CN106086208A - For detecting vibrio parahaemolyticus and the test kit of integron and method in food - Google Patents
For detecting vibrio parahaemolyticus and the test kit of integron and method in food Download PDFInfo
- Publication number
- CN106086208A CN106086208A CN201610624551.4A CN201610624551A CN106086208A CN 106086208 A CN106086208 A CN 106086208A CN 201610624551 A CN201610624551 A CN 201610624551A CN 106086208 A CN106086208 A CN 106086208A
- Authority
- CN
- China
- Prior art keywords
- integron
- primer
- vibrio parahaemolyticus
- probe
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses and a kind of detect vibrio parahaemolyticus and the primer of integron, probe, test kit and method in food, the sequence of primer is: forward primer VPF:GCCACACTGGAACTGAGACA downstream primer VPR:GGAGTTAGCCGGTGCTTCTT;The sequence of described integron primer is: forward primer int1F:CATCGTCGTAGAGACGTCGG downstream primer Int1R:AGAACAAGCAGGCATCACGA.In test kit of the present invention, primer, probe and other component, cooperation are rationally, easy to use, and detection is quick, accurately;The inventive method is easy and simple to handle, quick, low cost, and testing result is accurate.
Description
Technical field
The present invention relates to a kind of detect vibrio parahaemolyticus and the primer of integron in food, and coordinate with this primer and make
Probe;The invention still further relates to a kind of dual droplet type digital pcr detection kit comprising above-mentioned primer and probe, this
Bright further relate to a kind of use mentioned reagent box detection food in vibrio parahaemolyticus and the method for integron int1.
Background technology
Vibrio parahaemolyticus Vibrio Parahemolyticus, for gram negative bacilli, in arcuation, shaft-like, thread
Deng various shape, anodontia spore.The feed food containing this bacterium can cause alimentary toxicosis, also referred to as halophilic bacteria alimentary toxicosis.Parahemolyticas
Vibrio is a kind of marine bacteria, is mainly derived from the marine products such as fish, shrimp, Eriocheir sinensis, shellfish and Sargassum.Vibrio parahaemolyticus mainly passes through
Food transmission, it generally requires breeding and just can cause a disease to some, typically results in healthy Adult infections's morbidity, needs
Want every gram of food containing having more than 106Individual vibrio parahaemolyticus.Due to mesophilic warm, moist, the hypersaline environment of vibrio parahaemolyticus itself,
Hot summer, seafood consumption increase just beneficially its breeding.
Vibrio parahaemolyticus contaminated food products can have number of ways, and one is to eat or do not boil marine product raw to infect, and this is crowd
Topmost route of infection.Vibrio parahaemolyticus gets final product amount reproduction in albacore, shellfish transport or storage requirement time suitable, fast
Speed reaches carrying capacity of causing a disease;Two is cross-contamination.Cooked food is contained in the container polluted by vibrio parahaemolyticus, or uses
When other food processed by the kitchen tools being contaminated by bacterial, food cross can be caused to pollute, in turn result in into trencherman's Infective.Food
Safe standard GB/T 29921 " pathogenic bacterium limitation in food " regulation, vibrio parahaemolyticus at processed aquatic products, eat Aquatic product raw
Limited Doses in product, instant algae goods three based food is 102-103MPN/g (about 102-103CFU/g, difference exists
Different in the method for inspection).
Britain's public health laboratory food security standard regulation, in food, vibrio parahaemolyticus is satisfied with standard
(Satisfactory standard) is that acceptable standard (Acceptable standard) is 20CFU/g less than 20CFU/g
<100CFU/g.In Holland's marine product, vibrio parahaemolyticus Limited Doses is 100CFU/g.International food microbial standard committee
(ICMSF) standard of 1998 is: should gather 5 parts of samples of inspection during detection vibrio parahaemolyticus in same batch products each
25g, it is desirable to must not have the assay of 3 and above sample between CFU/g, arbitrary sample must not exceed 103CFU/g。。
1989, Strokes proposed the concept of integron first, and within 1991, Hall formally proposes box gene-integron
The concept of system.Integron is the DNA fragmentation of antibacterial, closely related with bacterial drug resistance, be one be present in bacterial plasmid or
Genetic elements system on chromosome, is obtained exogenous gene by the intergrase of self coding and is allowed to express.Integron is caught
Obtain, integrate and express drug resistance gene box, cause drug resistant gene to propagate between Pseudomonas of the same race or the most of the same race, so that antibacterial is resistance to
The property of medicine is able to extensive diffusive.Box gene is by being sheared down during on integron, intergrase is integrated into integron or from integron
Come, make drug resistant gene be propagated and diffusion.
