CN106119280B

CN106119280B - To the long relevant albumen OsJGL2 of rice grain and its encoding gene and application

Info

Publication number: CN106119280B
Application number: CN201610555501.5A
Authority: CN
Inventors: 夏新界; 张斌; 殷绪明
Original assignee: Hunan New Spring Agricultural Biotechnology High Tech Co Ltd
Current assignee: Hunan New Spring Agricultural Biotechnology High Tech Co Ltd
Priority date: 2016-07-14
Filing date: 2016-07-14
Publication date: 2019-11-05
Anticipated expiration: 2036-07-14
Also published as: CN106119280A

Abstract

The invention discloses albumen OsJGL2 encoding genes in preparation and the application in the long relevant expression vector of rice grain.Albumen OsJGL2 is preparing the application in rice grain length regulation preparation.The invention also discloses the expression vectors of albumen OsJGL2 relevant to rice grain length a kind of.Overexpression rice Os JGL2 gene can cause the extremely significant growth weight gain of rice paddy seed.Compared with wild type, transgenic paddy rice grain length increases by 7.0%, mass of 1000 kernel weight gain 15.6%.

Description

To the long relevant albumen OsJGL2 of rice grain and its encoding gene and application

Technical field

The invention belongs to field of biotechnology, and in particular to the long relevant albumen OsJGL2 of rice grain and its encoding gene With application.

Background technique

Rice is one of staple food crop for the survival of mankind, and there are about the populations of half using rice as staple food in the whole world. The disparities between supply and demand of View of World Rice are more and more prominent, improve the primary goal that yield is current rice breeding.Grain is to influence crop again One of an important factor for yield, increases the big granule weight of grain, is one of some effective of raising rice yield, and the length of grain Degree is the important morphological index for determining quality of rice again.Not only yield had been increased but also had improved quality of rice, and be the target that breeder pursues. For the other yield traits of rice, at present about the slightly aobvious lag of the research of grain length gene, the grain length base being really separated to Because also seldom.Excellent genes relevant to grain length are cloned in grass family material, are had to cultivation high yield, Fine Quality Rice Variety Important theory and practical significance.

Summary of the invention

OsJGL2 gene (the GenBank number of logging in XM_015770529.1) is Unknown Function gene in rice, is located at rice On No. 1 chromosome, intronless, mRNA size is 1349bp, and coded sequence (CDS) size is 747bp, and coding includes 248 The albumen (the GenBank number of logging in XP_015626015.1) of a amino acid residue, protein molecular weight 26.72KD, isoelectric point It is 8.1.In the protein sequence, charge residue 78, acidic amino acid 32, basic amino acid 33, polarity ammonia Base acid 55, hydrophobic amino acid 76.GenBank database compares analysis and finds, OsJGL2 protein sequence has presumption DUF1645 conserved domain, with short anther wild rice (XP_006644418.1), two fringe false bromegrass (XP_003569426.1), Sorghum (XP_002456032.1), millet (XP_004969278.1) and corn (NP_001143665.2) protein sequence it is homologous Property respectively reaches 82%, 56%, 61%, 65% and 61%.The sequence of OsJGL2 albumen is as shown in SEQ ID NO.2, OsJGL2 The coding gene sequence of albumen is as shown in SEQ ID NO.3.The present invention constructs the expression vector of albumen OsJGL2, and sequence is such as Shown in SEQ ID NO.1, it is named as carrier pCAMBIA1300+163+OsJGL2, is transformed into rice and is expressed, was found Amount expression rice Os JGL2 gene can cause the extremely significant growth weight gain of rice paddy seed.Compared with wild type, transgenic paddy rice grain length Increase by 7.0%, mass of 1000 kernel weight gain 15.6%.Therefore, albumen OsJGL2 encoding gene can be used for preparing relevant to rice grain length Expression vector.Albumen OsJGL2 can be used for preparing rice grain length regulation preparation.

Detailed description of the invention

The pcr amplification product of Fig. 1 rice Os JGL2 gene；M, Marker；1, PCR product；

The pMD18-T plasmid enzyme restriction of Fig. 2 OsJGL2 is analyzed；M, Marker；C, non-digested plasmid is as control；1,2 difference Represent different plasmid enzyme restriction products；

The structural schematic diagram of Fig. 3 expression vector pCAMBIA1300+163；

Fig. 4 expression vector pCAMBIA1300+163+OsJGL2 digestion identification；M, Marker；C, non-digested plasmid conduct pair According to；1,2,3 different plasmid enzyme restriction products are respectively represented；

Fig. 5 mediated by agriculture bacillus rice transformation；The picture left above is the induction of Rice Callus；Top right plot is after being commissioned to train It supports；Lower-left figure is kanamycin-resistant callus tissue screening；Bottom-right graph is callus differentiation；

The special hygromycin primer identification of Fig. 6 turns OsJGL2 trans-genetic hybrid rice；M, DNA molecular amount standard；1, no template control；2, 3, wild type control；4,5, positive control；6-24, transgenic plant；

Fig. 7 wild type is compared with turning OsJGL2 trans-genetic hybrid rice economical character；Control, rice wild type；OE crosses table Up to strain；*P<0.05,**P<0.01,Student's t test.

