CN106086188B - DNA structure probe for detecting mercury ions based on nucleic acid isothermal amplification technology - Google Patents
DNA structure probe for detecting mercury ions based on nucleic acid isothermal amplification technology Download PDFInfo
- Publication number
- CN106086188B CN106086188B CN201610460403.3A CN201610460403A CN106086188B CN 106086188 B CN106086188 B CN 106086188B CN 201610460403 A CN201610460403 A CN 201610460403A CN 106086188 B CN106086188 B CN 106086188B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- mercury ions
- probe
- mercury
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The DNA structure probe for detecting mercury ions based on the nucleic acid isothermal amplification technology comprises nucleic acid sequences of three DNA structure probes which contain mismatched sites and can form a triple hybrid structure through nucleic acid hybridization, and the triple hybrid structure is characterized in that: the probe is formed by hybridizing a mercury ion triggering DNA probe structure, a mercury ion binding region and a polymerase recognition region are spatially separated, a stable structure capable of continuously polymerizing is obtained before the action of mercury ions and thymine is damaged by biological thiol molecules by utilizing the rapid polymerization action of polymerase, and the interference of the biological thiol molecules is ingeniously avoided. The method can effectively eliminate the loss of trace mercury ions caused by the interference of biological thiol molecules when the nucleic acid constant temperature method is applied for detection, effectively improves the detection efficiency of the trace mercury ions on the premise of not introducing any reagent, and further improves the application of the nucleic acid constant temperature amplification technology in mercury ion detection.
Description
Technical Field
The invention belongs to the field of biotechnology, and particularly relates to a DNA structure probe for detecting mercury ions based on a nucleic acid isothermal amplification technology.
Technical Field
Heavy metal ions have a relatively high stability in the environment and are difficult to be degraded by microorganisms. Once they enter the environment, they are difficult to restore naturally, and can be continuously enriched and transferred in the ecosystem, and even if the intake of trace amount can generate great toxicity, which is a great threat to ecological balance and human health. As a representative of heavy metal ion contamination, accumulation of mercury ions in biological tissues causes DNA damage, affects ligand-receptor interaction, destroys the immune system, and causes a series of diseases such as brain damage, renal failure, various cognitive and motor disorders, and the like. Therefore, the quantitative detection of the mercury ions in the environment has important research value and practical significance.
The traditional methods for detecting mercury ions include atomic absorption/emission spectroscopy, chromatographic chromatography, inductively coupled plasma mass spectrometry, cold vapor atomic fluorescence spectroscopy, high performance liquid chromatography, anodic stripping voltammetry and the like, but most of the methods rely on large-scale equipment, are high in experimental cost, need to be operated by professional personnel, and are complicated in sample pretreatment process, so that the wide application of the methods in actual detection is restricted.
In recent years, methods for detection based on functionalized nucleic acids have been widely developed. Nucleic acid plays more and more important roles in biological detection and biochemical analysis due to the advantages of high stability, biocompatibility, easy labeling and modification, low cost, wide application and the like. Akira Ono equals 2004 and first discovered and proposed that mercury ions can undergo proton substitution reaction with the third nitrogen atom on thymine base to form stable T-Hg2+-a T structure. The structure can even replace the original A-T base pairing structure in the nucleic acid sequence, so that the secondary structure of the nucleic acid is recombined. The discovery of the special coordination structure improves the sensitivity and specificity of mercury ion detection to a great extent and makes a breakthrough contribution to heavy metal detection. Has been at presentVarious methods for detecting mercury ions based on the nucleic acid with the structure are developed, and the detection methods comprise detection methods such as colorimetry, electrochemistry, electrochemiluminescence, fluorescence spectroscopy and the like. However, although the result of the colorimetric method is visible to the naked eye, the sensitivity is not high enough, and the synthesis and preparation process of the nanogold is complicated. The electrochemical method has high sensitivity, but has complex operation and long time, and needs to be equipped with an expensive electrochemical related instrument, and meanwhile, the related fluorescence method is faster and simpler because amplification is not carried out, but is difficult to obtain satisfactory sensitivity and detection range.
