CN106047909A - Construction and identification of Mycobacterium tuberculosis 16kD-CFP10-19kD fusion protein - Google Patents

Abstract

The invention provides a Mycobacterium tuberculosis triple recombinant fusion protein 16kD-CFP10-19kD and application of the same to clinical diagnosis of pulmonary tuberculosis. According to the invention, three strong antigen epitopes of Mycobacterium tuberculosis are selected; the Mycobacterium tuberculosis triple recombinant fusion protein is constructed by using a PCR method with H37RV as a template; the fusion protein is expressed by using a DNA-hydrogel acellular in-vitro protein expression system; obtained recombinant protein is purified by using metal chelate affinity chromatographic techniques; and then a novel serological detection kit for Mycobacterium tuberculosis is prepared by using dot-immunogold filtration assay with the purified protein as an antigen. Compared with kits of a same kind in the market, the kit prepared in the invention has the advantages of high specificity, high sensitivity and the like and provides a more reliable tool for screening and diagnosis of tuberculosis; and the fusion protein is also applicable to preparation of a protein chip, a vaccine, a monoclonal antibody, a polyclonal antibody, etc.

Description

Tubercule bacillus 16kD-CFP10-19kD fusion protein construction and qualification

Technical field

The present invention relates to genetic engineering field, be specifically related to the structure of a kind of mycobacterium tuberculosis three recombination fusion protein Build, identify, expression and purification and application thereof.

Background technology

Tuberculosis is the chronic infectious disease caused by mycobacterium tuberculosis (Mycobacterituberculosis, TB), Serious harm human health.There are about 1/3 population in the world and catch tuberculosis, annual new cases about more than 900 ten thousand, death toll reaches 2000000, it can be seen that, whole world tuberculosis is the most prevailing, has become as the serious public health in the whole world and social problem.Research table Bright, by the crowd of tubercle bacillus affection, the people of 10 % can develop into tuberculosis.If not taking effective control measure, not 10 years come, China may have the infected of nearly 50,000,000 that tuberculosis occurs.Early discovery in time treatment are prevention and control knots The important process that core is sick, but current diagnosis lungy still relies on clinical data, bacteriological detection and Sputum smears microscopy, Although existing diagnostic method is the goldstandard of TB diagnosis, but also there is many deficiencies, as low in smear method positive rate, and cultivate Time is longer, is not suitable for the outer tuberculosis of lung, the diagnosis of children's's combination, far from meeting clinical demand.Additionally, due to pulmonary tuberculosis is early Phase modal symptom is cough and expectoration, easily makes patient and doctor be mistaken for flu or tracheitis and cause mistaken diagnosis, from And it is delayed best occasion for the treatment.As can be seen here, developing new diagnosis of tuberculosis instrument quick, simple, convenient, that sensitivity is high is The active tuberculosis day by day increased in the urgent need to.

With the fast development of TB diagnostic techniques, Serologic detection is succinct with it, quickly, economical, accurately, high specificity and Receive much concern, can be used for crowd's screening.But owing to antigen of mycobacterium tuberculosis is many and complicated, in host express quantity, Kind or opportunity may have any different with the individual immunity background of patient and the course of disease, thus show different antibody repertoires, only use The tuberculosis serological diagnosis sensitivity of single antigen is inadequate.Therefore, use the means of multiple antigen combined detection, ensure spy Contribute on the basis of the opposite sex improving the shortcoming that sensitivity is low.16kD antigen is primarily present on the cell membrane of tubercule bacillus, has Research shows, MPT63 can be detected from lunger's serum of 85 %；The encoding gene of CFP10 is positioned at RD1 district, It is important T cell antigen, there is good immunogenicity, it is possible to induction body produces specific immune response, is tuberculosis Diagnosis and the study hotspot of prevention；19kD is a kind of lipoprotein on bacillus tubercle cell wall, and it has proven to have exempts from Epidemic focus antigen, can be identified by the antibody in TB patients serum, be widely studied, Lyashchenko all the time Deng research show, 19kD can increase the sensitivity of detection as diagnostic antigen tuberculosis.

The most less about the report of 19kD fusion protein, therefore this research is being tied with 16kD, CFP10,19kD Advantage in terms of core disease Serologic detection, utilizes technique for gene engineering to construct 16kD-CFP10-19kD tri-fusion protein, with Time combine dot immuno gold filtration assay technology and be prepared for Serologic detection test kit, it is desirable to the diagnosis for tuberculosis infection provides more For special, instrument accurately.

