 product order-checkings

Employing T7 promoter:5-' TAATACGACTCACTATAGGG-3 ' and T7 terminator:5 '- GCTAGTTATTGCTCAGCGG-3 ' universal primer.All amplimers and the synthesis of sequencing primer and recombiant plasmid sequence The mensuration of pET28a-16kD-38kD-19kD is all provided service by Sheng Gong biological engineering company limited.Record purpose fusion gene Nucleotide sequence as shown in SEQ ID NO:1.

The expression of 1.3 destination proteins, purification

1.3.1 the preparation of X-DNA

X-DNA is formed through a special cycle of annealing by the DNA molecular of 40 bp length of four end reverse complementals.For The oligonucleotide sequence of synthesis X-DNA is:

X1:5'-p-CGACCGATGAATAGCGGTCAGATCCGTACCTACTCGGGCC-3'

X2:5'-p-CGAGTAGGTACGGATCTGCGTATTGCGAACGACTCGGGCC-3'

X3:5'-p-CGAGTCGTTCGCAATACGGCTGTACGTATGGTCTCGGGCC-3'

X4:5'-p-CGAGACCATACGTACAGCACCGCTATTCATCGGTCGGGCC-3'

Four oligonucleotide molecules mixed in equal amounts according to sequent synthesis (are controlled the final concentration of of every oligonucleotide molecules 0.2 mM) it is placed in PCR instrument.Annealing system: 95 DEG C of degeneration 2 min, 65 DEG C keep 2 min, and 60 DEG C keep 5.5 min, Every 30 s, temperature is turned down 1 DEG C afterwards, be down to 20 DEG C the most continuously.The nucleic acid electrophoresis figure of X-DNA is as shown in Figure 3.

1.3.2 the preparation of DNA-hydrogel microparticle

UseApaThe recombiant plasmid (pET28a-16kD-38kD-19kD) of correct for checking clone is carried out linearisation by I enzyme, For the connection carrying out X-DNA.

By Span 80 with 80 two kinds of surfactants of Tween respectively with 4.5 %(wt/wt) and 0.5 %(wt/wt) Ratio is added in mineral oil, mixing of fully vibrating.Take out 1 ml after ice bath and be placed in glass cuvette, add 3 mm × 8 mm rule The magnetic stir bar of lattice, and control to be 3000 rpm(maximum (top) speeds by rotating speed).The 10 μ l that will prepare on ice bath rapidly after stable DNA gel reaction mixture adds with the volume ratio of 1:100, continues stirring 1 min, makes DNA gel reactant liquor (aqueous phase) equably It is dispersed in mineral oil (oil phase), forms water-in-oil emulsion.The surfactant added in oil phase can be effectively prevented and be dispersed in The droplet of the DNA gel reactant liquor in oil phase regroups, and serves the effect of stable emulsion.Finely dispersed emulsion is put Being placed in 16 DEG C of overnight incubation, the droplet being dispersed in oil phase crosslinks reaction, forms uniform solid gel microparticle.

10 μ l DNA gel reaction mixture systems: X-DNA stock solution 3.5 μ l, linear plasmid template 2 μ L, Nuclease-free water 3 μ l, 10 × T4 ligase buffer 1 μ l, T4 ligase(5 U/ μ l) 0.5 μ l.

1.3.3 the collection of DNA-hydrogel microparticle, purification

Take the DNA-hydrogel sample being dispersed in oil phase synthesis, with the surfactant of mineral oil extraction residual, with normal hexane Dissolve remaining mineral oil.After fume hood is dried 15 min, deionized water cleans, and removes the normal hexane of residual.

1.3.4 DNA-hydrogel acellular albumen expression system is used to carry out expressing fusion protein

Use commercialization acellular reactant liquor test kit (purchased from Roche company, name of product: RTS 100E.coli HY Kit) the acellular expression of fusion protein is carried out.The DNA-hydrogel of 10 μ l volumes is added in acellular reactant liquor, reactant Tie up to 24 DEG C, 900 rpm vibrations in Proteomaster.Different time in acellular reaction takes the albumen of synthesis and examines Survey, screen the optimal incubation time of optimal acellular reaction.

