CN106119354A - Pig S.hominis LAMP detection kit and detection method thereof - Google Patents
Pig S.hominis LAMP detection kit and detection method thereof Download PDFInfo
- Publication number
- CN106119354A CN106119354A CN201610490222.5A CN201610490222A CN106119354A CN 106119354 A CN106119354 A CN 106119354A CN 201610490222 A CN201610490222 A CN 201610490222A CN 106119354 A CN106119354 A CN 106119354A
- Authority
- CN
- China
- Prior art keywords
- hominis
- primer
- pig
- reactant liquor
- detection kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides boar S.hominis LAMP detection kit and a detection method thereof.Described detection kit includes the reactant liquor A combined containing above-mentioned primer and includes the reactant liquor B of 1000x SYBR Green I, described primer combination includes inner primer 1, outer primer 1, inner primer 2 and outer primer 2, and its nucleotide sequence is respectively SEQ ID No.1 4.Described detection method includes: 1) extracts testing sample DNA, prepares DNA treatment fluid；2) ring mediated isothermal amplification: add DNA treatment fluid in reactant liquor A, mixing is centrifugal, places 45 60min in 60 65 DEG C of constant temperature；3) color developing detection of amplified production: add reactant liquor B in above-mentioned mixed liquor, reaction is sufficiently mixed after terminating, perusal reactant liquor color: green shows that pig S.hominis in sample, yellow explanation measuring samples do not contain pig S.hominis.The pig S.hominis LAMP detection kit that the present invention provides can quickly, accurately and sensitiveer, detect pig S.hominis efficiently.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of based on ring mediated isothermal amplification (Loop-mediated
Isothermal amplification, LAMP) the detection test kit of pig S.hominis of technology and detection method thereof.
Background technology
Sarcosporidiasis is the food-borne parasitic disease that a class is important, is by pushing up subphylum, sporozoa, proper sphere worm again
Mesh, Pathological observation section, Sarcocystis protozoon are drawn in parasitizing animal muscle and each internal organs capillary endothelial cell
The class Zoonosis protozoacide risen.At present, the cause of disease of pig Sarcosporidiasis has three kinds: Michaelis Pathological observation
(S.miescheriana), pig S.hominis (S.suihominis) and pig cat Pathological observation (S.porcifelis).
Pig S.hominis intermediate host is pig, and final host is people and inhuman primate, and people eats the meat in Carnis Sus domestica
There is certain harm after sporozoon, people can be caused to feel sick, suffer from diarrhoea.Therefore, the research to pig S.hominis disease is carried out to people
Class is healthy and aquaculture has important meaning.
At present the diagnostic techniques to pig Sarcosporidiasis depend on the observation of clinical symptoms, Epidemiological study,
Cut open the preliminary judgement such as work of examining substantially change, make a definite diagnosis and then rely on microscope inspection observation or histopathologic staining technique.These
There is the deficiencies such as time-consuming bothersome, susceptiveness and specificity are strong, detection program is loaded down with trivial details, workload is big in traditional method, is difficult to adapt to
The needs that modernization food safety quickly detects.Although although PCR method has simple to operate compared with traditional method, susceptiveness is with special
The advantages such as the opposite sex is strong, but still need the time of about 3 hours just can go out result, it is impossible to make a definite diagnosis immediately, and must be equipped with
Instrumentation, and often have non-specific appearance.
