CN106244685A - For detecting test kit and the method for Salmonella in Food and integron - Google Patents
For detecting test kit and the method for Salmonella in Food and integron Download PDFInfo
- Publication number
- CN106244685A CN106244685A CN201610617394.4A CN201610617394A CN106244685A CN 106244685 A CN106244685 A CN 106244685A CN 201610617394 A CN201610617394 A CN 201610617394A CN 106244685 A CN106244685 A CN 106244685A
- Authority
- CN
- China
- Prior art keywords
- integron
- salmonella
- primer
- probe
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses and a kind of detect Salmonella in Food and the primer of integron, probe, test kit and method, the sequence of primer is: forward primer SLMF:AGACCAAAGAGGGGGACCTT downstream primer SLMR:TTGGTGAGCCGTTACCTCAC；The sequence of described integron primer is: forward primer int1F:CATCGTCGTAGAGACGTCGG downstream primer Int1R:AGAACAAGCAGGCATCACGA.In test kit of the present invention, primer, probe, other component, reasonable mixture ratio, easy to use, and detection is quick, accurately, it is adaptable to dual ddPCR detection Salmonella in Food and integron int1；Detection method is easy and simple to handle, quick, low cost, and testing result is accurate.
Description
Technical field
The present invention relates to a kind of detect in food and the primer of integron int1 and probe；The invention still further relates to a kind of bag
Containing above-mentioned primer and the dual droplet type digital pcr detection kit of probe, the invention still further relates to a kind of employing mentioned reagent box
Detection Salmonella in Food and the method for integron int1.
Background technology
Salmonella belongs to Salmonella Salmonella, is that a group is at morphosis, cultural character, biochemical characteristic
The gram negative bacilli very much like with aspects such as antigen constructs.Salmonella poisoning is because a certain amount of viable bacteria that ingested,
These viable bacterias are again in human body caused by growth and breeding.Although egg, poultry and meat products are the main biographies that Salmonella is caused a disease
Broadcast medium, but in recent years, the food origin disease caused by salmonella-polluted instant food particularly marine product is the most repeatedly sent out
Raw.As a example by the U.S., in April, 2008, the U.S. reports in 43 states that 1442 examples are holy because of the food-borne eating Fructus Lycopersici esculenti raw and Fructus Capsici causes
Borrow's Salmonella infection, the same year, JIUYUE, because of the peanut butter polluted by Salmonella typhimurium of taking food, caused 44 state 642 examples husky
Salmonella infects door.In May, 2010, because feed is caused epidemic situation by salmonella-polluted egg, by JIUYUE, various places, the whole America are made a definite diagnosis
2000 many cases Salmonella cases, recall 500,000,000, problem egg, cause huge economic loss.In July, 2012, because of edible quilt
The Diet_induced obesity that Bareilly Salmonella and the salmonella-polluted tuna of Nchanga cause, involves 28 states of the U.S.,
Patient diagnosed 425 example, the report that 55 examples hospitalization American Centers for Disease Control and Prevention (CDC) are issued shows.2015, the U.S.
11 state outburst Salmonella infections, arch-criminal is the tuna sushi that people like.State food pharmaceuticals administration a few days ago is total
Office issues the 12nd phase in 2015 " food safety risk parsing ", and tissue relevant expert understands salmonella food poisoning event.
Salmonella is Main Pathogenic Bacteria in the whole world and China's food, and various countries generally propose the limitation requirement of these pathogenic bacterium.
GB29921-2013 " pathogenic bacterium limitation in food " drafts Salmonella regulation in group combing China foodstuffs standard, reference
The international organizations such as CAC, ICMSF, European Union, Australia and New Zealand, the U.S., Canada, Hong Kong, Taiwan, countries and regions
All 11 based foods are arranged Salmonella according to two grades of sampling plans and limit by maximum limits for Salmonella and regulation in instant food
Gauge is fixed, specially n=5, c=0, m=0 (i.e. in 5 parts of tested samples, do not allow arbitrary sample to detect Salmonella).