1.3.5 destination protein purification

The albumen Ni post (GE company) collected is purified, uses following eluant solution: 300 mM imidazoles, 50 mM Tris- HCl, 500 mM NaCl.16kD, 38kD and 19kD track fusion albumen totally 702 aminoacid, aminoacid sequence such as SEQ Shown in ID NO 2.

1.4 fusion protein are identified

1.4.1 purity testing

Through SDS-PAGE electrophoresis detection (albumen applied sample amount 6.4 μ g), for single zone, thin slice scan identifies that purity is 98.2 %, Testing result is shown in accompanying drawing 4.

1.4.2 concentration measures

Measuring through BCA method, using bovine serum albumin as standard reference product, fusion protein concentration is 5.7 mg/ml.

1.4.3 determination of activity

It is antigen coated in ELISA Plate with the fusion protein of purification, package amount 2 μ g/ hole, use and make a definite diagnosis lunger and be good for OD value at the determination of serum 492 nm wavelength of health person.Result is as follows:

Example 2: the preparation of mycobacterium tuberculosis antibody IgG diagnostic kit (dot immuno gold filtration assay method) and performance detecting

2.1 test kit composition and preparations

Test kit of the present invention is using the mycobacterium tuberculosis 16kD-38kD-19kD recombination fusion protein of purification as TB antigen, by it Being coated on nitrocellulose filter, as test point, this antigen can capture the IgG tuberculosis antibody in serum specimen, captured Tuberculosis antibody can combine with staphylococcal protein A (SPA) colloidal gold conjugate and present punctation.Without red in the middle of reacting hole Mottle point, represents that in blood serum sample, tuberculosis antibody is negative, and redness should occur in Quality Control point.

It is immunity percolation device that test kit mainly comprises composition, mainly by plastic caddy, water suction bedding and padding and celluloid Diaphragm three part forms, and nitrocellulose filter comprises detection zone and quality control region.

2.1.1 test point is coated recombination fusion protein 16kD-38kD-19kD, is coated concentration and makees 1:2 dilution.

2.1.2 Quality Control point is coated sheep anti-mouse igg, is coated concentration and makees 1:16 dilution.

2.1.3 immunity percolation reaction system optimization

(1) determination of reaction film optimum drying condition

Relative humidity gradient 20 %, 30 %, 40 % are set, drying time 30 min, 40 min, 50 min, 60 min, 70 Min, baking temperature is 37 DEG C, uses positive serum to detect, determines optimum drying humidity and drying time.

Table 1 reaction film drying condition choice experiment result

-: negative reaction ,+: positive reaction, ++: relatively strong positive reaction, +++: strong positive reaction

As can be seen from Table 1: under the conditions of relative humidity is 20 %, the short time is dried the poor stability that can cause reagent, time long Between be dried and can affect again the accuracy of testing result；And relative humidity be 30 %, under the conditions of 40 %, drying time is 40 When min, 50 min, 60 min and 70 min, the sensitivity of reagent and stability are all preferable, and testing result is relatively.Examine Consider the ease for operation to experimentation, therefore select under conditions of relative humidity is 30 %-40 %, be dried reaction film 60 min.

(2) optimal antigen coated concentration and the determination of the suitableeest sheep anti-mouse igg working concentration

Envelope antigen is diluted to 1:1,1:2,1:4,1:8 totally four Concentraton gradient, sheep anti-mouse igg is diluted to 1:4,1:8,1: 16, tetra-Concentraton gradient of 1:32, positive reference serum to be measured is diluted to 1:1,1:2,1:4,1:6,1:8,1:10 totally six dense Degree gradient, with envelope antigen concentration, sheep anti-mouse igg concentration as variable, coordinates undiluted gold labelling SPA respectively to six gradients To be measured positive reference serum carry out Checkerboard titration experiment, analyze experimental result, determine the suitableeest antigen coated concentration and sheep anti mouse IgG concentration.

The optimal antigen coated concentration of table 2 and sheep anti-mouse igg working concentration choice experiment result

+: positive, +/-: the weak positive ,-: negative

Being determined that antigen is made 1:2 dilution and is coated by table 2, sheep anti-mouse igg uses as working concentration after making 1:16 dilution.