The isothermal amplification technique for nucleic acid has been developed in recent years, and can rapidly amplify a plurality of oligonucleotide single strands under isothermal conditions. Compared with traditional amplification technologies such as PCR, isothermal nucleic acid amplification technology not only has higher amplification efficiency, but also does not need thermal cycling equipment, and has been increasingly used for detection of DNA, microRNA, other bioactive molecules and metal ions. The method for detecting the mercury ions by utilizing the nucleic acid isothermal amplification technology is developed to a certain extent, and compared with the traditional detection method, the method can quickly and efficiently realize the detection of the mercury ions. The application of nucleic acid isothermal amplification technology to detect mercury ions has also been developed.
When signal amplification is carried out using isothermal nucleic acid amplification techniques, it is often necessary to use a tool enzyme such as Klenow fragment polymerase (KF). In the existing storage solution of polymerase and the most suitable reaction buffer solution, biological thiol molecules such as Dithiothreitol (DTT), BSA and the like are commonly contained to ensure the stable structure and activity of the enzyme. Previous researches show that the biological thiol molecules have strong affinity with mercury ions. The existence of the biological thiol molecules can compete with thymine to capture trace mercury ions in a system, so that the effect of the action of the mercury ions and the thymine is reduced, the detection sensitivity of the trace mercury ions is low, and the application of a nucleic acid constant-temperature amplification method in the aspect of mercury ion detection is influenced.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide a DNA structure probe for detecting mercury ions based on a nucleic acid isothermal amplification technology aiming at the influence of biological thiol molecules in polymerase KF on mercury ion detection in a nucleic acid isothermal amplification process, a double-stranded region with a specific length is reserved between a mismatch site and the 3' end of a primer, and a mercury ion binding region and a polymerase recognition region are spatially isolated. By utilizing the rapid polymerization of the polymerase, a stable structure capable of continuously polymerizing is obtained before the action of the mercury ions and the thymine is destroyed by the biological thiol molecules, so that the interference of the biological thiol molecules is avoided ingeniously, and the wide application of the nucleic acid isothermal amplification technology in the trace mercury ion detection is promoted.
In order to achieve the purpose, the invention is realized by the following technical scheme:
the DNA structure probe for detecting mercury ions based on the nucleic acid isothermal amplification technology comprises nucleic acid sequences of three DNA structure probes containing mismatch sites and capable of forming a triple hybrid structure through nucleic acid hybridization, and nucleotide sequences (5 'to 3'):
3-WJ Probe 1AGAGGTAGTAGGTGATAGTCGG
3-WJ Probe 2CCGTCTTTCTCCCCATAT
3-WJ template: TGAGGCTAGAGCGAGCTGAGGCGGATATGGAATACTACCTCTAAA are provided.
The invention designs the nucleic acid sequence of three DNA structure probes which contain mismatching sites and can form a triple hybrid structure through nucleic acid hybridization.
The triple hybrid structure is characterized in that after the structure of the DNA probe is hybridized and formed by triggering mercury ions, even if the mercury ions are captured by biological thiol molecules, the triple hybrid structure still stably exists and initiates polymerization reaction. Under the trigger of mercury ions, the DNA structure probe can form a stable triple hybrid structure to initiate polymerization reaction; after a mercury ion triggers a DNA structure probe to form a stable triple hybridization structure, extending under the action of polymerase KF, then recognizing and cutting a specific site on an extension sequence by Nt.BbvCI to generate a single-chain product 1, polymerizing the rest part under the action of KF again to form a first round of polymerization-enzyme cutting cyclic reaction, and simultaneously generating a large amount of single-chain products 1. The cleaved product 1 is hybridized with a Molecular Beacon (MB) which has sequence specificity and is fluorescently labeled at the tail end to generate a fluorescent signal, the MB is used as a template for amplification, and specific sites of the extension sequence are recognized and cleaved by Nt. BbvCI recognizes and cleaves, yielding single-stranded product 2. Product 2 can hybridize to MB, generating a fluorescent signal. Meanwhile, the remaining MB after releasing the product 2 and the hybridization structure of the product 1 are polymerized again under the action of polymerase to form a second round of polymerization-enzyme digestion circulation amplification, a large amount of single-stranded products 2 are generated, and amplified fluorescence signals are generated after the hybridization with the MB.