1989, Strokes proposed the concept of integron first, and 1991, Hall formally proposed box gene-integration
The concept of subsystem.Integron is the DNA fragmentation of antibacterial, closely related with bacterial drug resistance, is that one is present in bacterial plasmid
Or the genetic elements system on chromosome, obtain exogenous gene by the intergrase of self coding and be allowed to express.Integron
Capture, integrate and express drug resistance gene box, cause drug resistant gene to propagate between Pseudomonas of the same race or the most of the same race, so that antibacterial
Drug resistance is able to extensive diffusive.Box gene is by being sheared during on integron, intergrase is integrated into integron or from integron
Get off, make drug resistant gene be propagated and diffusion.
At present, outside existing 130 multidrug resistant gene boxes are identified that integron passes through locus specificity restructuring capture and expresses
Source box gene, thus give Host Strains and various common drug kinds are produced drug resistance.Integron self can be located at joint simultaneously
On the mobility elements such as character grain, transposon, whole integron can be made to be moved.Thus integron is in new Resistant strain
Appearance and drug resistant gene level send out in play very important role.Integron is according to the primary structure of integrase protein
It is broadly divided into 4 classes, but class 1 integron is most common.The present invention by design for Salmonella and the special primer of integron,
Probe combinations, it may be appreciated that the distribution of Salmonella and the popularity of integron in bacterial strain in different food products.
At present, varieties of food items safety criterion is desirable that and detects Salmonella, but quantitative for Salmonella
Isolation identification after detecting mainly or being cultivated by traditional method.And conventional PCR method carries out electricity after needing PCR amplification
Swimming, not only complex operation, and detection by quantitative can not be realized.At present, Southern blot and real-time fluorescence quantitative PCR are
Two kinds of conventional copy number of foreign gene analytical technologies, are widely used in copy number of foreign gene analysis.But both approaches is also
There is certain defect.Such as, during Southern blot methods analyst, workload is big, cycle length, operation require that high, accuracy is relatively
Difference, especially for the analysis of multi-copy gene, result is less than normal.Quantitative fluorescent PCR (qRT-PCR) is analyzing exogenous gene
Standard curve and the gene of known copy number it is necessarily dependent upon, a kind of relative quantitation method, and standard curve during copy number
Quality be vulnerable to the factors such as the concentration of DNA purity, primer and probe, the response inhabitation factor impact；It addition, standard curve
Must be based on standard substance to set up, and the limitednumber of standard substance and expensive price are not applied for all of research.
Microdroplet digital pcr (droplet digital PCR, ddPCR) is a kind of new absolute quantitation of rising in recent years
Technology, it carries out the nucleic acid quantification counted, is a kind of method of absolute quantitation based on single-molecule PCR method.Main employing is worked as
Micro-fluidic or the microdroplet method of front analytical chemistry hot topic research field, is dispersed to chip by the nucleic acid solution after Macrodilution
In microreactor or microdroplet, the nucleic acid-templated number of each reactor is less than or equal to 1.So after PCR cycle, have
The reactor of one nucleic acid templates will provide fluorescence signal, does not has the reactor of template just not have fluorescence signal.According to
Relative scale and the volume of reactor, it is possible to extrapolate the gene copy number of original solution.
But the analysis work of copy number based on microdroplet digital pcr platform report is less, for Salmonella and integron
Detection the most more have no and report.The present invention, based on droplet type ddPCR platform, establishes Salmonella and integron genes is copied
Shellfish number analyze method, result of study be analyze food safety biogenic risks and assumptions detection by quantitative provide new method and
Use for reference, also provide technical support means for food safety quality control.
Summary of the invention
The invention aims to overcome weak point of the prior art, it is provided that one is used for detecting sramana in food
Salmonella and the primer of integron int1 and probe；
It is a further object to provide a kind of test kit comprising above-mentioned primer and probe；This test kit draws
Thing, probe, other component, reasonable mixture ratio, easy to use, detection is quick, accurately, it is adaptable to husky in dual ddPCR detection food
Door Salmonella and integron int1；
Another object of the present invention is to provide a kind of employing mentioned reagent box detection Salmonella in Food and integron
The method of int1, the method is easy and simple to handle, quick, low cost, and testing result is accurate.