Loop-mediated isothermal amplification (LAMP) technology is a kind of constant temperature nucleic acid amplification method of novelty.It is characterized in
4 species-specific primers are designed in 6 regions for target gene, utilize a kind of strand displacement archaeal dna polymerase, on isothermy (65 DEG C of left sides
Right) insulation dozens of minutes, nucleic acid amplification reaction can be completed.The method need not the thermal denaturation of template, long-time temperature cycles,
The processes such as loaded down with trivial details electrophoresis, ultraviolet visualization, and reaction result can observe system color change by adding SYBR Green I
Determining in tissue whether infected pigs's S.hominis, if infecting, then system is yellow green, is uninfected by then for orange-yellow.At present,
LAMP technology the most extensively should also have part to report in the detection of pathogenic microorganism in terms of parasite diagnosis, as trichinella,
Cattle Babesia, fetus trichomonacide, giardia lamblia, Histomanas Meleagridis etc., and the research in terms of pig S.hominis is
Blank.Compared with above-mentioned several laboratory diagnostic methods, ring mediated isothermal amplification (Loop-mediated isothermal
Amplification, LAMP) technology is less demanding to instrument and equipment, have simple to operate, be easily able to clinically, when detecting
Between short feature.Chinese patent ZL201210494834.3 discloses one and is applicable to Histomanas Meleagridis LAMP detection reagent
Box, including containing 10x isothermal reaction buffer, BstDNA polymerase, dNTP, MgCl2, four kinds of primer mixed liquors, glycine betaine and
The reactant liquor A of deionized water, and the reactant liquor B of the fluorescent dye SYBR Green I containing 1000x are anti-by naked eyes detection
Answer liquid color distortion, it is achieved at least detection sensitivity of 1 gene copy.But, live with pig people based on Histomanas Meleagridis
The nosetiology of sarcocystis, parasitic site and the difference of respective life cycle, this test kit cannot be used for detecting pig people and lives meat spore
Worm.
Summary of the invention
It is an object of the invention to provide boar S.hominis LAMP detection kit and a detection method thereof, thus
Quickly, accurately and also sensitiveer, efficiently detection pig S.hominis.Its design concept is: make full use of LAMP technology
High specificity, highly sensitive, quick and low cost and other advantages, and for pig S.hominis, the feature of target gene is set 4
Plant primer, utilize strand replacement reaction to make target gene efficient amplification at a constant temperature.
In order to achieve the above object, technical scheme is as follows:
The invention provides a boar S.hominis LAMP detection kit, including following component:
(1) reactant liquor A:
Containing 10x isothermal reaction buffer, 8000U/mL BstDNA polymerase, 0.5mM dNTP, 2mM MgCl2, contain
1.4 μMs of inner primers 1 and the inner primer mixed liquor of 1.4 μMs of inner primers 2, containing 0.2 μM of outer primer 1 and the outer primer of 0.2 μM of outer primer 2
Mixed liquor, 1M glycine betaine and deionized water, wherein:
10x isothermal reaction buffer contains 200mM trishydroxymethylaminomethane hydrochlorate (pH8.8), 100mM chlorination
Potassium, 100mM ammonium sulfate, 20mM magnesium sulfate and 1% (m/V) triton x-100 (pH8.8,25 DEG C)；
Inner primer 1 is: TCTACCATAAACTATGCCGACTAGACTTTGATTTCTCATGAGGTGC (SEQ ID
No.1),
Inner primer 2 is: ACCCCCTACTGTCGTTCTTGATTGTTAAAGACGAACTACTGCG (SEQ ID No.2),
Outer primer 1 is: CGTATTTAACTGTCAGAGGTGA (SEQ ID No.3),
Outer primer 2 is: TTCAGCCTTGCGACCATA (SEQ ID No.4)；
(2) reactant liquor B:1000x fluorescent dye SYBR Green I.
Present invention also offers a kind of use above-mentioned pig S.hominis LAMP detection kit detection pig people and live meat spore
The method of sub-worm, its major technique step includes:
1) extract testing sample DNA, prepare DNA treatment fluid；
2) ring mediated isothermal amplification of pig S.hominis:
By reactant liquor A that volume ratio is 24:1 and step 1) in the DNA treatment fluid mixing of gained centrifugal, in 60-65 DEG C of perseverance
Temperature places 45-60min；
3) color developing detection of amplified production:
In step 2) in gained mixed liquor in add reactant liquor B, its volume ratio is 25:1, and reaction is fully mixed after terminating
Close, perusal reactant liquor color: as color becomes green, show pig S.hominis in sample, if color is yellow, say
Bright measuring samples does not contains pig S.hominis.
Present invention also offers the primer combination of above-mentioned pig S.hominis LAMP detection, above-mentioned pig S.hominis
The detection method of LAMP detection kit and above-mentioned pig S.hominis LAMP detection kit lives meat spore detection pig people
Application in terms of sub-worm.