Compared with the prior art, the invention has the following beneficial technical effects:
1. compared with the traditional mercury ion detection methods, the traditional mercury ion detection methods comprise atomic absorption/emission spectroscopy, chromatography, inductively coupled plasma mass spectrometry, cold steam atomic fluorescence spectroscopy, high performance liquid chromatography, anodic stripping voltammetry and the like, but most of the methods depend on large-scale equipment, the experiment cost is high, professional operation is required, the sample pretreatment process is complicated, and the methods are restricted from being widely applied to actual detection.
2. Although the existing nucleic acid constant-temperature amplification method is simple and convenient to operate, the polymerase commonly contains biological thiol molecules such as DTT (draw texturing technique), BSA (bovine serum albumin) and the like, and the substance has strong affinity with mercury ions, so that the detection of trace mercury ions can be interfered, and the problems of low sensitivity, poor reproducibility and the like are caused. Aiming at the problem of interference of biological thiol molecules in the application of the nucleic acid isothermal amplification technology in the aspect of mercury ion detection, the invention provides the method for enhancing the detection effect of the nucleic acid isothermal amplification technology in the mercury ion detection by using the DNA structure probe, which can effectively avoid the interference of the biological thiol molecules in polymerase under the condition of not introducing external reagents, improves the nucleic acid amplification efficiency and has important application prospect.
Drawings
FIG. 1 is a schematic diagram of the reaction scheme of the present invention.
FIG. 2 is a schematic diagram of the signal source of the isothermal amplification method of nucleic acids characterized by the present invention.
FIG. 3 compares the amplification effect of the present invention with that of the prior art method.
Detailed Description
The present invention will be described in detail with reference to the accompanying drawings.
The DNA structure probe for detecting mercury ions based on the nucleic acid isothermal amplification technology comprises nucleic acid sequences of three DNA structure probes containing mismatch sites and capable of forming a triple hybrid structure through nucleic acid hybridization, and nucleotide sequences (5 'to 3'):
3-WJ Probe 1AGAGGTAGTAGGTGATAGTCGG
3-WJ Probe 2CCGTCTTTCTCCCCATAT
3-WJ template: TGAGGCTAGAGCGAGCTGAGGCGGATATGGAATACTACCTCTAAA are provided.
The working principle of the invention is as follows:
the DNA structure probe of the invention utilizes the nucleic acid isothermal amplification technology to detect mercury ions, and the steps are as follows:
(1) mixing nucleic acid sequences of three DNA structure probes which contain mismatched sites and can form a triple hybrid structure through nucleic acid hybridization according to the concentration of 20nM, and forming a stable hybrid structure which can be recognized by polymerase after the probes are combined with 20nM mercury ions in a solution to be detected; when comparing with the existing amplification method, the mismatch primer and the template are mixed according to the concentration of 20nM, and 20nM mercury ions are added for hybridization reaction;
(2) and mixing the nucleic acid hybridization structure combined with the mercury ions with amplification substrates dNTPs, KF, Nt.BbvCI, molecular beacons and amplification reaction buffer solution for reaction at 37 ℃ for 60 min. The concentrations of the components in the mixture are respectively as follows: 20nM of the sequence, amplification substrates dNTPs 40 mu M, KF polymerase 0.5U, Nt. BbvCI 4U, amplification reaction buffer 10mM Tris,75mM KAc,10mM Mg (Ac)2, pH 7.9, and probe sequence, after forming a stable hybridization structure, initiating a subsequent nucleic acid isothermal amplification reaction and generating a fluorescence signal through MB;
(3) and detecting the fluorescence signal by using a fluorescence spectrophotometer, and analyzing the fluorescence signal to obtain the content of mercury ions in the solution to be detected.
As can be seen from FIG. 1, the conventional nucleic acid amplification method is that mercury ions trigger the hybridization of mismatched primers and templates, thereby initiating isothermal amplification reaction. However, when polymerase KF exists in the reaction system, self-contained DTT in KF competes with nucleic acid strand for binding mercury ion, resulting in unstable hybridization of mismatched primer and template, and failing to initiate normal progress of subsequent polymerization reaction. The present invention designs specific DNA probe sequences capable of forming triple hybrid structures. The triple hybrid structure is characterized in that after the triple hybrid structure is formed by hybridizing the mercury ion triggering DNA probe, even if the mercury ion is captured by DTT, the triple hybrid structure still stably exists, the polymerization reaction is initiated, and the signal amplification can be realized through constant temperature amplification. Therefore, compared with the existing detection method, the method can improve the polymerization efficiency of the nucleic acid isothermal reaction, thereby improving the detection efficiency of trace mercury ions.