In order to achieve the above object, the present invention uses below scheme:
A kind of primer detecting Salmonella in Food and integron, it is characterised in that include Salmonella primer and whole
Zygote primer；
The sequence of described Salmonella primer is:
Forward primer SLMF:AGACCAAAGAGGGGGACCTT
Downstream primer SLMR:TTGGTGAGCCGTTACCTCAC；
The sequence of described integron primer is:
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA.
The present invention and primer described above with the use of probe, it is characterised in that include Salmonella probe and integration
Sub-probe:
The sequence of described Salmonella probe is:
Probe SLMP:AGATGGGATTAGCTTGTT
The sequence of described integron probe is:
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
For detecting the test kit of Salmonella and integron, it is characterised in that comprise primer described above with described above
Probe.
It is previously discussed for detecting Salmonella and the test kit of integron, it is characterised in that in this test kit, 20.0 μ L are anti-
System is answered to include following components: 2 × ddPCR Super Mix 10.0 μ L, staphylococcus aureus and integron int1's is positive and negative
To each 1.0 μ L of probe, DNA profiling 4.0 μ L of each 1.0 μ L of primer, staphylococcus aureus and integron int1.
The present invention detects the method for Salmonella and integron, it is characterised in that comprise the following steps:
A, extraction sample DNA；
B, by each reactive component add 20.0 μ l reaction systems as above, be subsequently adding 70.0 μ l mineral oil, mixing
After transfer to automatically generate on drop generator microdroplet；Take the positive quality control in test kit and negative Quality Control, preparation the most respectively
Corresponding DNA profiling；
C, digital pcr mixed liquor ddPCR Super Mix is fabricated to the micro-reaction system of Water-In-Oil PCR, and all shifts
In 96 hole Sptting plate PCR reaction tubes；Again by 96 hole Sptting plate PCR reaction tubes at sealer instrument upper sealing film, it is placed in regular-PCR instrument
Carry out PCR reaction；
D, opening microdroplet fluorescence detector application software, 96 hole Sptting plate PCR reaction tubes after PCR reaction being terminated are direct
Insertion equipment, detects the PCR response situation of microdroplet in each 96 hole Sptting plate PCR reaction tubes, finally according to amber pine distribution law
Calculate the copy number of testing gene.
Salmonella detected as described above and the method for integron, it is characterised in that the response procedures of PCR amplification in step C
Sequentially include the following steps:
(1) 94 DEG C of denaturation 3min；
(2) 94 DEG C of degeneration 10s, 59 DEG C of annealing 1min, carry out 40 circulations altogether；
(3) 98 DEG C of enzyme heat inactivation 10min；
(4) 4 DEG C of stopped reaction.
Salmonella detected as described above and the method for integron, it is characterised in that described in step A, extract sample DNA
Specifically comprise the following steps that
Take 1.5mL culture 10000rpm and be centrifuged 2min；Precipitate adds the TE buffer of 500 μ L, and piping and druming is allowed to repeatedly
Eddy diffusion, adds 30 μ L 10%SDS, and mixing, in 37 DEG C of incubation 1h；Add 100 μ L 5mol/L NaCl, fully mix, then
Add 80ul CTAB/NaCl solution, 65 DEG C of incubation 10min again after mixing；Add isopyknic phenol/chloroform/isoamyl alcohol mixing,
Centrifugal 4-5min, proceeds in a new pipe by supernatant, adds the isopropanol of 0.8 times of volume, is gently mixed under precipitating until DNA
Come；After 70% washing with alcohol of precipitation 1mL, add TE solution dissolution precipitation.
Salmonella detected as described above and the method for integron, it is characterised in that in step B, take positive quality control and feminine gender
The method that corresponding DNA profiling is prepared in Quality Control is identical with the method in step A.