(3) the suitableeest gold mark SPA concentration determines

Gold is marked SPA and is diluted to five Concentraton gradient of 1:1,1:2,1:4,1:8,1:10, with it as variable, in conjunction with fixed Suitable antigen coated concentration and optimal sheep anti-mouse igg working concentration, carry out chess to the to be measured positive reference serum of six gradients respectively Dish titration experiments, analyzes experimental result, determines the suitableeest gold mark dilution factor.

Table 3 the suitableeest gold mark SPA concentration choice experiment result

+: positive, +/-: the weak positive ,-: negative

As can be seen from Table 3, gold mark SPA is diluted to the suitableeest working concentration as 1:2.

(4) reaction film most preferably closes way choice

Sheep anti-mouse igg point sample is central as test point in nitrocellulose filter, and point four kinds of different modes are carried out after closing Immunity percolation is tested, and observes the different closing mode impact on reaction effect.

1. it is placed at room temperature on circumferential oscillation shaking table with the 0.01 M TBST containing 1 % BSA and closes 4 h；

2. it is placed at room temperature on circumferential oscillation shaking table with the 0.01 M TBST containing 5 % defatted milk powder and closes 4 h；

3. overnight close under the conditions of 4 DEG C with the 0.01 M TBST containing 1 % BSA；

4. overnight close under the conditions of 4 DEG C with the 0.01 M TBST containing 5 % defatted milk powder；

5. at 37 DEG C, 45 min are closed with the 0.01 M TBST containing 1 % BSA；

6. at 37 DEG C, 45 min are closed with the 0.01 M TBST containing 5 % defatted milk powder.

Draw according to experimental result: 6 groups of test points all develop the color and effectively can distinguish with background, but relative to other group Not, 4. in group, not only background is low, and colour developing is more uniform.Therefore select the 0.01 M TBST containing 5 % defatted milk powder as closing Liquid, sealing condition is overnight to close at 4 DEG C.

2.1.4 the manufacture of test kit

(1) being coated of antigen

Take antigen protein (1:2 dilution) point sample of 1 μ l in 1 × 1 cm²The nitrocellulose filter center position to the left conduct of size Test point, takes sheep anti-mouse igg (1:16 dilution) point sample of 1 μ l in position to the right, nitrocellulose filter center as Quality Control point, and 30 60 min it are dried under conditions of %-40 %.

(2) close

Antigenic membrane after point sample is dipped in the 0.01 M TBST confining liquid containing 5 % defatted milk powder, stood under the conditions of 4 DEG C Night is closed.

(3) film is washed

Discard confining liquid, quickly wash film once with ultra-pure water, then film is dipped in 0.01 M TBS solution, transfers to circumference and shake On bed, film 5 min is washed in 120 rpm concussions, naturally dries after taking-up.

(4) percolating device is assembled

Being placed in by absorbent material in immunity percolation card, the superiors cover filter paper, are transferred to by antigenic membrane on filter paper, compress diafiltration card Lid, makes diafiltration hole clipping alignment antigenic membrane central, completes the assembling of immunity percolation device.Finished product test kit includes Sptting plate, closing Liquid, cleaning mixture, gold mark liquid, positive control and negative control.

2.1.5 operational approach and result judge

(1) operational approach

1. in the middle of the reacting hole of detection plate, add 2 confining liquids, treat that thin film sucks；

2. take 20 μ l serum samples, add in the middle of reacting hole, treat that thin film sucks；

3. in the middle of reacting hole, add 8 cleaning mixture, treat that thin film sucks；

4. in the middle of reacting hole, add 2 gold mark liquid, treat that thin film sucks；

5. in the middle of reacting hole, add 8 cleaning mixture, treat that thin film sucks, visual observation.

(2) result judges

The positive-Quality Control point display redness, has punctation to occur in the middle of reacting hole；

Feminine gender-Quality Control point display redness, reacting hole middle redfree speckle appearance or only vestige.

2.2 test kit performance evaluations

2.2.1 serum sample detection

Clinical control serum sample is detected (60 parts) by test kit prepared by application experiment, judges that this examines according to experimental result Examining system is the most feasible.Testing result is shown in Table 4.