Technical scheme has reached following beneficial effect:
A) present invention establishes pig S.hominis LAMP detection kit, and this test kit is according to pig S.hominis
6 positions of 18SrRNA gene conserved region set 4 kinds of primers and be respectively as follows: two specificity inner primers and two specificitys
Outer primer, this conserved genetic sequences is that pig S.hominis is common；
B) present invention uses LAMP technology, high specificity, and has higher sensitivity than PCR detection method, but is not required to hold high
Expensive PCR instrument, only needs common metal bath or water bath, and result need not be observed with gel electrophoresis method, uses glimmering
Photoinitiator dye is observed, simple and quick.Can be used for the detection of pig S.hominis, being particularly suitable for basic unit scene should
With.
LAMP technology has high specificity, highly sensitive, quick and low cost and other advantages, is characterized in target gene 6
Individual position sets 4 kinds of primers, utilizes strand replacement reaction to make target gene efficient amplification at a constant temperature.Owing to its reaction is multiple primer
Common startup so that reaction result is more special than PCR, further, since carry out is isothermal duplication, reaction is in constant water bath box
Just can complete, not only save instrument cost, and operational approach is simpler, is suitable to field quick detection.
The present invention solve the method detecting pig S.hominis in prior art needed for cycle length, sensitivity relatively low,
The defects such as cost is high, on-the-spot application difficult, it is provided that the detection kit of pig S.hominis and detection method, to pig people
Pathological observation carries out LAMP detection, and quickly, accuracy is high, susceptiveness application good, on-the-spot is convenient, can be widely applied to veterinary,
Food, Exit-Entry Quaratine field.
Accompanying drawing explanation
Fig. 1 is the testing result of specific embodiment 1.
In figure, Zuo Tu: positive, middle figure: negative sample, right figure: blank.
Detailed description of the invention
In order to illustrate technical scheme and technical purpose, below in conjunction with the accompanying drawings and detailed description of the invention is to the present invention
It is described further.
Following Examples further illustrates the present invention, but should not be regarded as limitation of the present invention.
Embodiment 1:
Loop-mediated isothermal amplification detection kit by following formula making pig S.hominis:
(1) reactant liquor A:
Containing 10 × isothermal reaction buffer, 8000U/ml Bst archaeal dna polymerase, 0.5mM dNTP, 2mM MgCl2,
1.4 μMs of inner primers 1 and 1.4 μMs of inner primer 2 mixed liquors, 0.2 μM of outer primer 1 and 0.2 μM of outer primer 2 mixed liquor, 1M glycine betaine and
Deionized water, wherein:
10 × isothermal reaction buffer contains 200mM trishydroxymethylaminomethane hydrochlorate (pH8.8), 100mM chlorination
Potassium, 100mM ammonium sulfate, 20mM magnesium sulfate and 1% (m/V) triton x-100 (pH8.8,25 DEG C)；
Inner primer 1 is: TCTACCATAAACTATGCCGACTAGACTTTGATTTCTCATGAGGTGC (SEQ ID No.1)
Inner primer 2 is: ACCCCCTACTGTCGTTCTTGATTGTTAAAGACGAACTACTGCG (SEQ ID No.2)
Outer primer 1 is: CGTATTTAACTGTCAGAGGTGA (SEQ ID No.3)
Outer primer 2 is: TTCAGCCTTGCGACCATA (SEQ ID No.4)
(2) reactant liquor B:1000 × fluorescent dye SYBR Green I.
LAMP reactant liquor A, in terms of often pipe 24 μ L, is 2.5 μ L 10 × isothermal reaction buffer, 1.0 μ L 8U/ μ L Bst
Archaeal dna polymerase, 1.25 μ L 0.5mM dNTP, 3 μ l 2mM MgCl2, 2 μ L outer primer mixed liquors, 7 μ L inner primer mixed liquors, 2.5
μ L 1M glycine betaine, 4.75 μ L deionized waters.
Embodiment 2:
Pig S.hominis LAMP detection kit is utilized to detect pig S.hominis.
Prepared by sample to be tested treatment fluid: take from as a example by Carnis Sus domestica by sample, and infected pigs's S.hominis Carnis Sus domestica is as the positive
Sample, fresh pork, as negative sample, sets up the deionized water without sample as blank simultaneously.