Specific embodiment

Gene cloning

PCR cloning primer, the reaction experiments condition such as PCR, cloning vector, source and the restriction endonuclease that may be used, cDNA sun Property clonal analysis

Artificial synthesized pair of primers, and BamHI restriction enzyme site is added at the end of reverse primer 5 ', sequence where forward primer is attached Closely contain NcoI restriction enzyme site, without addition.Primer is as follows:

OsJGL2F:5'ACGCATCGTCACATCACAGAG 3'(21) (SEQ ID NO.4)；

OsJGL2R:5'GGATCC TAGGCTTCAAGTCAAAGGTTCG 3'(28)(BamHI)(SEQ ID NO.5)。

Using this to primer, PCR is carried out by template of the total DNA of rice OryzasativaLcv.Nipponbare.PCR condition are as follows: hot lid temperature 105 DEG C, initial denaturation 95 DEG C of 5min, 95 DEG C of denaturation 45s, 61 DEG C of annealing 45s, 72 DEG C of extension 60s carry out 34 circulations, 72 DEG C of extensions 10min.PCR system is shown in Table 1:

Table 1

Agarose gel electrophoresis is carried out using TAE electrophoretic buffer, the segment (Fig. 1) of about 900bp has been obtained, has been named as OsJGL2。

Above-mentioned OsJGL2 amplified production is subjected to glue recycling with the kit of TIANGEN, is then connected into recycling segment PMD18-T carrier (TAKARA).Linked system such as table 2:

Table 2

2 hours, the competent cell of Transformed E .coli DH5 α are connected, coated plate is screened with ammonia benzyl mycin.Select Dan Ke It is grand, it is identified after extracting plasmid with NcoI and BamHI double digestion, as a result as shown, there is the purpose band (figure of about 1000bp 2).1, No. 2 corresponding bacterium solution sequencing is sent, sequencing result is completely the same with gene order on GenBank.

Gene function verifies detailed process

Original vector and source are expressed, expression original vector constructs the restriction endonuclease that may be used

Clone obtains OsJGL2 gene, is building up to expression vector, the specific steps are as follows: will be connected with OsJGL2 gene Cloning vector pMD18-T and expression vector pCAMBIA1300+163 (Fig. 3) all with BamHI and NcoI carry out double digestion and point Then other recovery purifying is ligated and transformed into E.coli DH5 α with T4 ligase, picking single colonie extracts plasmid after expanding culture, The identification of BamHI and NcoI double digestion, it is final to obtain the Overexpression vector pCAMBIA1300+163+ for being connected with target gene OsJGL2 (Fig. 4).The expression vector of building is transformed into Agrobacterium EHA105 bacterial strain using heat shock method.

Gene transformation method, genetic transformation species

The expression vector of building is transformed into rice SR59 using agrobacterium-mediated transformation, obtains overexpression OsJGL2 base The Transgenic Rice strain of cause.The experimentation is as follows: using the callus of SR59 mature seed induction as receptor, passing through During Agrobacterium, co-cultivation, 2 resistant calli hygromycin step sizing (every time 2 weeks), resistant calli differentiation, life Root, hardening and etc. obtain hygromycin resistance plant (Fig. 5).

Genetically modified plants analysis of molecules

Using hygromycin special primer, PCR detection (Fig. 6) is carried out to hygromycin resistance regeneration plant.It detects mould containing tide 13 plants of the positive strain of plain gene.Primer is as follows:

HptF:5'TTTAGCGAGAGCCTGACCTATTGC 3'(SEQ ID NO.6)；

HptR:5'CGTCAACCAAGCTCTGATAGAGTTG 3'(SEQ ID NO.7)；

Genetically modified plants function phenotype (Fig. 7)

The economical character for turning OsJGL2 trans-genetic hybrid rice to wild type and T1 generation compares observation and statistical analysis.With it is wild The plant height of type is compared, and there was no significant difference for three strains.Compared with the tiller number of wild type, OE-1 and OE-2 strain is significantly high In wild type, there was no significant difference with wild type for OE-3 strain.Compared with the sword-like leave of wild type is long, OE-1 is considerably shorter than wild Type, OE-2 are considerably longer than wild type, and there was no significant difference with wild type for OE-3 strain.Compared with the sword-like leave of wild type is wide, OE-1 It is noticeably greater than wild type with OE-2, there was no significant difference with wild type for OE-3 strain.Compared with the spike length of wild type, three strains There was no significant difference.Compared with the number of grain per ear of wild type, OE-1 and OE-2 strain be substantially less than wild type, OE-3 strain without Significant difference.

Compared with the mass of 1000 kernel of wild type, the extremely significant weight gain of three strains, OE-1 strain weight gain 6.3%, OE-2 strain 13.8%, the OE-3 strain that increases weight weight gain 15.6%.Compared with the grain length of wild type, the extremely significant growth of three strains, OE-1 plants System increases by 8.4%, OE-2 strain and increases by 8.2%, OE-3 strain growth by 7.0%.Compared with the grain of wild type is wide, three strains without Significant difference.Compared with the grain thickness of wild type, there was no significant difference for three strains.

Claims

1. application of the albumen OsJGL2 encoding gene in the expression vector that preparation increases rice grain length；The albumen OsJGL2 is compiled The GenBank accession number of code gene is XM_015770529.1.

2. albumen OsJGL2 increases the application in rice grain length regulation preparation in preparation;The GenBank of the albumen OsJGL2 is stepped on Record number is XP_015626015.1.

3. a kind of expression vector of albumen OsJGL2 relevant to rice grain length, which is characterized in that contain in the expression vector Albumen OsJGL2 encoding gene described in claim 1；The GenBank accession number of the albumen OsJGL2 encoding gene is XM_ 015770529.1。

4. expression vector as claimed in claim 3, which is characterized in that the expression vector sequence as shown in SEQ ID NO.1, It is named as carrier pCAMBIA1300+163+ OsJGL2。