4 60 parts of serum sample testing results of table

-: negative reaction ,+: positive reaction, ++: relatively strong positive reaction, +++: strong positive reaction.

From experiment statistics result it can be seen that feminine gender and positive coincidence rate all reach 100 %, therefore it is considered that use this Detecting system is feasible.

2.2.2 the Positive Sera cross reaction such as HBV, HCV detection

Use test kit of the present invention to HBV(hepatitis B), HCV(hepatitis C) serum of patient detects, thus enters one The specificity of step kits for evaluation, testing result is shown in Table 5.

The cross reaction testing result of the anti-positive serum such as table 5 HBV, HCV

Find out from testing result: this test kit occurs with the equal no cross reaction of above-mentioned patients serum.

2.2.3 compare with the like product of commercialization

The positive of commercial kit of learning from else's experience detection and negative serum sample 30 example, use this test kit to detect, statistics inspection Surveying result, calculate the sensitivity of test kit, specificity, false positive rate, false negative rate and detection coincidence rate etc., experimental result is shown in Table 6.

Table 6-1 and the comparison test result of Jian Lun bio tech ltd, Guangzhou test kit

Verity and predictive value's computational analysis

Computational methods	Result of calculation
		Sensitivity=A/ (A+C) * 100 %	95.9 %
Specificity=D/ (B+D) * 100 %	99 %
		False positive rate=B/ (B+D) * 100 %	1 %
False negative rate=C/ (A+C) * 100 %	4.1 %
		Slightly-cause=(A+D)/(A+B+C+D) * 100 %	97.4 %
Youden index=(A/ (A+C)+D/ (B+D))-1	0.949
		Predictive value=A/ (A+B) * 100 % of positive test	99.1 %
Predictive value=D/ (C+D) * 100 % of negative test	95.7 %
		Adjust concordance=1/4 (A/ (A+B)+A/ (A+C)+D/ (C+D)+D/ (B+D)) * 100 %	97.4 %

From form it can be seen that the detection of test kit of the present invention and Jian Lun bio tech ltd, reference product Guangzhou test kit accords with Conjunction rate is 97.4 %.

Table 6-2 and the comparison test result of Aikang Biotechnology's test kit

Verity and predictive value's computational analysis

Computational methods	Result of calculation
		Sensitivity=A/ (A+C) * 100 %	94.5 %
Specificity=D/ (B+D) * 100 %	97 %
		False positive rate=B/ (B+D) * 100 %	3 %
False negative rate=C/ (A+C) * 100 %	5.5 %
		Slightly-cause=(A+D)/(A+B+C+D) * 100 %	95.7 %
Youden index=(A/ (A+C)+D/ (B+D))-1	0.915
		Predictive value=A/ (A+B) * 100 % of positive test	97.2 %
Predictive value=D/ (C+D) * 100 % of negative test	94.2 %
		Adjust concordance=1/4 (A/ (A+B)+A/ (A+C)+D/ (C+D)+D/ (B+D)) * 100 %	95.7 %

From form it can be seen that the detection of test kit of the present invention and reference product Aikang Biotechnology (Hangzhou) Co., Ltd. test kit Coincidence rate is 95.7 %.

Table 6-3 and the comparison test result of Shanghai Upper Bio-tech Pharma Co., Ltd.'s test kit

Verity and predictive value's computational analysis

Computational methods	Result of calculation
		Sensitivity=A/ (A+C) * 100 %	93.2 %
Specificity=D/ (B+D) * 100 %	96 %
		False positive rate=B/ (B+D) * 100 %	4 %
False negative rate=C/ (A+C) * 100 %	6.8 %
		Slightly-cause=(A+D)/(A+B+C+D) * 100 %	94.5 %
Youden index=(A/ (A+C)+D/ (B+D))-1	0.892
		Predictive value=A/ (A+B) * 100 % of positive test	96.2 %
Predictive value=D/ (C+D) * 100 % of negative test	92.8 %
		Adjust concordance=1/4 (A/ (A+B)+A/ (A+C)+D/ (C+D)+D/ (B+D)) * 100 %	94.6 %

From form it can be seen that the detection of test kit of the present invention and reference product Shanghai Upper Bio-tech Pharma Co., Ltd. test kit accords with Conjunction rate is 94.6 %.