A. take Pork Tissue 0.5g, be placed in 1.5mL centrifuge tube, after grinding, add the Tissue lysates (100mM of 1mL
PH8.0Tris, 500mM pH 8.0EDTA, 20mM NaCL, 10%SDS)；
B. add 20 μ L E.C. 3.4.21.64 (20mg/mL) mixings, be placed in water-bath 30min in 65 DEG C of thermostat water baths；
C.12000 × g is centrifuged 5min, is moved in new centrifuge tube by supernatant；
D. isopyknic phenol is added: chloroform: isoamyl alcohol (25:24:1) vibration vortex, 12000 × g is centrifuged 5min, by upper strata
Liquid enters in another centrifuge tube；
E. adding the dehydrated alcohol mixing of 2 times of volume pre-coolings, 4 DEG C of precipitations 20min, 12000 × g are centrifuged 10min, go
Clearly；
F. precipitation 75% washing with alcohol of 800 μ L pre-coolings once rear 12000 × g, centrifugal 5min；
G. discarding supernatant, centrifuge tube is inverted in absorbent paper, drying at room temperature 2-3min；
H. go again to dissolve from water dried precipitation with 20 μ L, be subsequently placed in-20 DEG C and save backup.
Detection:
(1) ring mediated isothermal amplification of pig S.hominis
The DNA of the 1 above-mentioned prepared positive to be checked of μ L it is separately added in the PCR reaction tube equipped with 24 μ L reactant liquor A
Treatment fluid, the DNA treatment fluid of fresh pork or sterilizing deionized water, as positive control, negative control and blank,
Mixing is centrifugal, is dropped in respectively by the reactant liquor B of 1 μ L in the middle of inside PCR pipe lid, and (careful operation, in case nitrite ion falls to cover tightly lid
Enter in reaction mixture), in 60-65 DEG C of constant water bath box, place 60min；
(2) color developing detection of amplified production
Reverse PCR pipe for several times, makes reaction mixture be sufficiently mixed with reactant liquor B, and observing response liquid color, according to reactant liquor
Color change naked eyes judge testing result.Positive control color becomes green, shows in sample containing pig S.hominis.
Negative control and blank color are yellow, illustrate not contain pig S.hominis.Detection result of the test such as Fig. 1.
Embodiment 3: pig S.hominis detection method sensitivity test
Take the plasmid DNA containing pig S.hominis specific gene, by 10 doubling dilutions as LAMP detection test mould
Plate, makes to be respectively 10 containing templet gene copy number in every μ L diluent8, 107, 106, 105, 104, 103, 102, 10,1；
In the PCR reaction tube equipped with 24 μ L reactant liquor A, it is separately added into 1 μ L said gene group diluent, arranges not simultaneously
Adding the blank of plasmid DNA, mixing is centrifugal, is dropped in by the reactant liquor B of 1 μ L in the middle of inside PCR pipe lid, covers tightly lid in 60-
65 DEG C of constant water bath box are placed 60min；
Reverse PCR pipe for several times, makes reaction mixture be sufficiently mixed with reactant liquor B, perusal reactant liquor color, and result shows
Showing that the reaction tube added with plasmid DNA becomes green, control tube color is yellow, the detection sensitivity of this test kit is described at least
10 gene copies.
The ultimate principle of the present invention, principal character and advantages of the present invention have more than been shown and described.The technology of the industry
Personnel, it should be appreciated that the present invention is not restricted to the described embodiments, simply illustrating this described in above-described embodiment and description
The principle of invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, the present invention
Claimed scope is defined by appending claims, description and equivalent thereof.