Summary of the invention

(1) to solve the technical problem that

The present invention seeks to build mycobacterium tuberculosis 16kD-CFP10-19kD tri-recombination fusion protein, utilize speckle gold to exempt from Epidemic disease diafiltration techniques (DIGFA) produces the novel mycobacterium tuberculosis Serologic detection test kit that specificity is high, false positive is low, for knot Core disease provides a kind of methods for clinical diagnosis reliably, easily and fast.

(2) technical scheme

The present invention obtains tubercule bacillus H according to ncbi database retrieval₃₇Rv reference culture 16kD, CFP10 and 38kD gene sequence Row, design synthetic primer, after PCR, TA clone, and enzyme action purification 3 fragment gene fragment, recombinate successively with pET28a carrier, First build pET28a-16kD recombiant plasmid, continue enzyme action on the basis of identifying successfully and be connected with CFP10 fragment, after identifying successfully, Enzyme action is connected with 19kD fragment further, and enzyme action is identified, the final acquisition recombinant expressed load of pET-28a-16kD-CFP10-19kD Body, order-checking identifies that 16kD-CFP10-19kD restructuring fusion sequence is recombinated successfully.

Present invention application DNA-hydrogel cell free in vitro protein expression system expresses recombination fusion protein.First X-is synthesized DNA, applicationApa IEnzyme action carries out linearisation to fusion protein plasmid, with nuclease free water, T4 DNA ligase, T4 DNA even Connect the composition DNA gel reaction mixtures such as enzyme buffer liquid；It is then based on magnetic agitation mode and prepares DNA gel microparticle, and right It is purified and identifies；Last according to RTS 100E.coliTest kit prepares the acellular reactant liquor of commercialization, determines without thin Optimal incubation time, X-DNA and the optimum concentration of gene masterplate of born of the same parents' reaction.The final one that obtains expresses mycobacterium tuberculosis The DNA-hydrogel acellular albumen expression system of 16kD-CFP10-19kD tri-recombination fusion protein.

Applied metal of the present invention chelating affinity chromatography medium technology (metal chelate chromatography) purification The recombination fusion protein obtained in above-mentioned steps, carries out determined amino acid sequence, applies BCA simultaneously fusion protein after purification Method measures fusion protein concentration, and application ELISA method measures fusion protein activity.The final acquisition purity tuberculosis branch more than 96 % Bacillus 16kD-CFP10-19kD tri-fusion protein.

The high-purity recombination fusion protein of above-mentioned acquisition is coated on nitrocellulose filter by the present invention, uses colloid gold label Staphylococcal protein A (SPA), then assembles percolating device, sets up and optimizes dot immuno gold filtration assay detection system, finally obtaining Novel mycobacterium tuberculosis serological diagnostic kit based on dot immuno gold filtration assay technology.Clinical serum pattern detection is tested Showing, the sensitivity of this test kit is 95.2 %, and false positive is 2.8 %.

(3) effective benefit

Diagnostic kit prepared by the mycobacterium tuberculosis 16kD-CFP10-19kD recombination fusion protein using the present invention to provide, Compared with the similar test kit on market, there is high specificity, sensitivity advantages of higher, better met mycobacterium tuberculosis Infect the needs of clinical diagnosis.

Accompanying drawing explanation

Fig. 1 is the structure flow chart of expression vector pET-16kD-CFP10-19kD.

Fig. 2 is the restriction enzyme digestion and electrophoresis figure of expression vector pET-16kD-CFP10-19kD, A: single-gene enzyme action point electrophoretogram, 1: Marker, 2:16kD, 3:CFP10,4:19kD；B: fusion gene restriction enzyme digestion and electrophoresis figure, 1:Marker, 2: the restructuring matter before enzyme action Grain, 3:16kD, 4:16kD+CFP10,5:16kD+CFP10+19kD.

Fig. 3 is 4 oligonucleotide sequences and inspection electrophoretogram, 1:X1,2:X1+X2,3:X1+X2+X3, the 4:X1+ of X-DNA X2+X3+X4。

Fig. 4 is the metal chelate chromatography affinity purification gel electrophoresis figure of DNA-hydrogel protein expression system expressing protein, 1:Marker, 2: before purification, 3: after purification.

Detailed description of the invention

1.1 gene fusion

Analyze TB H37Rv genom sequence by computer, select its strong antigen epi-position 16kD(GENEBANK locus: NP_214765), CFP10 albumen (GENEBANK locus:NP_218391) and 19kD(GENEBANK locus:CP007027) DNA sequence be template, design amplimer be:

16kD amplimer:

16-CFP10-19a:GGAAGGCATATGAACAATCTCGCATTGTGGTCGC

16-CFP10-19b:TTATTAGGATCCTCCGCCACCCTTCGTGATGGCGATG

CFP10 amplimer:

16-CFP10-19c:GGCCGCGGATCCATGGCAGAGATGAAGAC

16-CFP10-19d:CGGCGGGAATTCGAAGCCCATTTGCGA

19kD amplimer:

16-CFP10-19e:AATAGAATTCGGAGGTGGCGGTAGTGTGAAGCGTGGACT GA

16-CFP10-19f:GTCCGGAAGCTTTTAGGAACAGGTCACCTCGATTTCG

50 ml amplification system: ddH₂O 31.5 ml, 10 × buffer 5.0 ml, 4 × dNTP 4.0 ml, upstream and downstream primer Mixed liquid 4.0 ml, DNA 1.5 ml, Taqplus 0.2 ml(1U).

Take Mycobacterium tuberculosis H₃₇R_VThalline, add 100 ml E.C. 3.4.21.64s (10 mg/ml), put 56 DEG C of water-baths digestion 4 H, purifies by conventional phenol/chloroform method, carries out PCR amplification with above-mentioned primer.Wherein, 16kD forward primer increasesNdeI enzyme action position Point, downstream increasesBamHI restriction enzyme site；CFP10 forward primer increasesBamHI restriction enzyme site, downstream increasesEcoRI enzyme action position Point；19kD forward primer increasesEcoRI restriction enzyme site, downstream increasesHind III restriction enzyme site.

Being modified by cloned sequence, product cuts after purification through agarose gel electrophoresis, will press containing the blob of viscose of DNA band DNA fast purifying test kit (purchased from green skies company, name of product:PCR/DNA purification kit) description operates, return Receive DNA.Plasmid DNA and 16kD, CFP10,19kD fragment all through inscribe enzyme action, 50 ml system: 10 × buffer 5.0 ml, DNA 12 ml,Hind III HeNdeEach 15 U of I, ddH₂O mends to 50 ml；37 DEG C of water-bath 6 h.50 ml digestion products are through fine jade Sepharose is separated by electrophoresis, cutting DNA band agar block, utilizes DNA fast purifying test kit to reclaim DNA.

16kD, CFP10 and 19kD genetic fragment is cloned into pET28a plasmid successively (haveHindIII HeNdeI enzyme action Site, purchased from Dalian treasured biological engineering company limited), first build pET28a-16kD recombiant plasmid, on the basis of identifying successfully Continuing enzyme action to be connected with CFP10 fragment, after identifying successfully, further enzyme action is connected with 19kD fragment, and enzyme action is identified.20 ml are even Junctor system: ddH₂O 15.0 ml, 10 × buffer 2.0 ml, pET28a 2.0 ml, genetic fragment 1.0 ml, T4 DNA even Meet enzyme 20 U.Plasmid self connects comparison, 20 ml coupled reaction system: ddH₂O 16.0 ml, 10 × buffer 2.0 ml, PET28a 2.0 ml, T4 DNA ligase 20 U.After above-mentioned sample-adding, mixing, the most centrifugal, 14 DEG C-16 DEG C connect overnight. Transformed E .coli is coated with flat board (containing the LB solid medium of 15 mcg/ml kanamycin) and chooses clone's upgrading grain order-checking, really The clone that fixed sequence is correct.The enzyme action of recombiant plasmid (Nde Ⅰ/HindIII) electrophoretogram is as shown in Figure 2.

1.2 product order-checkings

Employing T7 promoter:5-' TAATACGACTCACTATAGGG-3 ' and T7 terminator:5 '- GCTAGTTATTGCTCAGCGG-3 ' universal primer.All amplimers and the synthesis of sequencing primer and recombiant plasmid sequence The mensuration of pET28a-16kD-CFP10-19kD is all provided service by Sheng Gong biological engineering company limited.Record purpose fusion gene Nucleotide sequence as shown in SEQ ID NO:1.

The expression and purification of 1.3 destination proteins

1.3.1 the preparation of X-DNA

X-DNA is formed through a special cycle of annealing by the DNA molecular of 40 bp length of four end reverse complementals.For The oligonucleotide sequence of synthesis X-DNA is:

X1:5'-p-CGACCGATGAATAGCGGTCAGATCCGTACCTACTCGGGCC-3'

X2:5'-p-CGAGTAGGTACGGATCTGCGTATTGCGAACGACTCGGGCC-3'

X3:5'-p-CGAGTCGTTCGCAATACGGCTGTACGTATGGTCTCGGGCC-3'

X4:5'-p-CGAGACCATACGTACAGCACCGCTATTCATCGGTCGGGCC-3'

Four oligonucleotide molecules mixed in equal amounts according to sequent synthesis (are controlled the final concentration of of every oligonucleotide molecules 0.2 mM) it is placed in PCR instrument.Annealing system: 95 DEG C of degeneration 2 min, 65 DEG C keep 2 min, and 60 DEG C keep 5.5 min, Every 30 s, temperature is turned down 1 DEG C afterwards, be down to 20 DEG C the most continuously.The nucleic acid electrophoresis figure of X-DNA is as shown in Figure 3.

1.3.2 the preparation of DNA hydrogel microparticle

UseApaThe recombiant plasmid (pET28a-16kD-CFP10-19kD) of correct for checking clone is carried out linearisation by I enzyme, with For carrying out the connection of X-DNA.

By Span 80 with 80 two kinds of surfactants of Tween respectively with 4.5 %(wt/wt) and 0.5 %(wt/wt) Ratio is added in mineral oil, mixing of fully vibrating.Take out 1 ml after ice bath and be placed in glass cuvette, add 3 mm × 8 mm The magnetic stir bar of specification, and control to be 3000 rpm(maximum (top) speeds by rotating speed).To prepare on ice bath rapidly after stable 10 μ l DNA gel reaction mixtures add with the volume ratio of 1:100, continue stirring 1 min, make DNA gel reactant liquor (water Phase) it is evenly dispersed in mineral oil (oil phase), form water-in-oil emulsion.The surfactant added in oil phase can be effectively The droplet preventing the DNA gel reactant liquor being dispersed in oil phase regroups, and serves the effect of stable emulsion.By equal for dispersion Even emulsion is positioned over 16 DEG C of overnight incubation, and the droplet being dispersed in oil phase crosslinks reaction, forms uniform solid and coagulates Glue microparticle.

10 μ l DNA gel reaction mixture systems: X-DNA stock solution 3.5 μ l, linear plasmid template 2 μ l, Nuclease-free water 3 μ l, 10 × T4 ligase buffer 1 μ l, T4 ligase(5 U/ μ l) 0.5 μ l。

1.3.3 the collection of DNA-hydrogel microparticle, purification

Take the DNA-hydrogel sample being dispersed in oil phase synthesis, with the surfactant of mineral oil extraction residual, with normal hexane Dissolve remaining mineral oil.After fume hood is dried 15 min, deionized water cleans, and removes the normal hexane of residual.

1.3.4 DNA-hydrogel acellular albumen expression system is used to carry out expressing fusion protein

Use commercialization acellular reactant liquor test kit (purchased from Roche company, name of product: RTS 100E.coli HY Kit) the acellular expression of fusion protein is carried out.The DNA-hydrogel of 10 μ l volumes is added in acellular reactant liquor, reactant Tie up to 24 DEG C, 900 rpm vibrations in Proteomaster.Different time in acellular reaction takes the albumen of synthesis and examines Survey, screen the optimal incubation time of optimal acellular reaction.

1.3.5 destination protein purification

The albumen Ni post (GE company) collected is purified, uses following eluant solution: 300 mM imidazoles, 50 mM Tris- HCl, 500 mM NaCl.16kD, CFP10 and 19kD track fusion albumen totally 428 aminoacid, aminoacid sequence such as SEQ Shown in ID NO 2.

1.4 fusion protein are identified

1.4.1 purity testing

Through SDS-PAGE electrophoresis detection (albumen applied sample amount is 7.2 μ g), for single zone, thin slice scan identifies that purity is 97.9 %, testing result is shown in accompanying drawing 4.

1.4.2 concentration measures

Measuring through BCA method, using bovine serum albumin as standard reference product, fusion protein concentration is 6.28 mg/ml.

1.4.3 determination of activity

It is antigen coated in ELISA Plate with the fusion protein of purification, package amount 2 μ g/ hole, use and make a definite diagnosis lunger and be good for OD value at the determination of serum 492 nm wavelength of health person.Result is as follows:

Example 2: the preparation of mycobacterium tuberculosis antibody IgG diagnostic kit (dot immuno gold filtration assay method) and performance detecting

2.1 test kit composition and preparations

Test kit of the present invention, will using the mycobacterium tuberculosis 16kD-CFP10-19kD recombination fusion protein of purification as TB antigen It is coated on nitrocellulose filter, and as test point, this antigen can capture the IgG tuberculosis antibody in serum specimen, captured Tuberculosis antibody can combine with staphylococcal protein A (SPA) colloidal gold conjugate and present punctation.Nothing in the middle of reacting hole Punctation, represents that in blood serum sample, tuberculosis antibody is negative, and redness should occur in Quality Control point.

It is immunity percolation device that test kit mainly comprises composition, mainly by plastic caddy, water suction bedding and padding and celluloid Diaphragm three part forms, and nitrocellulose filter comprises detection zone and quality control region.

2.1.1 test point is coated recombination fusion protein 16kD-CFP10-19kD, is coated concentration and does not dilutes.

2.1.2 Quality Control point is coated sheep anti-mouse igg, is coated concentration and makees 1:16 dilution.

2.1.3 immunity percolation reaction system optimization

(1) determination of reaction film optimum drying condition

Relative humidity gradient 20 %, 30 %, 40 % are set, drying time 30 min, 40 min, 50 min, 60 min, 70 Min, baking temperature is 37 DEG C, uses positive serum to detect, determines optimum drying humidity and drying time.

Table 1 reaction film drying condition choice experiment result

-: negative reaction ,+: positive reaction, ++: relatively strong positive reaction, +++: strong positive reaction

As can be seen from Table 1: under the conditions of relative humidity is 20 %, the short time is dried the poor stability that can cause reagent, time long Between be dried and can affect again the accuracy of testing result；And relative humidity be 30 %, under the conditions of 40 %, drying time is 40 When min, 50 min, 60 min and 70 min, the sensitivity of reagent and stability are all preferable, and testing result is relatively.Examine Consider the ease for operation to experimentation, therefore select under conditions of relative humidity is 30 %-40 %, be dried reaction film 60 min。

(2) optimal antigen coated concentration and the determination of the suitableeest sheep anti-mouse igg working concentration

Envelope antigen is diluted to 1:1,1:2,1:4,1:8 totally four Concentraton gradient, sheep anti-mouse igg is diluted to 1:4,1:8,1: 16, tetra-Concentraton gradient of 1:32, positive reference serum to be measured is diluted to 1:1,1:2,1:4,1:6,1:8,1:10 totally six dense Degree gradient, with envelope antigen concentration, sheep anti-mouse igg concentration as variable, coordinates undiluted gold labelling SPA respectively to six gradients To be measured positive reference serum carry out Checkerboard titration experiment, analyze experimental result, determine the suitableeest antigen coated concentration and sheep anti mouse IgG concentration.

The optimal antigen coated concentration of table 2 and sheep anti-mouse igg working concentration choice experiment result

+: positive, +/-: the weak positive ,-: negative

Being determined that antigen is not coated as dilution by table 2, sheep anti-mouse igg uses as working concentration after making 1:16 dilution.

(3) the suitableeest gold mark SPA concentration determines

Gold is marked SPA and is diluted to five Concentraton gradient of 1:1,1:2,1:4,1:8,1:10, with it as variable, in conjunction with fixed Suitable antigen coated concentration and optimal sheep anti-mouse igg working concentration, carry out chess to the to be measured positive reference serum of six gradients respectively Dish titration experiments, analyzes experimental result, determines the suitableeest gold mark dilution factor.

Table 3 the suitableeest gold mark SPA concentration choice experiment result

+: positive, +/-: the weak positive ,-: negative

As can be seen from Table 3: gold mark SPA is not diluted to the suitableeest working concentration.

(4) reaction film most preferably closes way choice

Sheep anti-mouse igg point sample is central as test point in nitrocellulose filter, and point four kinds of different modes are carried out after closing Immunity percolation is tested, and observes the different closing mode impact on reaction effect.

1. it is placed at room temperature on circumferential oscillation shaking table with the 0.01 M TBST containing 1 % BSA and closes 4 h；

2. it is placed at room temperature on circumferential oscillation shaking table with the 0.01 M TBST containing 5% defatted milk powder and closes 4 h；

3. overnight close under the conditions of 4 DEG C with the 0.01 M TBST containing 1 % BSA；

4. overnight close under the conditions of 4 DEG C with the 0.01 M TBST containing 5 % defatted milk powder；

5. at 37 DEG C, 45 min are closed with the 0.01 M TBST containing 1 % BSA；

6. at 37 DEG C, 45 min are closed with the 0.01 M TBST containing 5 % defatted milk powder.