Sensitivity and Specificity test in the present invention:
Using the methods such as order-checking that positive amplification product carries out sequence verification, result positive amplification Product Sequence is carried out
When Blast compares, sequence all with Genbank aim sequence very high homology.10 times of reference strain genomic DNAs diluted are added
Previous reaction system, repeats have fine repeatability in test display detection sample.Dilute template concentrations logarithm value and copy
Also in good linear relationship R between shellfish numerical value2≥0.95.Illustrate that the method has preferable degree of accuracy and good stablizing
Property.
The present invention compared with prior art, has the advantage that
1) reagent constituents of the present invention and reasonable mixture ratio, easy to use, and detection is quick, accurately, it is adaptable to ddPCR quantitatively examines
Survey Salmonella and integron (int1)；
2) detection method simplifies testing process, and without making standard curve, substantially reduces detection week
Phase, the detection time cultivates method of counting than tradition and shortens about two days；
3) the whole process of detection method is without using standard curve, and direct with new-generation sequencing slitless connection,
Gene copy number can be performed absolute quantification analysis.
4) digital pcr detecting system is processed by microdroplet, can greatly reduce the interference of background and substrate, and sensitivity can
With as little as 1 copy, therefore, the slight change to low concentration mrna concentration carries out accurate and repeated good detection.
5) use detection method can realize Salmonella and integron simultaneously in same reaction system and carry out essence
Quasi-detection, easy and simple to handle, quick.There is preferable industrialization prospect.
Detailed description of the invention
Below in conjunction with detailed description of the invention, the present invention is described further:
Embodiment 1
The present invention detects Salmonella in Food and the primer of integron (int1), and the sequence of this primer is respectively as follows:
Forward primer SLMF:AGACCAAAGAGGGGGACCTT
Downstream primer SLMR:TTGGTGAGCCGTTACCTCAC
Probe SLMP:AGATGGGATTAGCTTGTT
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC
Embodiment 2
A kind of test kit detecting Salmonella in Food and integron int1 of the present invention, wherein 20 μ L reaction systems include
Following components:
The each 1.0 μ L of 2 × ddPCR Super Mix 10.0 μ L, Salmonella and the forward and reverse primer of integron int1, probe
Each 1.0 μ L, DNA profiling 4.0 μ L.
Wherein the sequence of primer and probe is as follows:
Forward primer SLMF:AGACCAAAGAGGGGGACCTT
Downstream primer SLMR:TTGGTGAGCCGTTACCTCAC
Probe SLMP:AGATGGGATTAGCTTGTT
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
Embodiment 3
The present invention detects Salmonella in Food and the method for integron int1, comprises the following steps:
A, extraction sample DNA；
B, each reactive component is added 20.0 μ l reaction systems, be subsequently adding 70.0 μ l mineral oil, transfer to micro-after mixing
Drip and automatically generate microdroplet on generator；
20 μ L reaction systems include following components:
The each 1.0 μ L of 2 × ddPCR Super Mix 10.0 μ L, Salmonella and the forward and reverse primer of integron int1, probe
Each 1.0 μ L, DNA profiling 4.0 μ L.
Wherein the sequence of primer and probe is as follows:
Forward primer SLMF:AGACCAAAGAGGGGGACCTT
Downstream primer SLMR:TTGGTGAGCCGTTACCTCAC
Probe SLMP:AGATGGGATTAGCTTGTT
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
B, the microdroplet of generation is carefully transferred completely in 96 hole Sptting plate PCR reaction tubes；Again by 96 hole Sptting plates in envelope
Film instrument upper sealing film, is placed in regular-PCR instrument and carries out PCR reaction.
C, opening microdroplet fluorescence detector application software, 96 hole Sptting plates after PCR reaction being terminated are inserted directly into equipment,
Detect the PCR response situation of microdroplet in every PCR reaction tube, calculate the copy number of testing gene finally according to amber pine distribution law.