At present, outside existing 130 multidrug resistant gene boxes are identified that integron passes through locus specificity restructuring capture and expresses
Source box gene, thus give Host Strains and various common drug kinds are produced drug resistance.Integron self can be located at joint simultaneously
On the mobility elements such as character grain, transposon, whole integron can be made to be moved.Thus integron is in new Resistant strain
Appearance and drug resistant gene level send out in play very important role.Integron is according to the primary structure of integrase protein
It is broadly divided into 4 classes, but class 1 integron is most common.The present invention is by special for vibrio parahaemolyticus and integron of design
Primer, probe combinations, it may be appreciated that the distribution of vibrio parahaemolyticus and the popularity of integron in bacterial strain in different food products.
At present, varieties of food items safety criterion is desirable that and vibrio parahaemolyticus carries out detection by quantitative, but for secondary haemolysis
Property vibrio detection by quantitative counting mainly or after cultivating by traditional method.And after conventional PCR method needs PCR amplification
Carry out electrophoresis, not only complex operation, and detection by quantitative can not be realized.At present, Southern blot and real time fluorescent quantitative
PCR is conventional two kind copy number of foreign gene analytical technologies, is widely used in copy number of foreign gene analysis.But both sides
Method there is also certain defect.Such as, during Southern blot methods analyst, workload is big, cycle length, operation require high, accurately
Property is poor, and especially for the analysis of multi-copy gene, result is less than normal.Quantitative fluorescent PCR (qRT-PCR) is analyzing external source
Standard curve and the gene of known copy number it is necessarily dependent upon, a kind of relative quantitation method, and standard during gene copy number
The quality of curve is vulnerable to the impact of the factors such as the concentration of DNA purity, primer and probe, the response inhabitation factor;It addition, standard
Curve must be based on standard substance and sets up, and the limitednumber of standard substance and expensive price are not applied for all of research.
Microdroplet digital pcr (droplet digital PCR, ddPCR) is a kind of new absolute quantitation of rising in recent years
Technology, it carries out the nucleic acid quantification counted, is a kind of method of absolute quantitation based on single-molecule PCR method.Main employing is worked as
Micro-fluidic or the microdroplet method of front analytical chemistry hot topic research field, is dispersed to chip by the nucleic acid solution after Macrodilution
In microreactor or microdroplet, the nucleic acid-templated number of each reactor is less than or equal to 1.So after PCR cycle, have
The reactor of one nucleic acid templates will provide fluorescence signal, does not has the reactor of template just not have fluorescence signal.According to
Relative scale and the volume of reactor, it is possible to extrapolate the gene copy number of original solution.
But the analysis work of copy number based on microdroplet digital pcr platform report is less, for vibrio parahaemolyticus and whole
The detection of zygote the most more has no and reports.The present invention, based on droplet type ddPCR platform, establishes vibrio parahaemolyticus and integration thereof
Sub-gene copy number analyzes method, and result of study is that the detection by quantitative analyzing food safety biogenic risks and assumptions provides newly
Method and reference, also provide technical support means for food safety quality control.
Summary of the invention
The invention aims to overcome weak point of the prior art, it is provided that one is used for detecting in food secondary molten
Courageous and upright vibrio and the primer of integron, and with this primer with the use of probe;
Another object of the present invention is to provide a kind of test kit comprising above-mentioned primer and probe, and this test kit is applicable to double
Vibrio parahaemolyticus and integron in weight ddPCR detection food, in test kit, primer, probe and other component, cooperation are rationally,
Easy to use, detection is quick, accurately;
Another object of the present invention is to provide vibrio parahaemolyticus and integration in a kind of employing mentioned reagent box detection food
The method of sub-int1, the method is easy and simple to handle, quick, low cost, and testing result is accurate.
In order to achieve the above object, the present invention uses below scheme:
A kind of detect vibrio parahaemolyticus and the primer of integron in food, it is characterised in that include that vibrio parahaemolyticus is drawn
Thing and integron primer;
The sequence of described vibrio parahaemolyticus primer is:
Forward primer VPF:GCCACACTGGAACTGAGACA
Downstream primer VPR:GGAGTTAGCCGGTGCTTCTT;
The sequence of described integron primer is:
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA.