SEQUENCE LISTING

<110>Shenyang all creation bio tech ltd

<120>structure of tubercule bacillus 16kD-38kD-19kD tri-fusion protein and qualification

<130> 2015

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 2109

<212> DNA

<213> Mycobacterium tuberculosis

<400> 1

atgaacaatc tcgcattgtg gtcgcgtccg gtgtgggacg ttgagccctg ggaccgctgg 60

ctacgtgact tcttcggccc tgccgcgacg acggactggt accgcccggt cgccggagac 120

ttcacgccgg ccgccgagat cgtcaaggat ggcgacgacg cggtggtccg tttggaactg 180

cccggcattg acgtcgacaa ggacgtcaac gtcgagcttg accctggcca gccggtgagc 240

cgcctggtga tccgcggcga acaccgcgac gagcacacgc aagacgccgg agacaaagac 300

ggccgcaccc tgcgtgagat ccgctacgga tcattccgcc gctcgttccg gctgcccgcg 360

cacgtcacca gcgaggccat cgcggcttcc tatgacgccg gtgtgctgac cgtccgggtt 420

gccggcgcct acaaggcccc agccgaaact caggcgcagc gcatcgccat cacgaagggt 480

ggcggaggat ccgtgaaaat tcgtttgcat acgctgttgg ccgtgttgac cgctgcgccg 540

ctgctgctag cagcggcggg ctgtggctcg aaaccaccga gcggttcgcc tgaaacgggc 600

gccggcgccg gtactgtcgc gactaccccc gcgtcgtcgc cggtgacgtt ggcggagacc 660

ggtagcacgc tgctctaccc gctgttcaac ctgtggggtc cggcctttca cgagaggtat 720

ccgaacgtca cgatcaccgc tcagggcacc ggttctggtg ccgggatcgc gcaggccgcc 780

gccgggacgg tcaacattgg ggcctccgac gcctatctgt cggaaggtga tatggccgcg 840

cacaaggggc tgatgaacat cgcgctagcc atctccgctc agcaggtcaa ctacaacctg 900

cccggagtga gcgagcacct caagctgaac ggaaaagtcc tggcggccat gtaccagggc 960

accatcaaaa cctgggacga cccgcagatc gctgcgctca accccggcgt gaacctgccc 1020

ggcaccgcgg tagttccgct gcaccgctcc gacgggtccg gtgacacctt cttgttcacc 1080

cagtacctgt ccaagcaaga tcccgagggc tggggcaagt cgcccggctt cggcaccacc 1140

gtcgacttcc cggcggtgcc gggtgcgctg ggtgagaacg gcaacggcgg catggtgacc 1200

ggttgcgccg agacaccggg ctgcgtggcc tatatcggca tcagcttcct cgaccaggcc 1260

agtcaacggg gactcggcga ggcccaacta ggcaatagct ctggcaattt cttgttgccc 1320

gacgcgcaaa gcattcaggc cgcggcggct ggcttcgcat cgaaaacccc ggcgaaccag 1380

gcgatttcga tgatcgacgg gcccgccccg gacggctacc cgatcatcaa ctacgagtac 1440

gccatcgtca acaaccggca aaaggacgcc gccaccgcgc agaccttgca ggcatttctg 1500

cactgggcga tcaccgacgg caacaaggcc tcgttcctcg accaggttca tttccagccg 1560

ctgccgcccg cggtggtgaa gttgtctgac gcgttgatcg cgacgatttc cagcggaggt 1620

ggcggtagtg tgaagcgtgg actgacggtc gcggtagccg gagccgccat tctggtcgca 1680

ggtctttccg gatgttcaag caacaagtcg actacaggaa gcggtgagac cacgaccgcg 1740

gcaggcacga cggcaagccc cggcgccgcc tccgggccga aggtcgtcat cgacggtaag 1800

gaccagaacg tcaccggctc cgtggtgtgc acaaccgcgg ccggcaatgt caacatcgcg 1860

atcggcgggg cggcgaccgg cattgccgcc gtgctcaccg acggcaaccc tccggaggtg 1920

aagtccgttg ggctcggtaa cgtcaacggc gtcacgctgg gatacacgtc gggcaccgga 1980

cagggtaacg cctcggcaac caaggacggc agccactaca agatcactgg gaccgctacc 2040

ggggtcgaca tggccaaccc gatgtcaccg gtgaacaagt cgttcgaaat cgaggtgacc 2100

tgttcctaa 2109

<210> 2

<211> 702

<212> PRT

<213>mycobacterium tuberculosis (Mycobacterium tuberculosis)