Referring to FIG. 2, in order to verify the effect of the present invention in enhancing isothermal amplification of nucleic acids, the intensity of fluorescence signal generated by the existing isothermal amplification method of nucleic acids was selected for characterization.
After a mercury ion triggers a DNA structure probe to form a stable triple hybridization structure, extending under the action of polymerase KF, then recognizing and cutting a specific site on an extension sequence by Nt.BbvCI to generate a single-chain product 1, polymerizing the rest part under the action of KF again to form a first round of polymerization-enzyme cutting cyclic reaction, and simultaneously generating a large amount of single-chain products 1. The cleaved product 1 is hybridized with a Molecular Beacon (MB) which has sequence specificity and is fluorescently labeled at the tail end to generate a fluorescent signal, the MB is used as a template for amplification, and specific sites of the extension sequence are recognized and cleaved by Nt. BbvCI recognizes and cleaves, yielding single-stranded product 2. Product 2 can hybridize to MB, generating a fluorescent signal. Meanwhile, the remaining MB after releasing the product 2 and the hybridization structure of the product 1 are polymerized again under the action of polymerase to form a second round of polymerization-enzyme digestion circulation amplification, a large amount of single-stranded products 2 are generated, and after the hybridization with the MB, the signal cascade amplification is formed.
Referring to FIG. 3, the difference of fluorescence signals when the DNA structure probe provided by the present invention and the existing mismatch primer and template hybridization structure are combined with the nucleic acid isothermal amplification technology for amplification detection is compared.
The hybridization structure of the existing mismatch primer and the template comprises:
mismatch primer: TAGAGGTT
Template: TGAGGCTAGAGCGAGCTGAGGCGGATATGGAATACTACCTCTAAA
Curves a and b are the signal and background fluorescence spectra generated by the hybridization of the mercury ion triggering mismatch primer and the template and the combination of the nucleic acid isothermal amplification method. Curves c and d show the formation of triple hybrid structures by mercury ion-triggered DNA probes, also combined with the signal and background fluorescence spectra generated by the subsequent isothermal amplification of nucleic acids. The inset shows the fluorescence spectra corresponding to the magnified a, b, and c. As can be seen from the figure, the existing method for amplifying by hybridizing the primer and the template has very low signal and background, which indicates that the detection efficiency of trace mercury ions is very low. The signal and the background of the isothermal amplification method based on the DNA probe structure have great difference, which shows that the system really has interference factors influencing the stable combination of the mercury ions and the nucleic acid chain, and the triple hybrid structure can obviously enhance the effect of the nucleic acid isothermal amplification technology in the mercury ion detection, thereby proving that the DNA probe structure has important application value in the aspect of detecting the mercury ions based on the nucleic acid isothermal amplification technology.