Described fluorescent PCR amplification sequentially includes the following steps:
(1) 94 DEG C of denaturation 3min；
(2) 94 DEG C of degeneration 10s, 59 DEG C of annealing 1min, carry out 40 circulations altogether；
(3) 98 DEG C of enzyme heat inactivation 10min；
(4) 4 DEG C of stopped reaction.
Embodiment 4
Increase bacterium sample before weighing 1g, wherein can adjust sample size according to the DNA content of sample, join the centrifugal of 50mL
Guan Zhong；Add 5mL extract with CTAB liquid, fully mix.Hatch 30min, frequently vibrate for 65 DEG C；The food samples that water absorption is big, adds
Enter extract with CTAB liquid amount should according to liquid level whether can cover sample and have more a little depending on；65 DEG C overnight after, 8000r/min room
The centrifugal 10min of temperature, takes 1ml supernatant and enters in 2ml centrifuge tube；Using forced oscillation after adding 700 μ L chloroforms, 13000g is centrifuged 10min,
Transfer supernatant 600 μ L is in new 2ml centrifuge tube；Adding the CTAB precipitation solution of 2 times of volumes, reverse rear chamber is gentle and quiet for several times puts
60min, 13000 × g are centrifuged 10min, supernatant discarded, add 350 μ L NaCl solution and precipitation are suspended, add 350 μ L
Chloroform, vortex oscillation mixes, and 13000g is centrifuged 10min, and the isopropanol adding 0.8 times of volume after transfer supernatant is used for precipitating
Nucleic acid, room temperature is placed 20min, 13000g and is centrifuged 10min, supernatant discarded, adds 500 μ L 70% ethanol solution washing precipitations, molten
Solution is in 50 μ L TE solution.Then take 4.0 μ L extracts and join following reaction system,
The each 1.0 μ L of 2 × ddPCR Super Mix 10.0 μ L, Salmonella and (int1) forward and reverse primer, probe each 1.0
μ L, DNA profiling 4.0 μ L.Wherein primer sequence is as follows:
Forward primer SLMF:AGACCAAAGAGGGGGACCTT
Downstream primer SLMR:TTGGTGAGCCGTTACCTCAC
Probe SLMP:AGATGGGATTAGCTTGTT
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
Carry out PCR amplification, sequentially include the following steps:
(1) 94 DEG C of denaturation 3min；
(2) 94 DEG C of degeneration 10s, 59 DEG C of annealing 1min, carry out 40 circulations altogether；
(3) 98 DEG C of enzyme heat inactivation 10min；
(4) 4 DEG C of stopped reaction.
In order to prove the accuracy of detection method, the present invention has made comparative testing below: be respectively adopted the present invention
" national food safety standard food microbiological examination Salmonella is examined for detection method and colony counting method GB 4789.4-2010
Test " carry out the comparison of Salmonella quantitative measurement.Concrete experimental implementation is all carried out according to standard test numerical value, tests repetition three
Secondary, results averaged.Result is as shown in table 1, from the results, it was seen that the present invention uses digital pcr method to big in food
The measurement result of intestinal flora quantity, compared with existing GB 4789.4-2010,10 parts of samples, mean error is 3.7%, this explanation
The inventive method has the highest accuracy.It addition, digital pcr of the present invention is enjoyed oneself to the full, single sample whole process detection time of method is 4
Hour, method of counting cultivated by the most existing traditional flat board, and while detecting Salmonella, moreover it is possible to its integron is entered
Row well detection, it is possible to accurately Fast Evaluation food-borne pathogens and pathogenic bacterium carry the propagation risk of drug resistant gene.Therefore
There is good technical advantage and Developmental Prospect of Industrialization.
Table 1
The ultimate principle of the present invention and principal character and advantages of the present invention have more than been shown and described.The skill of the industry
The art personnel simply explanation it should be appreciated that the present invention is not restricted to the described embodiments, described in above-described embodiment and description
The principle of the present invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, these
Changes and improvements both fall within scope of the claimed invention.Claimed scope by appending claims and
Its equivalent defines.
Claims (8)
1. the primer detecting Salmonella in Food and integron, it is characterised in that include Salmonella primer and integration
Sub-primer；
The sequence of described Salmonella primer is:
Forward primer SLMF:AGACCAAAGAGGGGGACCTT
Downstream primer SLMR:TTGGTGAGCCGTTACCTCAC；
The sequence of described integron primer is:
Forward primer int1F:CATCGTCGTAGAGACGTCGG
Downstream primer Int1R:AGAACAAGCAGGCATCACGA.
2. with claim 1 described in primer with the use of probe, it is characterised in that include Salmonella probe and integron
Probe:
The sequence of described Salmonella probe is:
Probe SLMP:AGATGGGATTAGCTTGTT
The sequence of described integron probe is:
Probe I nt1P:AGGGTGTGCGGTGTGGCGGGC.
3. for detecting the test kit of Salmonella and integron, it is characterised in that comprise the primer in claim 1 and right
Require the probe in 2.
The most according to claim 3 for detecting the test kit of Salmonella and integron, it is characterised in that in this test kit
20.0 μ L reaction systems include following components: 2 × ddPCR Super Mix10.0 μ L, staphylococcus aureus and integron
The each 1.0 μ L of probe, DNA profiling 4.0 μ L of each 1.0 μ L of forward and reverse primer, staphylococcus aureus and the integron int1 of int1.
5. detection Salmonella and the method for integron, it is characterised in that comprise the following steps:
A, extraction sample DNA；
B, each reactive component is added 20.0 μ l reaction systems as claimed in claim 4, be subsequently adding 70.0 μ l mineral oil, mixed
Transfer to automatically generate on drop generator microdroplet after even；Take the positive quality control in test kit and negative Quality Control, system the most respectively
Standby corresponding DNA profiling；
C, digital pcr mixed liquor ddPCR Super Mix is fabricated to the micro-reaction system of Water-In-Oil PCR, and is transferred completely into 96
In the Sptting plate PCR reaction tube of hole；Again by 96 hole Sptting plate PCR reaction tubes at sealer instrument upper sealing film, it is placed in regular-PCR instrument and carries out
PCR reacts；
D, opening microdroplet fluorescence detector application software, 96 hole Sptting plate PCR reaction tubes after PCR reaction being terminated are inserted directly into
Equipment, detects the PCR response situation of microdroplet in each 96 hole Sptting plate PCR reaction tubes, calculates finally according to amber pine distribution law
The copy number of testing gene.
Detection Salmonella and the method for integron the most according to claim 5, it is characterised in that PCR amplification in step C
Response procedures sequentially includes the following steps:
(1) 94 DEG C of denaturation 3min；
(2) 94 DEG C of degeneration 10s, 59 DEG C of annealing 1min, carry out 40 circulations altogether；
(3) 98 DEG C of enzyme heat inactivation 10min；
(4) 4 DEG C of stopped reaction.
Detection Salmonella and the method for integron the most according to claim 5, it is characterised in that extract sample described in step A
Product DNA specifically comprises the following steps that
Take 1.5mL culture 10000rpm and be centrifuged 2min；Precipitate adds the TE buffer of 500 μ L, and piping and druming is allowed to again repeatedly
Suspending, add 30 μ L 10%SDS, mixing, in 37 DEG C of incubation 1h；Add 100 μ L 5mol/L NaCl, fully mix, add
80ulCTAB/NaCl solution, 65 DEG C of incubation 10min again after mixing；Add isopyknic phenol/chloroform/isoamyl alcohol mixing, centrifugal 4-
5min, proceeds in a new pipe by supernatant, adds the isopropanol of 0.8 times of volume, is gently mixed until DNA precipitates；Precipitation
After 70% washing with alcohol of 1mL, add TE solution dissolution precipitation.
Detection Salmonella and the method for integron the most according to claim 7, it is characterised in that take positive matter in step B
Control identical with the method in step A with the method that corresponding DNA profiling is prepared in negative Quality Control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610617394.4A CN106244685A (en) | 2016-07-29 | 2016-07-29 | For detecting test kit and the method for Salmonella in Food and integron |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610617394.4A CN106244685A (en) | 2016-07-29 | 2016-07-29 | For detecting test kit and the method for Salmonella in Food and integron |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106244685A true CN106244685A (en) | 2016-12-21 |
Family
ID=57606713
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610617394.4A Pending CN106244685A (en) | 2016-07-29 | 2016-07-29 | For detecting test kit and the method for Salmonella in Food and integron |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244685A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107419016A (en) * | 2017-07-17 | 2017-12-01 | 蔡先全 | Detect the primer of pseudomonas aeruginosa and integron, kit and method in water |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894283A (en) * | 2015-06-25 | 2015-09-09 | 蔡先全 | Primer, reagent box and method for detecting salmonella and integron (int) |
-
2016
- 2016-07-29 CN CN201610617394.4A patent/CN106244685A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894283A (en) * | 2015-06-25 | 2015-09-09 | 蔡先全 | Primer, reagent box and method for detecting salmonella and integron (int) |
Non-Patent Citations (1)
| Title |
|---|
| MICHAEL J. ROTHROCK JR.等: "Quantification of Zoonotic Bacterial Pathogens within Commercial Poultry Processing Water Samples Using Droplet Digital PCR", 《ADVANCES IN MICROBIOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107419016A (en) * | 2017-07-17 | 2017-12-01 | 蔡先全 | Detect the primer of pseudomonas aeruginosa and integron, kit and method in water |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105274099B (en) | The primer of 9 kinds of animal derived materials, probe compositions, kit and its detection method and application in Rapid identification food or feed | |
| CN106048052A (en) | Kit and method for detecting staphylococcus aureus and integron in food | |
| CN110093457A (en) | A kind of African swine fever virus ASFV-LAMP detection primer group and kit | |
| CN107513561A (en) | Detect primer, kit and the method for P. aeruginosa and C.perfringens | |
| CN106086208A (en) | For detecting vibrio parahaemolyticus and the test kit of integron and method in food | |
| CN105861641A (en) | Primer, kit and method for detecting CHO cell DNA residues | |
| CN104894283A (en) | Primer, reagent box and method for detecting salmonella and integron (int) | |
| CN106148534A (en) | For detecting shigella and the test kit of integron and method in food | |
| CN105695560A (en) | Method for identifying Bifidobacterium lactis in infant formula milk powder | |
| CN107513562A (en) | Detect pseudomonas aeruginosa and ExoU primer, kit and method in water | |
| CN106244685A (en) | For detecting test kit and the method for Salmonella in Food and integron | |
| CN105331677B (en) | For multiplex PCR detection primer sets, kit and the detection method of the salmonella and Shigella in food | |
| CN106244691A (en) | A kind of based on the method for Salmonella in microdroplet digital pcr method fast quantification examination Fructus Fragariae Ananssae | |
| CN104212885A (en) | LAMP kit for Vibrio cholera in aquatic product | |
| CN109022549A (en) | The method of PMA vibrio parahemolyticus living cells bacterium in quantitative detection food in conjunction with droplet type digital pcr | |
| CN107727863A (en) | The detection method of endotoxin content in yeast extract | |
| CN106148536A (en) | For detecting test kit and the method for Escherichia Coli in Food and integron | |
| CN110343766A (en) | A method of based on calf-derived Cyclospora in QPCR quantitative detection livestock meat | |
| CN108467897A (en) | Detect the primer of C.perfringens and plc genes, kit and method in food | |
| CN107287328A (en) | Detect primer, kit and the method for pseudomonas aeruginosa and toxA in water | |
| CN108203736A (en) | A kind of method of quick detection Salmonella in Food | |
| CN107447001A (en) | Detect pseudomonas aeruginosa and ExoS primer, kit and method in water | |
| CN108950027A (en) | It is a kind of for detecting the kit and method of klebsiella pneumoniae | |
| CN105177156A (en) | Human EGFR gene mutation detection kit and application thereof | |
| CN108441543A (en) | Detect the primer of C.perfringens and β toxin, kit and method in food |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161221 |