The present invention and primer described above with the use of probe, it is characterised in that include vibrio parahaemolyticus probe and whole
Zygote probe:
The sequence of described vibrio parahaemolyticus probe is:
Probe VPP:TGCATTATTTGACGTTAGCGAC
Described integron probe sequence is:
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
The present invention is for detecting vibrio parahaemolyticus and the test kit of integron in food, it is characterised in that comprises right and wants
Ask the primer in 1 and the probe in claim 2.
As above for detecting vibrio parahaemolyticus and the test kit of integron in food, it is characterised in that this reagent
In box, 20.0 μ L reaction systems include following components: 2 × ddPCR Super Mix 10.0 μ L, vibrio parahaemolyticus and integron
The each 1.0 μ L of probe, DNA profiling 4.0 μ L of each 1.0 μ L of forward and reverse primer, vibrio parahaemolyticus and the integron int1 of int1.
The present invention detects vibrio parahaemolyticus and the method for integron int1 in food, it is characterised in that include following step
Rapid:
A, extraction sample DNA;
Each reactive component is added 20.0 μ l reaction systems as claimed in claim 4, is subsequently adding 70.0 μ l mineral oil,
Transfer to automatically generate on drop generator microdroplet after mixing;Take the positive quality control in test kit and negative Quality Control the most respectively,
Prepare corresponding DNA profiling;
B, digital pcr mixed liquor ddPCR Super Mix is fabricated to the micro-reaction system of Water-In-Oil PCR, and all shifts
In 96 hole Sptting plate PCR reaction tubes;Again by 96 hole Sptting plate PCR reaction tubes at sealer instrument upper sealing film, it is placed in regular-PCR instrument
Carry out PCR reaction;
C, opening microdroplet fluorescence detector application software, 96 hole Sptting plate PCR reaction tubes after PCR reaction being terminated are direct
Insertion equipment, detects the PCR response situation of microdroplet in each 96 hole Sptting plate PCR reaction tubes, finally according to amber pine distribution law
Calculate the copy number of testing gene.
Vibrio parahaemolyticus and the method for integron int1 in food detected as described above, it is characterised in that PCR in step C
The response procedures of amplification sequentially includes the following steps:
(1) 94 DEG C of denaturation 3min;
(2) 94 DEG C of degeneration 10s, 60 DEG C of annealing 1min, carry out 40 circulations altogether;
(3) 98 DEG C of enzyme heat inactivation 10min;
(4) 4 DEG C of stopped reaction.
Vibrio parahaemolyticus and the method for integron int1 in food detected as described above, it is characterised in that institute in step A
State and extract specifically comprising the following steps that of sample DNA
Take 1.5mL culture 10000rpm and be centrifuged 2min;Precipitate adds the TE buffer of 500 μ L, and piping and druming is allowed to repeatedly
Eddy diffusion, adds 30 μ L 10%SDS, and mixing, in 37 DEG C of incubation 1h;Add 100 μ L 5mol/L NaCl, fully mix, then
Add 80ul CTAB/NaCl solution, 65 DEG C of incubation 10min again after mixing;Add isopyknic phenol/chloroform/isoamyl alcohol mixing,
Centrifugal 4-5min, proceeds in a new pipe by supernatant, adds the isopropanol of 0.8 times of volume, is gently mixed under precipitating until DNA
Come;After 70% washing with alcohol of precipitation 1mL, add TE solution dissolution precipitation.
Vibrio parahaemolyticus and the method for integron int1 in food detected as described above, it is characterised in that it is characterized in that
Step B takes positive quality control identical with the method in step A with the method that corresponding DNA profiling is prepared in negative Quality Control.
Sensitivity and Specificity test in the present invention:
Using the methods such as order-checking that positive amplification product carries out sequence verification, result positive amplification Product Sequence is carried out
When Blast compares, sequence all with Genbank aim sequence very high homology.10 times of reference strain genomic DNAs diluted are added
Previous reaction system, repeats have fine repeatability in test display detection sample.Dilute template concentrations logarithm value and copy
Also in good linear relationship R between shellfish numerical value2≥0.95.Illustrate that the method has preferable degree of accuracy and good stablizing
Property.
The present invention compared with prior art, has the advantage that
1) reagent constituents of the present invention and reasonable mixture ratio, easy to use, and detection is quick, accurately, it is adaptable to ddPCR quantitatively examines
Survey vibrio parahaemolyticus and integron (int1);
2) detection method simplifies testing process, and without making standard curve, substantially reduces detection week
Phase, the detection time cultivates method of counting than tradition and shortens about two days;
3) the whole process of detection method is without using standard curve, and direct with new-generation sequencing slitless connection,
Gene copy number can be performed absolute quantification analysis.
4) digital pcr detecting system is processed by microdroplet, can greatly reduce the interference of background and substrate, and sensitivity can
With as little as 1 copy, therefore, the slight change to low concentration mrna concentration carries out accurate and repeated good detection.
5) use detection method can realize vibrio parahaemolyticus and integron simultaneously in same reaction system to enter
Row precisely detection, easy and simple to handle, quick.There is preferable industrialization prospect.
Detailed description of the invention
Below in conjunction with detailed description of the invention, the present invention is described further:
Embodiment 1
The present invention detects vibrio parahaemolyticus and the primer of integron (int1) in food, and the sequence of this primer is respectively as follows:
Forward primer VPF:GCCACACTGGAACTGAGACA
Downstream primer VPR:GGAGTTAGCCGGTGCTTCTT
Probe VPP:TGCATTATTTGACGTTAGCGAC
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
Embodiment 2
The present invention is a kind of detects vibrio parahaemolyticus and the test kit of integron int1 in food, wherein 20 μ L reaction system
Including following components:
The each 1.0 μ L of 2 × ddPCR Super Mix 10.0 μ L, vibrio parahaemolyticus and the forward and reverse primer of int1, probe are each
1.0 μ L, DNA profiling 4.0 μ L.
Wherein primer sequence is as follows:
Forward primer VPF:GCCACACTGGAACTGAGACA
Downstream primer VPR:GGAGTTAGCCGGTGCTTCTT
Probe VPP:TGCATTATTTGACGTTAGCGAC
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
Embodiment 3
The present invention detects vibrio parahaemolyticus and the method for integron int1 in food, comprises the following steps:
A, extraction sample DNA;
Each reactive component is added 20.0 μ l reaction systems, is subsequently adding 70.0 μ l mineral oil, after mixing, transfers to microdroplet
Microdroplet is automatically generated on generator;
Wherein 20 μ L reaction systems include following components:
The each 1.0 μ L of 2 × ddPCR Super Mix 10.0 μ L, vibrio parahaemolyticus and the forward and reverse primer of int1, probe are each
1.0 μ L, DNA profiling 4.0 μ L.
Wherein primer sequence is as follows:
Forward primer VPF:GCCACACTGGAACTGAGACA
Downstream primer VPR:GGAGTTAGCCGGTGCTTCTT
Probe VPP:TGCATTATTTGACGTTAGCGAC
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
B, the microdroplet of generation is carefully transferred completely in 96 hole Sptting plate PCR reaction tubes;Again by 96 hole Sptting plates in envelope
Film instrument upper sealing film, is placed in regular-PCR instrument and carries out PCR reaction.
C, opening microdroplet fluorescence detector application software, 96 hole Sptting plates after PCR reaction being terminated are inserted directly into equipment,
Detect the PCR response situation of microdroplet in every PCR reaction tube, calculate the copy number of testing gene finally according to amber pine distribution law.
Described fluorescent PCR amplification sequentially includes the following steps:
(1) 94 DEG C of denaturation 3min;
(2) 94 DEG C of degeneration 10s, 60 DEG C of annealing 1min, carry out 40 circulations altogether;
(3) 98 DEG C of enzyme heat inactivation 10min;
(4) 4 DEG C of stopped reaction.
Embodiment 4
Increase bacterium sample before weighing 1g, wherein can adjust sample size according to the DNA content of sample, join the centrifugal of 50mL
Guan Zhong;Add 5mL extract with CTAB liquid and 20 μ L Proteinase K Solution, fully mix.Hatch 30min, frequently vibrate for 65 DEG C;Water suction
Property big food samples, add extract with CTAB liquid amount should according to liquid level whether can cover sample and have more a little depending on;65℃
After overnight, 8000r/min room temperature is centrifuged 10min, takes 1ml supernatant and enters in 2ml centrifuge tube;Firmly shake after adding 700 μ L chloroforms
Swinging, 13000g is centrifuged 10min, in transfer supernatant 600 μ L to new 2ml centrifuge tube;Add the CTAB precipitation solution of 2 times of volumes
Reverse rear chamber is gentle and quiet for several times puts 60min, and 13000 × g is centrifuged 10min, supernatant discarded, adds 350 μ L NaCl solution and precipitation is entered
Row suspends, and adds 350 μ L chloroforms, and vortex oscillation mixes, and 13000g is centrifuged 10min, adds 0.8 times of body after transfer supernatant
Long-pending isopropanol is used for precipitate nucleic acids, and room temperature is placed 20min, 13000g and is centrifuged 10min, supernatant discarded, adds 500 μ L 70%
Ethanol solution washing precipitation, is dissolved in 50 μ L TE solution.Then take 4.0 μ L extracts and join following reaction system,
The each 1.0 μ L of wherein 2 × ddPCR Super Mix 10.0 μ L, vibrio parahaemolyticus and (int1) forward and reverse primer,
The each 1.0 μ L of probe, DNA profiling 4.0 μ L.Wherein primer sequence is as follows:
Forward primer 1, VPF:GCCACACTGGAACTGAGACA
Downstream primer 1, VPR:GGAGTTAGCCGGTGCTTCTT
Probe 1, VPP:TGCATTATTTGACGTTAGCGAC
Forward primer 2, int1F:CATCGTCGTAGAGACGTCGG
Downstream primer 2, Int1R:AGAACAAGCAGGCATCACGA
Probe 2, Int1P:AGGGTGTGCGGTGTGGCGGGC.
Carry out PCR amplification, sequentially include the following steps:
(1) 94 DEG C of denaturation 3min;
(2) 94 DEG C of degeneration 10s, 60 DEG C of annealing 1min, carry out 40 circulations altogether;
(3) 98 DEG C of enzyme heat inactivation 10min;
(4) 4 DEG C of stopped reaction.
In order to prove the accuracy of detection method, the present invention has made comparative testing below: be respectively adopted the present invention
Detection method and colony counting method GB 4789.7-2013 " national food safety standard food microbiological examination parahemolyticas arc
Bacterium is checked " carry out the comparison of vibrio parahaemolyticus quantitative measurement.Concrete experimental implementation is all carried out according to standard test numerical value, real
Test in triplicate, results averaged.Result is as shown in table 1, from the results, it was seen that the present invention uses digital pcr method pair
The measurement result of coliform quantity in food, compared with existing GB4789.7-2013,10 parts of samples, mean error is
1.8%, this explanation the inventive method has the highest accuracy.It addition, digital pcr of the present invention is enjoyed oneself to the full, single sample of method is omnidistance
The detection time is 4 hours, and method of counting cultivated by the most existing traditional flat board, and while detecting vibrio parahaemolyticus,
Its integron well can also be detected, it is possible to accurately Fast Evaluation food-borne pathogens and pathogenic bacterium carry drug resistant gene
Propagation risk.Therefore there is good technical advantage and Developmental Prospect of Industrialization.
Table 1
The ultimate principle of the present invention and principal character and advantages of the present invention have more than been shown and described.The skill of the industry
The art personnel simply explanation it should be appreciated that the present invention is not restricted to the described embodiments, described in above-described embodiment and description
The principle of the present invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, these
Changes and improvements both fall within scope of the claimed invention.Claimed scope by appending claims and
Its equivalent defines.
Claims (8)
1. one kind is detected vibrio parahaemolyticus and the primer of integron in food, it is characterised in that include vibrio parahaemolyticus primer
With integron primer;
The sequence of described vibrio parahaemolyticus primer is:
Forward primer VPF:GCCACACTGGAACTGAGACA
Downstream primer VPR:GGAGTTAGCCGGTGCTTCTT;
The sequence of described integron primer is:
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA.
2. with claim 1 described in primer with the use of probe, it is characterised in that include vibrio parahaemolyticus probe and integration
Sub-probe:
The sequence of described vibrio parahaemolyticus probe is:
Probe VPP:TGCATTATTTGACGTTAGCGAC
Described integron probe sequence is
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
3. for detecting the test kit of vibrio parahaemolyticus and integron, it is characterised in that comprise the primer in claim 1 and
Probe in claim 2.
4. according to the test kit for detecting vibrio parahaemolyticus and integron described in right 3, it is characterised in that this test kit
In 20.0 μ L reaction systems include following components: 2 × ddPCR Super Mix10.0 μ L, vibrio parahaemolyticus and integron
The each 1.0 μ L of probe, DNA profiling 4.0 μ L of each 1.0 μ L of forward and reverse primer, vibrio parahaemolyticus and the integron int1 of int1.