<400> 2

Met Asn Asn Leu Ala Leu Trp Ser Arg Pro Val Trp Asp Val Glu Pro

1 5 10 15

Trp Asp Arg Trp Leu Arg Asp Phe Phe Gly Pro Ala Ala Thr Thr Asp

20 25 30

Trp Tyr Arg Pro Val Ala Gly Asp Phe Thr Pro Ala Ala Glu Ile Val

35 40 45

Lys Asp Gly Asp Asp Ala Val Val Arg Leu Glu Leu Pro Gly Ile Asp

50 55 60

Val Asp Lys Asp Val Asn Val Glu Leu Asp Pro Gly Gln Pro Val Ser

65 70 75 80

Arg Leu Val Ile Arg Gly Glu His Arg Asp Glu His Thr Gln Asp Ala

85 90 95

Gly Asp Lys Asp Gly Arg Thr Leu Arg Glu Ile Arg Tyr Gly Ser Phe

100 105 110

Arg Arg Ser Phe Arg Leu Pro Ala His Val Thr Ser Glu Ala Ile Ala

115 120 125

Ala Ser Tyr Asp Ala Gly Val Leu Thr Val Arg Val Ala Gly Ala Tyr

130 135 140

Lys Ala Pro Ala Glu Thr Gln Ala Gln Arg Ile Ala Ile Thr Lys Gly

145 150 155 160

Gly Gly Gly Ser Val Lys Ile Arg Leu His Thr Leu Leu Ala Val Leu

165 170 175

Thr Ala Ala Pro Leu Leu Leu Ala Ala Ala Gly Cys Gly Ser Lys Pro

180 185 190

Pro Ser Gly Ser Pro Glu Thr Gly Ala Gly Ala Gly Thr Val Ala Thr

195 200 205

Thr Pro Ala Ser Ser Pro Val Thr Leu Ala Glu Thr Gly Ser Thr Leu

210 215 220

Leu Tyr Pro Leu Phe Asn Leu Trp Gly Pro Ala Phe His Glu Arg Tyr

225 230 235 240

Pro Asn Val Thr Ile Thr Ala Gln Gly Thr Gly Ser Gly Ala Gly Ile

245 250 255

Ala Gln Ala Ala Ala Gly Thr Val Asn Ile Gly Ala Ser Asp Ala Tyr

260 265 270

Leu Ser Glu Gly Asp Met Ala Ala His Lys Gly Leu Met Asn Ile Ala

275 280 285

Leu Ala Ile Ser Ala Gln Gln Val Asn Tyr Asn Leu Pro Gly Val Ser

290 295 300

Glu His Leu Lys Leu Asn Gly Lys Val Leu Ala Ala Met Tyr Gln Gly

305 310 315 320

Thr Ile Lys Thr Trp Asp Asp Pro Gln Ile Ala Ala Leu Asn Pro Gly

325 330 335

Val Asn Leu Pro Gly Thr Ala Val Val Pro Leu His Arg Ser Asp Gly

340 345 350

Ser Gly Asp Thr Phe Leu Phe Thr Gln Tyr Leu Ser Lys Gln Asp Pro

355 360 365

Glu Gly Trp Gly Lys Ser Pro Gly Phe Gly Thr Thr Val Asp Phe Pro

370 375 380

Ala Val Pro Gly Ala Leu Gly Glu Asn Gly Asn Gly Gly Met Val Thr

385 390 395 400

Gly Cys Ala Glu Thr Pro Gly Cys Val Ala Tyr Ile Gly Ile Ser Phe

405 410 415

Leu Asp Gln Ala Ser Gln Arg Gly Leu Gly Glu Ala Gln Leu Gly Asn

420 425 430

Ser Ser Gly Asn Phe Leu Leu Pro Asp Ala Gln Ser Ile Gln Ala Ala

435 440 445

Ala Ala Gly Phe Ala Ser Lys Thr Pro Ala Asn Gln Ala Ile Ser Met

450 455 460

Ile Asp Gly Pro Ala Pro Asp Gly Tyr Pro Ile Ile Asn Tyr Glu Tyr

465 470 475 480

Ala Ile Val Asn Asn Arg Gln Lys Asp Ala Ala Thr Ala Gln Thr Leu

485 490 495

Gln Ala Phe Leu His Trp Ala Ile Thr Asp Gly Asn Lys Ala Ser Phe

500 505 510

Leu Asp Gln Val His Phe Gln Pro Leu Pro Pro Ala Val Val Lys Leu

515 520 525

Ser Asp Ala Leu Ile Ala Thr Ile Ser Ser Gly Gly Gly Gly Ser Val

530 535 540

Lys Arg Gly Leu Thr Val Ala Val Ala Gly Ala Ala Ile Leu Val Ala

545 550 555 560

Gly Leu Ser Gly Cys Ser Ser Asn Lys Ser Thr Thr Gly Ser Gly Glu

565 570 575

Thr Thr Thr Ala Ala Gly Thr Thr Ala Ser Pro Gly Ala Ala Ser Gly

580 585 590

Pro Lys Val Val Ile Asp Gly Lys Asp Gln Asn Val Thr Gly Ser Val

595 600 605

Val Cys Thr Thr Ala Ala Gly Asn Val Asn Ile Ala Ile Gly Gly Ala

610 615 620

Ala Thr Gly Ile Ala Ala Val Leu Thr Asp Gly Asn Pro Pro Glu Val

625 630 635 640

Lys Ser Val Gly Leu Gly Asn Val Asn Gly Val Thr Leu Gly Tyr Thr

645 650 655

Ser Gly Thr Gly Gln Gly Asn Ala Ser Ala Thr Lys Asp Gly Ser His

660 665 670

Tyr Lys Ile Thr Gly Thr Ala Thr Gly Val Asp Met Ala Asn Pro Met

675 680 685

Ser Pro Val Asn Lys Ser Phe Glu Ile Glu Val Thr Cys Ser

690 695 700

Claims (6)

1. encoding a fusion gene of mycobacterium tuberculosis three recombination fusion protein 16kD-38kD-19kD, its feature exists In: its nucleotide sequence is as shown in SEQ ID NO:1.

2. a mycobacterium tuberculosis three recombination fusion protein 16kD-38kD-19kD, it is characterised in that: it is to be wanted by right Asking the fusion gene in 1 to encode, its aminoacid sequence is as shown in SEQ ID NO:2.

3. the expression vector of mycobacterium tuberculosis three recombination fusion protein, it is characterised in that: it is by claim 1 In fusion gene be connected on pET28a carrier according to the building mode shown in Fig. 1, its aminoacid sequence such as SEQ ID NO:2 Shown in.

4. a DNA-hydrogel acellular albumen expression system, it is characterised in that: it is to be moved back by four oligonucleotide sequences The X-DNA that fire is combined into is the hydrogel structure of skeleton, and after its synthesis, the result is as shown in Figure 3.

5. an antigen of mycobacterium tuberculosis speckle gold immunity quick detection kit, containing diafiltration determinator, point sample film, Label and eluent, it is characterised in that: described point sample film is to have selected antigen of mycobacterium tuberculosis (three restructuring fusion eggs Nitrocellulose filter in vain)；Described label is colloid gold label staphylococcal protein A conjugate；Described eluent is The 0.01 M TBS buffer of pH 7.4；The connection antibody in serum is used to put up a bridge between antigen and label.

Antigen of mycobacterium tuberculosis speckle gold immunity quick detection kit the most according to claim 5, its feature exists In: antigen coated concentration makees 1:2 dilution, and colloid gold label staphylococcal protein A working concentration makees 1:2 dilution, Quality Control point goat-anti Mus IgG is coated concentration and makees 1:16 dilution, and the sealing condition of reaction film is 4 DEG C and overnight closes, and the drying condition of reaction film is in phase It is that the environment of 30 %-40 % is dried 60 min to humidity.