Claims (1)
1. The DNA structure probe for detecting mercury ions based on the nucleic acid isothermal amplification technology is characterized by comprising nucleic acid sequences of three DNA structure probes which contain mismatched sites and can form a triple hybrid structure through nucleic acid hybridization, wherein the nucleotide sequences are from 5 'to 3':
3-WJ Probe 1 AGAGGTAGTAGGTGATAGTCGG;
3-WJ Probe 2 CCGTCTTTCTCCCCATAT;
3-WJ template: TGAGGCTAGAGCGAGCTGAGGCGGATATGGAATACTACCTCTAAA are provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610460403.3A CN106086188B (en) | 2016-06-22 | 2016-06-22 | DNA structure probe for detecting mercury ions based on nucleic acid isothermal amplification technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610460403.3A CN106086188B (en) | 2016-06-22 | 2016-06-22 | DNA structure probe for detecting mercury ions based on nucleic acid isothermal amplification technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106086188A CN106086188A (en) | 2016-11-09 |
| CN106086188B true CN106086188B (en) | 2020-01-21 |
Family
ID=57252136
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610460403.3A Expired - Fee Related CN106086188B (en) | 2016-06-22 | 2016-06-22 | DNA structure probe for detecting mercury ions based on nucleic acid isothermal amplification technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106086188B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108315400A (en) * | 2018-02-11 | 2018-07-24 | 中国农业大学 | A kind of visualization of heavy metal ion quantifies new detecting method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039521A (en) * | 2015-06-24 | 2015-11-11 | 天津科技大学 | Method for detecting concentration of Hg<2+> based on fluorescent probe adopting DNA three-way junction |
| CN105256033A (en) * | 2015-10-22 | 2016-01-20 | 西安交通大学 | Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof |
-
2016
- 2016-06-22 CN CN201610460403.3A patent/CN106086188B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039521A (en) * | 2015-06-24 | 2015-11-11 | 天津科技大学 | Method for detecting concentration of Hg<2+> based on fluorescent probe adopting DNA three-way junction |
| CN105256033A (en) * | 2015-10-22 | 2016-01-20 | 西安交通大学 | Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof |
Non-Patent Citations (2)
| Title |
|---|
| Metal-locked DNA three-way junction;Duprey JL等;《Angew Chem Int Ed Engl》;20130121;第52卷(第4期);第1212-1216页 * |
| Target-triggered three-way junction structure and polymerase/nicking enzyme synergetic isothermal quadratic DNA machine for highly specific, one-step, and rapid microRNA detection at attomolar level;Zhang Q等;《Anal Chem》;20140819;第86卷(第16期);第8098-8105页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106086188A (en) | 2016-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111394430B (en) | Detection system based on CRISPR-Cas12a coupling enhanced strand displacement amplification and application thereof | |
| JP5382802B2 (en) | Detection and quantification of biomolecules using mass spectrometry | |
| Li et al. | Rolling circle amplification-driven encoding of different fluorescent molecules for simultaneous detection of multiple DNA repair enzymes at the single-molecule level | |
| US20080305479A1 (en) | Detection and quantification of biomolecules using mass spectrometry | |
| JP2008513011A (en) | Compositions, methods and kits for identifying and quantifying low molecular weight RNA molecules | |
| CN105256033B (en) | Mercury ion detection kit and its detection method based on constant-temperaturecascade cascade nucleic acid amplification | |
| DE69938894D1 (en) | PROCESS FOR DETECTING TARGET NUCLEIC ACIDS BY PCR | |
| CN113088557B (en) | Fluorescent chemical sensor for simultaneously detecting multiple DNA glycosylases and detection method and application thereof | |
| CN101376912B (en) | Loop-mediated isothermal amplification detection kit of influenza A3 viruses and detecting method | |
| Cui et al. | Detection of single nucleotide polymorphism by measuring extension kinetics with T7 exonuclease mediated isothermal amplification | |
| Zhang et al. | Detection of DNA 3'-phosphatase activity based on exonuclease III-assisted cascade recycling amplification reaction | |
| KR101820440B1 (en) | Method for detection of target nucleic acids | |
| CN103261437A (en) | Genotyping method for hpa and primers used | |
| Cheng et al. | Ligase chain reaction coupled with rolling circle amplification for high sensitivity detection of single nucleotide polymorphisms | |
| CN107083437B (en) | Method for simultaneously detecting multiple DNA glycosylases by using inherent fluorescent nucleotide ultrasensitiveness | |
| CN106086188B (en) | DNA structure probe for detecting mercury ions based on nucleic acid isothermal amplification technology | |
| Xu et al. | Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene | |
| CA2336546A1 (en) | Method for determining polynucleotide sequence variations | |
| CN112359143A (en) | Isothermal index amplification method based on Y-type probe set and application thereof | |
| CN109097449B (en) | Real-time fluorescence LAMP detection method and kit based on metal ruthenium complex | |
| CN107893120B (en) | Primer group for detecting motion gene SNP, application and product thereof, and detection method and application for detecting motion gene SNP | |
| CN113652473B (en) | Fluorescent chemical sensor for detecting DNA damage site by single molecule, method and application | |
| Li et al. | A primer-initiated strand displacement amplification strategy for sensitive detection of 5-Hydroxymethylcytosine in genomic DNA | |
| CN113151420B (en) | One-step fluorescence detection system, and detection method and application of DNA glycosylase activity | |
| CN106086187B (en) | Method for eliminating DTT interference during detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200121 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |