CN106119280A

CN106119280A - The albumen OsJGL2 relevant to rice grain length and encoding gene thereof and application

Info

Publication number: CN106119280A
Application number: CN201610555501.5A
Authority: CN
Inventors: 夏新界; 张斌; 殷绪明
Original assignee: Hunan New Spring Agricultural Biotechnology High Tech Co Ltd
Current assignee: Hunan New Spring Agricultural Biotechnology High Tech Co Ltd
Priority date: 2016-07-14
Filing date: 2016-07-14
Publication date: 2016-11-16
Anticipated expiration: 2036-07-14
Also published as: CN106119280B

Abstract

The invention discloses the application in the expression vector that preparation is relevant to rice grain length of the albumen OsJGL2 encoding gene.Albumen OsJGL2 application in preparation Oryza sativa L. grain length regulation and control preparation.The invention also discloses the expression vector of a kind of albumen OsJGL2 relevant to rice grain length.Overexpression rice Os JGL2 gene can cause rice paddy seed significantly to increase weightening finish.Compared with wild type, transgenic paddy rice grain length increases by 7.0%, mass of 1000 kernel weightening finish 15.6%.

Description

The albumen OsJGL2 relevant to rice grain length and encoding gene thereof and application

Technical field

The invention belongs to biological technical field, be specifically related to the albumen OsJGL2 relevant to rice grain length and encoding gene thereof With application.

Background technology

Oryza sativa L. is one of staple food crop of depending on for existence of the mankind, and the whole world there are about the population of half with rice as staple food. The disparities between supply and demand of View of World Rice are more and more prominent, improve the primary goal that yield is current rice breeding.Grain is heavily to affect crop One of key factor of yield, increases the big granule weight of grain, is one of some effective improving rice yield, and the length of grain Degree is again the important morphological index determining quality of rice.Not only increase yield but also improve quality of rice, be the target of breeding man pursuit. For other yield traits of Oryza sativa L., the research about grain length gene at present slightly shows delayed, the grain length base being really separated to Because of seldom.In grass family material, clone the excellent genes relevant to grain length, cultivation high yield, Fine Quality Rice Variety are had Important theory and practical significance.

Summary of the invention

OsJGL2 gene (the GenBank number of logging in XM_015770529.1) is Unknown Function gene in Oryza sativa L., is positioned at Oryza sativa L. On No. 1 chromosome, intronless, mRNA size is 1349bp, and coded sequence (CDS) size is 747bp, and coding comprises 248 The albumen (the GenBank number of logging in XP_015626015.1) of individual amino acid residue, protein molecular weight is 26.72KD, isoelectric point, IP It is 8.1.In this protein sequence, charge residue 78, acidic amino acid 32, basic amino acid 33, polarity ammonia Base acid 55, hydrophobic amino acid 76.GenBank data base's comparison is analyzed and is found, OsJGL2 protein sequence has presumption DUF1645 conserved domain, with short flower pesticide wild rice (XP_006644418.1), two fringe false bromegrasses (XP_003569426.1), Sorghum vulgare Pers. (XP_002456032.1), Semen setariae (XP_004969278.1) and the homology of Semen Maydis (NP_001143665.2) protein sequence Property respectively reaches 82%, 56%, 61%, 65% and 61%.The sequence of OsJGL2 albumen as shown in SEQ ID NO.2, OsJGL2 The coding gene sequence of albumen is as shown in SEQ ID NO.3.The present invention constructs the expression vector of albumen OsJGL2, and its sequence is such as Shown in SEQ ID NO.1, named carrier pCAMBIA1300+163+OsJGL2, it is transformed in Oryza sativa L. expression, was found Scale reaches rice Os JGL2 gene and rice paddy seed can be caused significantly to increase weightening finish.Compared with wild type, transgenic paddy rice grain length Increase by 7.0%, mass of 1000 kernel weightening finish 15.6%.Therefore, albumen OsJGL2 encoding gene can be used for prepare relevant to rice grain length Expression vector.Albumen OsJGL2 can be used for preparing Oryza sativa L. grain length regulation and control preparation.

Accompanying drawing explanation

The pcr amplification product of Fig. 1 rice Os JGL2 gene；M, Marker；1, PCR primer；

The pMD18-T plasmid enzyme restriction of Fig. 2 OsJGL2 is analyzed；M, Marker；C, non-digested plasmid is as comparison；1,2 respectively Represent different plasmid enzyme restriction product；

The structural representation of Fig. 3 expression vector pCAMBIA1300+163；

Fig. 4 expression vector pCAMBIA1300+163+OsJGL2 enzyme action is identified；M, Marker；C, non-digested plasmid is as right According to；1,2,3 different plasmid enzyme restriction product is represented respectively；

The agriculture bacillus mediated rice transformation of Fig. 5；The picture left above is the induction of Rice Callus；Top right plot is subculture training Support；Lower-left figure is kanamycin-resistant callus tissue screening；Bottom-right graph is wound healing differentiation；

Fig. 6 special hygromycin primer is identified and is turned OsJGL2 trans-genetic hybrid rice；M, DNA molecular amount standard；1, no template control；2、 3, wild type control；4,5, positive control；6-24, transfer-gen plant；

Fig. 7 wild type and the comparison turning OsJGL2 trans-genetic hybrid rice economical character；Control, Oryza sativa L. wild type；OE, crosses table Reach strain；*P<0.05,**P<0.01,Student’s t test.

Detailed description of the invention

Gene is cloned

PCR cloning primer, the reaction experiment condition such as PCR, cloning vehicle, source and may use cut enzyme, cDNA sun Sex clone is analyzed

Synthetic pair of primers, and at reverse primer 5 ' end plus BamHI restriction enzyme site, forward primer place sequence is attached Near containing NcoI restriction enzyme site, it is not necessary to add.Primer is as follows:

OsJGL2F:5'ACGCATCGTCACATCACAGAG 3'(21) (SEQ ID NO.4)；

OsJGL2R:5'GGATCC TAGGCTTCAAGTCAAAGGTTCG 3'(28)(BamHI)(SEQ ID NO.5)。

Utilize this to primer, carry out PCR with the fine STb gene of Oryza sativa L. Japan for template.PCR condition is: hot lid temperature 105 DEG C, 95 DEG C of 5min of denaturation, 95 DEG C of degeneration 45s, 61 DEG C of annealing 45s, 72 DEG C extend 60s, carry out 34 circulations, 72 DEG C of extensions 10min.PCR system is shown in Table 1:

Table 1

Use TAE electrophoretic buffer to carry out agarose gel electrophoresis, obtain the fragment (Fig. 1) of about 900bp, named OsJGL2。

The test kit of above-mentioned OsJGL2 amplified production TIANGEN is carried out glue recovery, then recovery fragment is connected into PMD18-T carrier (TAKARA).Linked system such as table 2:

Table 2

Connect 2 hours, the competent cell of Transformed E .coli DH5 α, coated plate, screen with ammonia benzyl mycin.Select Dan Ke Grand, to identify with NcoI and BamHI double digestion after extracting plasmid, result is as it can be seen, all there is the purpose band (figure of about 1000bp 2).Sending 1, No. 2 corresponding bacterium solution order-checkings, sequencing result is all completely the same with gene order on GenBank.

Gene function checking detailed process

Expressing original vector and source, what expression original vector structure may be used cuts enzyme

Clone obtains OsJGL2 gene, is building up to expression vector, specifically comprises the following steps that connection has OsJGL2 gene Cloning vehicle pMD18-T and expression vector pCAMBIA1300+163 (Fig. 3) all with BamHI and NcoI carry out double digestion and point Do not reclaim purification, Transformed E .coli DH5 α after then connecting with T4 ligase, extract plasmid after picking list bacterium colony amplification culture, BamHI and NcoI double digestion is identified, final acquisition connects the Overexpression vector pCAMBIA1300+163+ having genes of interest OsJGL2 (Fig. 4).Heat shock method is utilized to be transformed in Agrobacterium EHA105 bacterial strain by the expression vector of structure.

Gene transformation method, gene transformation species

Agrobacterium-mediated transformation is used to be transformed in Oryza sativa L. SR59 by the expression vector of structure, it is thus achieved that overexpression OsJGL2 base The Transgenic Rice strain of cause.This experimentation is as follows: the callus come with the induction of SR59 mature seed, as receptor, passes through During Agrobacterium, co-culture, 2 resistant calli hygromycin step sizing (each 2 weeks), resistant calli differentiation, raw The step such as root, seedling exercising obtains hygromycin resistance plant (Fig. 5).

Transgenic plant analysis of molecules

Utilize hygromycin special primer, hygromycin resistance regeneration plant is carried out PCR detection (Fig. 6).Detect containing tide mould Positive strain 13 strain of plain gene.Primer is as follows:

HptF:5'TTTAGCGAGAGCCTGACCTATTGC 3'(SEQ ID NO.6)；

HptR:5'CGTCAACCAAGCTCTGATAGAGTTG 3'(SEQ ID NO.7)；

Transgenic plant function phenotype (Fig. 7)

The economical character that wild type and T1 generation turn OsJGL2 trans-genetic hybrid rice carries out paired observation and statistical analysis.With wild The plant height of type is compared, and three strains there was no significant difference.Compared with the tiller number of wild type, OE-1 and OE-2 strain is the most significantly high In wild type, OE-3 strain there was no significant difference with wild type.Compared with the sword-like leave length of wild type, OE-1 is the wildest Type, OE-2 is considerably longer than wild type, and OE-3 strain there was no significant difference with wild type.Compared with the sword-like leave width of wild type, OE-1 Being noticeably greater than wild type with OE-2, OE-3 strain there was no significant difference with wild type.Compared with the spike length of wild type, three strains There was no significant difference.Compared with the number of grain per ear of wild type, OE-1 and OE-2 strain all be substantially less than wild type, OE-3 strain without Significant difference.

Compared with the mass of 1000 kernel of wild type, three strains significantly increase weight, OE-1 strain weightening finish 6.3%, OE-2 strain Weightening finish 13.8%, OE-3 strain weightening finish 15.6%.Compared with the grain length of wild type, three strains significantly increase, OE-1 strain Being growth by 8.4%, OE-2 strain increases by 8.2%, and OE-3 strain increases by 7.0%.Compared with wide with the grain of wild type, three strains without Significant difference.Compared with the grain thickness of wild type, three strains there was no significant difference.

Claims

1. albumen OsJGL2 encoding gene application in the expression vector that preparation is relevant to rice grain length.

2. albumen OsJGL2 application in preparation Oryza sativa L. grain length regulation and control preparation.

3. the expression vector of an albumen OsJGL2 relevant to rice grain length, it is characterised in that contain in described expression vector Albumen OsJGL2 encoding gene described in claim 1.

4. expression vector as claimed in claim 3, it is characterised in that described expression vector sequence as shown in SEQ ID NO.1, Named carrier pCAMBIA1300+163+OsJGL2.