Claims (6)
1. the primer combination of a boar S.hominis LAMP detection, it is characterised in that include inner primer 1, inner primer 2, outer
Primer 1 and outer primer 2, the nucleotides sequence of described inner primer 1 is classified as SEQ ID No.1, and the nucleotides sequence of described inner primer 2 is classified as
SEQ ID No.2, the nucleotides sequence of described outer primer 1 is classified as SEQ ID No.3, and the nucleotides sequence of described outer primer 2 is classified as SEQ
ID No.4。
2. a boar S.hominis LAMP detection kit, it is characterised in that include reactant liquor A and reactant liquor B, wherein:
Described reactant liquor A includes: containing inner primer 1 as claimed in claim 1 and the inner primer mixed liquor of inner primer 2, contain
There is the outer primer mixed liquor of outer primer 1 as claimed in claim 1 and outer primer 2；
Described reactant liquor B includes: the fluorescent dye SYBR Green I of 1000x.
A boar S.hominis LAMP detection kit the most as claimed in claim 2, it is characterised in that described reaction
Liquid A includes: 10x isothermal reaction buffer, 8000U/mL BstDNA polymerase, 0.5mM dNTP, 2mM MgCl2, containing 1.4 μMs
Inner primer 1 as claimed in claim 1 and the inner primer mixed liquor of 1.4 μMs of inner primers 2 as claimed in claim 1, containing 0.2 μM
Outer primer 1 as claimed in claim 1 and the outer primer mixed liquor of 0.2 μM of outer primer 2 as claimed in claim 1,1M Radix Betae
Alkali and deionized water.
A boar S.hominis LAMP detection kit the most as claimed in claim 3, it is characterised in that: described 10x
Isothermal reaction buffer contains the trishydroxymethylaminomethane hydrochlorate of 200mM pH8.8,100mM potassium chloride, 100mM sulphuric acid
Ammonium, 20mM magnesium sulfate and solid-to-liquid ratio are the pH8.8 of 1%, the triton x-100 of 25 DEG C.
5. the detection side of the pig S.hominis LAMP detection kit used as according to any one of claim 2-4
Method, it is characterised in that comprise the following steps:
1) extract testing sample DNA, prepare DNA treatment fluid；
2) ring mediated isothermal amplification of pig S.hominis:
By reactant liquor A that volume ratio is 24:1 and step 1) in the DNA treatment fluid mixing of gained centrifugal, put in 60-65 DEG C of constant temperature
Put 45-60min；
3) color developing detection of amplified production: in step 2) in gained mixed liquor in add reactant liquor B, its volume ratio is 25:1,
Reaction is sufficiently mixed after terminating, perusal reactant liquor color: as color becomes green, show that in sample, pig people lives meat spore
Worm, if color is yellow, illustrates that measuring samples does not contains pig S.hominis.
The primer of a boar S.hominis LAMP detection the most as claimed in claim 1 combines, as appointed in claim 2-4
A described boar S.hominis LAMP detection kit of anticipating and pig people as claimed in claim 5 live meat spore
The application in terms of detection pig S.hominis of the detection method of sub-worm LAMP detection kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610490222.5A CN106119354A (en) | 2016-06-28 | 2016-06-28 | Pig S.hominis LAMP detection kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610490222.5A CN106119354A (en) | 2016-06-28 | 2016-06-28 | Pig S.hominis LAMP detection kit and detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106119354A true CN106119354A (en) | 2016-11-16 |
Family
ID=57285482
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610490222.5A Pending CN106119354A (en) | 2016-06-28 | 2016-06-28 | Pig S.hominis LAMP detection kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106119354A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110922491A (en) * | 2019-12-17 | 2020-03-27 | 河南科技大学 | Sarcocystis fusion antigen, encoding gene, indirect ELISA antibody detection kit and application thereof |
| CN113186322A (en) * | 2021-06-03 | 2021-07-30 | 中国农业大学 | LAMP (loop-mediated isothermal amplification) detection kit for sheep Sarcocystis tenella and application of LAMP detection kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6110665A (en) * | 1995-02-14 | 2000-08-29 | University Of Kentucky Research Foundation | Sarcocystis neuronadiagnostic primer and its use in methods of equine protozoal myeloencephalitis diagnosis |
| CN102925584A (en) * | 2012-11-28 | 2013-02-13 | 扬州大学 | LAMP (loop-mediated isothermal amplification) detecting kit for turkey histomonas melegridis |
-
2016
- 2016-06-28 CN CN201610490222.5A patent/CN106119354A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6110665A (en) * | 1995-02-14 | 2000-08-29 | University Of Kentucky Research Foundation | Sarcocystis neuronadiagnostic primer and its use in methods of equine protozoal myeloencephalitis diagnosis |
| CN102925584A (en) * | 2012-11-28 | 2013-02-13 | 扬州大学 | LAMP (loop-mediated isothermal amplification) detecting kit for turkey histomonas melegridis |
Non-Patent Citations (4)
| Title |
|---|
| CATARINA COELHO等: "Unraveling Sarcocystis miescheriana and Sarcocystis suihominis infections in wild boar", 《VETERINARY PARASITOLOGY》 * |
| FURUKAWA M等: "The Development of a Novel, Validated, Rapid and Simple Method for the Detection of Sarcocystis fayeri in Horse Meat in the Sanitary Control Setting", 《BIOCONTROL SCI》 * |
| 张伟等主编: "《现代食品微生物检测技术》", 30 September 2007, 化学工业出版社 * |
| 禚振男等: "猪住肉孢子虫病诊断技术的研究进展", 《黑龙江畜牧兽医》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110922491A (en) * | 2019-12-17 | 2020-03-27 | 河南科技大学 | Sarcocystis fusion antigen, encoding gene, indirect ELISA antibody detection kit and application thereof |
| CN113186322A (en) * | 2021-06-03 | 2021-07-30 | 中国农业大学 | LAMP (loop-mediated isothermal amplification) detection kit for sheep Sarcocystis tenella and application of LAMP detection kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110656187B (en) | Kit for detecting pathological tissues or echinococcus in canine feces by multiple RAA and multiple PCR and detection method | |
| CN113416799B (en) | CDA primer group and kit for detecting African swine fever virus and application of CDA primer group and kit | |
| CN102747165B (en) | Reagent kit and method for quickly detecting tilapia streptococcus agalactiae by using loop-mediated isothermal amplification technology | |
| CN110551851A (en) | CAMP primer group for amplifying ASFV, kit and application | |
| CN107488730A (en) | A kind of fluorescence detection reagent kit for the detection of China prawn shrimp liver sausage spore worm | |
| Zhao et al. | Establishment and application of multiple cross displacement amplification coupled with lateral flow biosensor (MCDA-LFB) for visual and rapid detection of Candida albicans in clinical samples | |
| CN107058599A (en) | A kind of Primer composition, kit and its dual signal channel detection methods for detecting staphylococcus aureus | |
| RU2645263C1 (en) | Test system of detecting dna of african swine fever virus by real-time polymerase chain reaction | |
| CN115029459A (en) | Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application | |
| CN107881261A (en) | Detect LAMP primer group, kit and the application of the type of pig circular ring virus 3 | |
| CN108866244A (en) | Detect RPA primer and probe, kit and its method of prawn irido virus | |
| CN113322338A (en) | CDA primer group and kit for detecting Shigella and application of CDA primer group and kit | |
| CN108588277A (en) | A kind of canine distemper virus visualization nucleic acid detection method | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| CN114774563B (en) | Detection reagent for brucellosis in dog and application | |
| CN107460255A (en) | A kind of RT LAMP primers group, kit and application for detecting pig fourth type coronavirus | |
| CN106119354A (en) | Pig S.hominis LAMP detection kit and detection method thereof | |
| CN101591713B (en) | Gosling plague virus LAMP detection kit and detection method thereof | |
| CN110499394A (en) | Detect LAMP primer group, kit and the detection method of African swine fever virus | |
| CN107630097A (en) | A kind of primer sets and kit of quick detection urogenital infections common causative | |
| CN103695538B (en) | Use LAMP technology detection Anaplasma phagocytophilum method | |
| CN107365684B (en) | A kind of paper micro-fluidic chip and its method for extracting nucleic acid and isothermal amplification method | |
| Trotz-Williams et al. | Multiattribute evaluation of two simple tests for the detection of Cryptosporidium parvum in calf faeces | |
| CN103276088B (en) | Kit for simultaneously detecting three diarrhea protozoa and detection method | |
| CN102925584B (en) | LAMP (loop-mediated isothermal amplification) detecting kit for turkey trichomonas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161116 |
|
| RJ01 | Rejection of invention patent application after publication |