5. detection vibrio parahaemolyticus and the method for integron int1, it is characterised in that comprise the following steps:
A, extraction sample DNA;
Each reactive component is added 20.0 μ l reaction systems as claimed in claim 4, is subsequently adding 70.0 μ l mineral oil, mixing
After transfer to automatically generate on drop generator microdroplet;Take the positive quality control in test kit and negative Quality Control, preparation the most respectively
Corresponding DNA profiling;
B, digital pcr mixed liquor ddPCR Super Mix is fabricated to the micro-reaction system of Water-In-Oil PCR, and is transferred completely into 96
In the Sptting plate PCR reaction tube of hole;Again by 96 hole Sptting plate PCR reaction tubes at sealer instrument upper sealing film, it is placed in regular-PCR instrument and carries out
PCR reacts;
C, opening microdroplet fluorescence detector application software, 96 hole Sptting plate PCR reaction tubes after PCR reaction being terminated are inserted directly into
Equipment, detects the PCR response situation of microdroplet in each 96 hole Sptting plate PCR reaction tubes, calculates finally according to amber pine distribution law
The copy number of testing gene.
Detection vibrio parahaemolyticus and the method for integron int1 the most according to claim 5, it is characterised in that in step C
The response procedures of PCR amplification sequentially includes the following steps:
(1) 94 DEG C of denaturation 3min;
(2) 94 DEG C of degeneration 10s, 60 DEG C of annealing 1min, carry out 40 circulations altogether;
(3) 98 DEG C of enzyme heat inactivation 10min;
(4) 4 DEG C of stopped reaction.
Detection vibrio parahaemolyticus and the method for integron int1 the most according to claim 5, it is characterised in that institute in step A
State and extract specifically comprising the following steps that of sample DNA
Take 1.5mL culture 10000rpm and be centrifuged 2min;Precipitate adds the TE buffer of 500 μ L, and piping and druming is allowed to again repeatedly
Suspending, add 30 μ L 10%SDS, mixing, in 37 DEG C of incubation 1h;Add 100 μ L 5mol/L NaCl, fully mix, add
80ul CTAB/NaCl solution, 65 DEG C of incubation 10min again after mixing;Add isopyknic phenol/chloroform/isoamyl alcohol mixing, centrifugal
4-5min, proceeds in a new pipe by supernatant, adds the isopropanol of 0.8 times of volume, is gently mixed until DNA precipitates;Heavy
After 70% washing with alcohol of shallow lake 1mL, add TE solution dissolution precipitation.
Detection vibrio parahaemolyticus and the method for integron int1 the most according to claim 5, it is characterised in that its feature exists
Positive quality control is taken identical with the method in step A with the method that corresponding DNA profiling is prepared in negative Quality Control in step B.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610624551.4A CN106086208A (en) | 2016-07-29 | 2016-07-29 | For detecting vibrio parahaemolyticus and the test kit of integron and method in food |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610624551.4A CN106086208A (en) | 2016-07-29 | 2016-07-29 | For detecting vibrio parahaemolyticus and the test kit of integron and method in food |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106086208A true CN106086208A (en) | 2016-11-09 |
Family
ID=57453897
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610624551.4A Pending CN106086208A (en) | 2016-07-29 | 2016-07-29 | For detecting vibrio parahaemolyticus and the test kit of integron and method in food |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106086208A (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107419014A (en) * | 2017-07-17 | 2017-12-01 | 蔡先全 | Detect pseudomonas aeruginosa and aprA primer, kit and method in water |
CN107475374A (en) * | 2017-08-01 | 2017-12-15 | 北京出入境检验检疫局检验检疫技术中心 | The kit and detection method of Vibrio vulnificus in a kind of accurate quantification detection food |
CN109022549A (en) * | 2018-08-21 | 2018-12-18 | 广东出入境检验检疫局检验检疫技术中心 | The method of PMA vibrio parahemolyticus living cells bacterium in quantitative detection food in conjunction with droplet type digital pcr |
CN109762917A (en) * | 2019-03-28 | 2019-05-17 | 广东省实验动物监测所 | Multiple liquid phase genetic chip primer, kit and its analysis method a kind of while that detect 5 Sulfonamides-resistant genes |
CN110951899A (en) * | 2020-01-03 | 2020-04-03 | 广东顺德工业设计研究院(广东顺德创新设计研究院) | PCR detection system, kit and detection method for detecting vibrio parahaemolyticus |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104894283A (en) * | 2015-06-25 | 2015-09-09 | 蔡先全 | Primer, reagent box and method for detecting salmonella and integron (int) |
-
2016
- 2016-07-29 CN CN201610624551.4A patent/CN106086208A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104894283A (en) * | 2015-06-25 | 2015-09-09 | 蔡先全 | Primer, reagent box and method for detecting salmonella and integron (int) |
Non-Patent Citations (1)
Title |
---|
MICHAEL J. ROTHROCK JR.等: "Quantification of Zoonotic Bacterial Pathogens within Commercial Poultry Processing Water Samples Using Droplet Digital PCR", 《ADVANCES IN MICROBIOLOGY》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107419014A (en) * | 2017-07-17 | 2017-12-01 | 蔡先全 | Detect pseudomonas aeruginosa and aprA primer, kit and method in water |
CN107475374A (en) * | 2017-08-01 | 2017-12-15 | 北京出入境检验检疫局检验检疫技术中心 | The kit and detection method of Vibrio vulnificus in a kind of accurate quantification detection food |
CN109022549A (en) * | 2018-08-21 | 2018-12-18 | 广东出入境检验检疫局检验检疫技术中心 | The method of PMA vibrio parahemolyticus living cells bacterium in quantitative detection food in conjunction with droplet type digital pcr |
CN109762917A (en) * | 2019-03-28 | 2019-05-17 | 广东省实验动物监测所 | Multiple liquid phase genetic chip primer, kit and its analysis method a kind of while that detect 5 Sulfonamides-resistant genes |
CN110951899A (en) * | 2020-01-03 | 2020-04-03 | 广东顺德工业设计研究院(广东顺德创新设计研究院) | PCR detection system, kit and detection method for detecting vibrio parahaemolyticus |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106086208A (en) | For detecting vibrio parahaemolyticus and the test kit of integron and method in food | |
CN106048052A (en) | Kit and method for detecting staphylococcus aureus and integron in food | |
CN104388573B (en) | Utilize cross primer and the method for double probe constant-temperature amplification detection beef derived components | |
CN106048022A (en) | Kit for detecting enterocytozoonhepatopenaei | |
CN101892300A (en) | Klebsiella pneumoniae detection kit and use method thereof | |
CN101586169B (en) | Porcine circovirus 2 LAMP detection kit and detecting method | |
CN106148534A (en) | For detecting shigella and the test kit of integron and method in food | |
CN101368204B (en) | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique | |
CN101570780B (en) | Detection kit and detection method for brucellae in meat products | |
CN102676664A (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
CN104878116A (en) | Quantitative determination method for pathogenic bacteria in food | |
CN101624624B (en) | Detection kit for salmonella and shigella in feeds and detection method thereof | |
CN102978282B (en) | Typhoid fever salmonella and salmonella paratyphi fluorescent quantitative polymerase chain reaction (PCR) detection kit and application thereof | |
CN105274199A (en) | A reagent kit simultaneously detecting Staphylococcus aureus and Cronobacter sakazakii, and usage method thereof | |
CN107513562A (en) | Detect pseudomonas aeruginosa and ExoU primer, kit and method in water | |
CN101570781B (en) | Detection kit and species-based detection method for lactobacilli | |
CN106244685A (en) | For detecting test kit and the method for Salmonella in Food and integron | |
CN109022549A (en) | The method of PMA vibrio parahemolyticus living cells bacterium in quantitative detection food in conjunction with droplet type digital pcr | |
CN106148536A (en) | For detecting test kit and the method for Escherichia Coli in Food and integron | |
CN107727863A (en) | The detection method of endotoxin content in yeast extract | |
CN102605069B (en) | Enterohemorrhagic Escherichia coli O104: H4 detection kit and use method thereof | |
CN110964849B (en) | Method for eliminating African swine fever virus detection false positive and kit for detecting African swine fever virus | |
CN104894232A (en) | Citrobacter freundii fluorescent quantitative PCR diagnostic reagent kit | |
CN107447001A (en) | Detect pseudomonas aeruginosa and ExoS primer, kit and method in water | |
CN104178575B (en) | Method and the kit of a kind of quick discriminating campylobacter fetus and venereal disease subspecies |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161109 |
|
RJ01 | Rejection of invention patent application after publication |