Draw according to experimental result: 6 groups of test points all develop the color and effectively can distinguish with background, but relative to other group Not, 4. in group, not only background is low, and colour developing is more uniform.Therefore select the 0.01 M TBST containing 5 % defatted milk powder as closing Liquid, sealing condition is overnight to close at 4 DEG C.

2.1.4 the manufacture of test kit

(1) being coated of antigen

Take antigen protein (not diluting) point sample of 1 μ l in 1 × 1 cm²The position to the left, nitrocellulose filter center of size is made For test point, take sheep anti-mouse igg (1:16 dilution) point sample of 1 μ l in position to the right, nitrocellulose filter center as Quality Control point, 60 min it are dried under conditions of 30 %-40 %.

(2) close

Antigenic membrane after point sample is dipped in the 0.01 M TBST confining liquid containing 5 % defatted milk powder, stood under the conditions of 4 DEG C Night is closed.

(3) film is washed

Discard confining liquid, quickly wash film once with ultra-pure water, then film is dipped in 0.01 M TBS solution, transfers to circumference and shake On bed, film 5 min is washed in 120 rpm concussions, naturally dries after taking-up.

(4) percolating device is assembled

Being placed in by absorbent material in immunity percolation card, the superiors cover filter paper, are transferred to by antigenic membrane on filter paper, compress diafiltration card Lid, makes diafiltration hole clipping alignment antigenic membrane central, completes the assembling of immunity percolation device.Finished product test kit includes Sptting plate, closing Liquid, cleaning mixture, gold mark liquid, positive control and negative control.

2.1.5 operational approach and result judge

(1) operational approach

1. in the middle of the reacting hole of detection plate, add 1 confining liquid, treat that thin film sucks；

2. take 10 μ l serum samples, add in the middle of reacting hole, treat that thin film sucks；

3. in the middle of reacting hole, add 6 cleaning mixture, treat that thin film sucks；

4. in the middle of reacting hole, add 1 gold mark liquid, treat that thin film sucks；

5. in the middle of reacting hole, add 6 cleaning mixture, treat that thin film sucks, visual observation.

(2) result judges

The positive-Quality Control point display redness, has punctation to occur in the middle of reacting hole；

Feminine gender-Quality Control point display redness, reacting hole middle redfree speckle appearance or only vestige.

2.2 test kit performance evaluations

2.2.1 serum sample detection

Clinical control serum sample is detected (60 parts) by test kit prepared by application experiment, judges that this examines according to experimental result Examining system is the most feasible.Testing result is shown in Table 4.

4 60 parts of serum sample testing results of table

-: negative reaction ,+: positive reaction, ++: relatively strong positive reaction, +++: strong positive reaction.

From experiment statistics result it can be seen that feminine gender and positive coincidence rate all reach 100 %, therefore it is considered that use this Detecting system is feasible.

2.2.2 the Positive Sera cross reaction such as HBV, HCV detection

Use test kit of the present invention to HBV(hepatitis B), HCV(hepatitis C) serum of patient detects, thus enters one The specificity of step kits for evaluation, testing result is shown in Table 5.

The cross reaction testing result of the anti-positive serum such as table 5 HBV, HCV

From testing result it can be seen that this test kit occurs with the equal no cross reaction of above-mentioned patients serum.

2.2.3 compare with the like product of commercialization

The positive of commercial kit of learning from else's experience detection and negative serum sample 30 example, use this test kit to detect, statistics inspection Surveying result, calculate the sensitivity of test kit, specificity, false positive rate, false negative rate and detection coincidence rate etc., experimental result is shown in Table 6 below.

Table 6-1 and the comparison test result of Jian Lun bio tech ltd, Guangzhou test kit

Verity and predictive value's computational analysis

From form it can be seen that the detection of test kit of the present invention and Jian Lun bio tech ltd, reference product Guangzhou test kit accords with Conjunction rate is 96.7 %.

Table 6-2 and the comparison test result of Aikang Biotechnology's test kit

It is really property and predictive value's computational analysis

From form it can be seen that the detection of test kit of the present invention and reference product Aikang Biotechnology (Hangzhou) Co., Ltd. test kit Coincidence rate is 94.3 %.

Table 6-3 and the comparison test result of Shanghai Upper Bio-tech Pharma Co., Ltd.'s test kit

Verity and predictive value's computational analysis

From form it can be seen that the detection of test kit of the present invention and reference product Shanghai Upper Bio-tech Pharma Co., Ltd. test kit accords with Conjunction rate is 97.4 %.

SEQUENCE LISTING

<110>Shenyang all creation bio tech ltd

<120>structure of tubercule bacillus 16kD-CFP10-19kD tri-fusion protein and qualification

<130> 2015

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1287

<212> DNA

<213>mycobacterium tuberculosis (Mycobacterium tuberculosis)

<400> 1

atgaacaatc tcgcattgtg gtcgcgtccg gtgtgggacg ttgagccctg ggaccgctgg 60

ctacgtgact tcttcggccc tgccgcgacg acggactggt accgcccggt cgccggagac 120

ttcacgccgg ccgccgagat cgtcaaggat ggcgacgacg cggtggtccg tttggaactg 180

cccggcattg acgtcgacaa ggacgtcaac gtcgagcttg accctggcca gccggtgagc 240

cgcctggtga tccgcggcga acaccgcgac gagcacacgc aagacgccgg agacaaagac 300

ggccgcaccc tgcgtgagat ccgctacgga tcattccgcc gctcgttccg gctgcccgcg 360

cacgtcacca gcgaggccat cgcggcttcc tatgacgccg gtgtgctgac cgtccgggtt 420

gccggcgcct acaaggcccc agccgaaact caggcgcagc gcatcgccat cacgaagggt 480

ggcggaggat ccatggcaga gatgaagacc gatgccgcta ccctcgcgca ggaggcaggt 540

aatttcgagc ggatctccgg cgacctgaaa acccagatcg accaggtgga gtcgacggca 600

ggttcgttgc agggccagtg gcgcggcgcg gcggggacgg ccgcccaggc cgcggtggtg 660

cgcttccaag aagcagccaa taagcagaag caggaactcg acgagatctc gacgaatatt 720

cgtcaggccg gcgtccaata ctcgagggcc gacgaggagc agcagcaggc gctgtcctcg 780

caaatgggct tcggaggtgg cggtagtgtg aagcgtggac tgacggtcgc ggtagccgga 840

gccgccattc tggtcgcagg tctttccgga tgttcaagca acaagtcgac tacaggaagc 900

ggtgagacca cgaccgcggc aggcacgacg gcaagccccg gcgccgcctc cgggccgaag 960

gtcgtcatcg acggtaagga ccagaacgtc accggctccg tggtgtgcac aaccgcggcc 1020

ggcaatgtca acatcgcgat cggcggggcg gcgaccggca ttgccgccgt gctcaccgac 1080

ggcaaccctc cggaggtgaa gtccgttggg ctcggtaacg tcaacggcgt cacgctggga 1140

tacacgtcgg gcaccggaca gggtaacgcc tcggcaacca aggacggcag ccactacaag 1200

atcactggga ccgctaccgg ggtcgacatg gccaacccga tgtcaccggt gaacaagtcg 1260

ttcgaaatcg aggtgacctg ttcctaa 1287

<210> 2

<211> 428

<212> PRT

<213>mycobacterium tuberculosis (Mycobacterium tuberculosis)

<400> 2

Met Asn Asn Leu Ala Leu Trp Ser Arg Pro Val Trp Asp Val Glu Pro

1 5 10 15

Trp Asp Arg Trp Leu Arg Asp Phe Phe Gly Pro Ala Ala Thr Thr Asp

20 25 30

Trp Tyr Arg Pro Val Ala Gly Asp Phe Thr Pro Ala Ala Glu Ile Val

35 40 45

Lys Asp Gly Asp Asp Ala Val Val Arg Leu Glu Leu Pro Gly Ile Asp

50 55 60

Val Asp Lys Asp Val Asn Val Glu Leu Asp Pro Gly Gln Pro Val Ser

65 70 75 80

Arg Leu Val Ile Arg Gly Glu His Arg Asp Glu His Thr Gln Asp Ala

85 90 95

Gly Asp Lys Asp Gly Arg Thr Leu Arg Glu Ile Arg Tyr Gly Ser Phe

100 105 110

Arg Arg Ser Phe Arg Leu Pro Ala His Val Thr Ser Glu Ala Ile Ala

115 120 125

Ala Ser Tyr Asp Ala Gly Val Leu Thr Val Arg Val Ala Gly Ala Tyr

130 135 140

Lys Ala Pro Ala Glu Thr Gln Ala Gln Arg Ile Ala Ile Thr Lys Gly

145 150 155 160

Gly Gly Gly Ser Met Ala Glu Met Lys Thr Asp Ala Ala Thr Leu Ala

165 170 175

Gln Glu Ala Gly Asn Phe Glu Arg Ile Ser Gly Asp Leu Lys Thr Gln

180 185 190

Ile Asp Gln Val Glu Ser Thr Ala Gly Ser Leu Gln Gly Gln Trp Arg

195 200 205

Gly Ala Ala Gly Thr Ala Ala Gln Ala Ala Val Val Arg Phe Gln Glu

210 215 220

Ala Ala Asn Lys Gln Lys Gln Glu Leu Asp Glu Ile Ser Thr Asn Ile

225 230 235 240

Arg Gln Ala Gly Val Gln Tyr Ser Arg Ala Asp Glu Glu Gln Gln Gln

245 250 255

Ala Leu Ser Ser Gln Met Gly Phe Gly Gly Gly Gly Ser Val Lys Arg

260 265 270

Gly Leu Thr Val Ala Val Ala Gly Ala Ala Ile Leu Val Ala Gly Leu

275 280 285

Ser Gly Cys Ser Ser Asn Lys Ser Thr Thr Gly Ser Gly Glu Thr Thr

290 295 300

Thr Ala Ala Gly Thr Thr Ala Ser Pro Gly Ala Ala Ser Gly Pro Lys

305 310 315 320

Val Val Ile Asp Gly Lys Asp Gln Asn Val Thr Gly Ser Val Val Cys

325 330 335

Thr Thr Ala Ala Gly Asn Val Asn Ile Ala Ile Gly Gly Ala Ala Thr

340 345 350

Gly Ile Ala Ala Val Leu Thr Asp Gly Asn Pro Pro Glu Val Lys Ser

355 360 365

Val Gly Leu Gly Asn Val Asn Gly Val Thr Leu Gly Tyr Thr Ser Gly

370 375 380

Thr Gly Gln Gly Asn Ala Ser Ala Thr Lys Asp Gly Ser His Tyr Lys

385 390 395 400

Ile Thr Gly Thr Ala Thr Gly Val Asp Met Ala Asn Pro Met Ser Pro

405 410 415

Val Asn Lys Ser Phe Glu Ile Glu Val Thr Cys Ser

420 425

Claims (6)

1. encoding a fusion gene of mycobacterium tuberculosis three recombination fusion protein 16kD-CFP10-19kD, its feature exists In: its nucleotide sequence is as shown in SEQ ID NO:1.

2. a mycobacterium tuberculosis three recombination fusion protein 16kD-CFP10-19kD, it is characterised in that: it is by right Requiring the fusion gene coding in 1, its aminoacid sequence is as shown in SEQ ID NO:2.

3. the expression vector of mycobacterium tuberculosis three recombination fusion protein, it is characterised in that: it is by claim 1 In fusion gene be connected on pET28a carrier according to the building mode shown in Fig. 1, its aminoacid sequence such as SEQ ID NO:2 Shown in.

4. a DNA-hydrogel acellular albumen expression system, it is characterised in that: it is to be moved back by four oligonucleotide sequences The X-DNA that fire is combined into is the hydrogel structure of skeleton, and after its synthesis, the result is as shown in Figure 3.

5. an antigen of mycobacterium tuberculosis speckle gold immunity quick detection kit, containing diafiltration determinator, point sample film, Label and eluent, it is characterised in that: described point sample film is to have selected antigen of mycobacterium tuberculosis (three restructuring fusion eggs Nitrocellulose filter in vain)；Described label is colloid gold label staphylococcal protein A conjugate；Described eluent is The 0.01 M TBS buffer of pH 7.4；The connection antibody in serum is used to put up a bridge between antigen and label.

Antigen of mycobacterium tuberculosis speckle gold immunity quick detection kit the most according to claim 5, its feature exists In: antigen coated concentration does not dilutes, and colloid gold label staphylococcal protein A working concentration does not dilutes, Quality Control point sheep anti mouse IgG is coated concentration and makees 1:16 dilution, and the sealing condition of reaction film is 4 DEG C and overnight closes, and the drying condition of reaction film is relatively Humidity be 30 %-40 % environment in be dried 60 min.