CN106086187B - Method for eliminating DTT interference during detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide - Google Patents
Method for eliminating DTT interference during detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide Download PDFInfo
- Publication number
- CN106086187B CN106086187B CN201610460402.9A CN201610460402A CN106086187B CN 106086187 B CN106086187 B CN 106086187B CN 201610460402 A CN201610460402 A CN 201610460402A CN 106086187 B CN106086187 B CN 106086187B
- Authority
- CN
- China
- Prior art keywords
- hydrogen peroxide
- amplification
- nucleic acid
- mercury
- mercury ions
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
A method for eliminating DTT interference when nucleic acid isothermal amplification is used for detecting mercury ions by hydrogen peroxide is characterized in that a primer containing a mismatch site and initiating nucleic acid isothermal amplification and a recognition sequence of a template are mixed in equal volume according to the concentration of 100nM, and a stable hybridization structure capable of being recognized by polymerase can be formed after the recognition sequence is combined with mercury ions in a mercury-containing solution to be detected; mixing the stable hybridization structure with a hydrogen peroxide solution, an amplification substrate, DNA polymerase KF, SYBR Green I and an amplification reaction buffer solution for reaction, and initiating an amplification reaction under the action of the polymerase to generate double-stranded DNA; SYBR Green I can be specifically combined on double-stranded DNA molecules and simultaneously emits a fluorescent signal; the amplified sequence is characterized by using a dissolution curve and agarose gel electrophoresis, and the method proves that the hydrogen peroxide eliminates the DTT interference.
Description
Technical Field
The invention belongs to the field of biotechnology, and particularly relates to a method for eliminating DTT interference during detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide.
Technical Field
Heavy metal ions have a relatively high stability in the environment and are difficult to be degraded by microorganisms. Once they enter the environment, they are difficult to restore naturally, and can be continuously enriched and transferred in the ecosystem, and even if the intake of trace amount can generate great toxicity, which is a great threat to ecological balance and human health. As a representative of heavy metal ion contamination, accumulation of mercury ions in biological tissues causes DNA damage, affects ligand-receptor interaction, destroys the immune system, and causes a series of diseases such as brain damage, renal failure, various cognitive and motor disorders, and the like. Therefore, the quantitative detection of the mercury ions in the environment has important research value and practical significance.
The traditional methods for detecting mercury ions include atomic absorption/emission spectroscopy, chromatographic chromatography, inductively coupled plasma mass spectrometry, cold vapor atomic fluorescence spectroscopy, high performance liquid chromatography, anodic stripping voltammetry and the like, but most of the methods rely on large-scale equipment, are high in experimental cost, need to be operated by professional personnel, and are complicated in sample pretreatment process, so that the wide application of the methods in actual detection is restricted.
In recent years, based onMethods for detecting functionalized nucleic acids have been widely developed. Nucleic acid plays more and more important roles in biological detection and biochemical analysis due to the advantages of high stability, biocompatibility, easy labeling and modification, low cost, wide application and the like. Akira Ono equals 2004 and first discovered and proposed that mercury ions can undergo proton substitution reaction with the third nitrogen atom on thymine base to form stable T-Hg2+-a T structure. The structure can even replace the original A-T base pairing structure in the nucleic acid sequence, so that the secondary structure of the nucleic acid is recombined. The discovery of the special coordination structure improves the sensitivity and specificity of mercury ion detection to a great extent and makes a breakthrough contribution to heavy metal detection. Various methods for detecting mercury ions based on the nucleic acid with the structure are developed at present, and the detection methods comprise detection methods such as colorimetry, electrochemistry, electrochemiluminescence, fluorescence spectroscopy and the like. However, although the result of the colorimetric method is visible to the naked eye, the sensitivity is not high enough, and the synthesis and preparation process of the nanogold is complicated. The electrochemical method has high sensitivity, but has complex operation and long time, and needs to be equipped with an expensive electrochemical related instrument, and meanwhile, the related fluorescence method is faster and simpler because amplification is not carried out, but is difficult to obtain satisfactory sensitivity and detection range.
The isothermal amplification technique for nucleic acid has been developed in recent years, and can rapidly amplify a plurality of oligonucleotide single strands under isothermal conditions. Compared with traditional amplification technologies such as PCR, isothermal nucleic acid amplification technology not only has higher amplification efficiency, but also does not need thermal cycling equipment, and has been increasingly used for detection of DNA, microRNA, other bioactive molecules and metal ions. The method for detecting the mercury ions by utilizing the nucleic acid isothermal amplification technology is developed to a certain extent, and compared with the traditional detection method, the method can quickly and efficiently realize the detection of the mercury ions. The application of nucleic acid isothermal amplification technology to detect mercury ions has also been developed.
When signal amplification is carried out using isothermal nucleic acid amplification techniques, it is often necessary to use a tool enzyme such as Klenow fragment polymerase KF. In the existing storage solution of polymerase and the most suitable reaction buffer solution, biological thiol molecules such as dithiothreitol DTT are commonly contained to ensure the stable structure and activity of the enzyme. Previous researches show that the biological thiol molecules have strong affinity with mercury ions. The existence of the biological thiol molecules can compete with thymine to capture trace mercury ions in a system, so that the effect of the action of the mercury ions and the thymine is reduced, the detection sensitivity of the trace mercury ions is low, and the application of a nucleic acid constant-temperature amplification method in the aspect of mercury ion detection is influenced.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide a method for eliminating the DTT interference when the nucleic acid is subjected to isothermal amplification detection on mercury ions by using hydrogen peroxide aiming at the influence of DTT in polymerase KF in the nucleic acid isothermal amplification process, and the hydrogen peroxide is used for eliminating DTT of dithiothreitol so as to further promote the wide application of the nucleic acid isothermal amplification technology in the detection of mercury ions.
In order to achieve the purpose, the invention is realized by the following technical scheme:
the method for eliminating DTT interference during the detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide comprises the following steps:
(1) mixing a primer containing a mismatch site and initiating nucleic acid isothermal amplification with a recognition sequence of a template according to the concentration of 100nM with equal volume, wherein the recognition sequence can form a stable hybridization structure which can be recognized by polymerase after being combined with mercury ions in a mercury-containing solution to be detected;
(2) mixing the stable hybridization structure combined with the mercury ions with a hydrogen peroxide solution, an amplification substrate, DNA polymerase KF, SYBR Green I and an amplification reaction buffer solution for reaction at 37 ℃ for 15 min; the concentrations of the components in the mixture are respectively as follows: primer concentration 100nM, template concentration 100nM, hydrogen peroxide concentration 0.01% -0.5%, amplification substrate 40 μ M, DNA polymerase KF 0.5U, SYBR Green I concentration 2 × SYBR Green I, amplification reaction buffer 10mM Tris,75mM KAc,10mM Mg (Ac)2The pH value is 7.9; exposing the 3' end after the primer and the template form a stable hybridization structure, and initiating an amplification reaction under the action of polymerase to generate double-stranded DNA; SYBR Green I can be specifically combined on double-stranded DNA molecules and simultaneously emits fluorescent signalNumber;
(3) the amplified sequence is characterized by using a dissolution curve and agarose gel electrophoresis, and the hydrogen peroxide is verified to eliminate DTT interference, wherein the conditions for preparing the dissolution curve are as follows: scanning fluorescence signals by real-time fluorescence PCR at the temperature of 60-95 ℃; the agarose gel electrophoresis characterization conditions are as follows: electrophoresis was performed for 30min at a concentration of 2% agarose gel and a voltage of 60V.
The nucleotide sequence (5 'to 3') of the recognition sequences of the primer and the template containing the mismatch site and initiating isothermal amplification of nucleic acids:
mismatch primer: TAGAGGTT
Template: TGAGGCTAGAGCGAGCTGAGGCGGATATGGAATACTACCTCTAAA are provided.
The mercury-containing solution: and mercury nitrate.
The amplification substrate is a commercially available dNTPs mixture.
Compared with the prior art, the invention has the following beneficial technical effects:
1. compared with the traditional mercury ion detection methods, the traditional mercury ion detection methods comprise atomic absorption/emission spectroscopy, chromatography, inductively coupled plasma mass spectrometry, cold steam atomic fluorescence spectroscopy, high performance liquid chromatography, anodic stripping voltammetry and the like, but most of the methods depend on large-scale equipment, the experiment cost is high, professional operation is required, the sample pretreatment process is complicated, and the methods are restricted from being widely applied to actual detection.
2. Although the traditional nucleic acid isothermal amplification method is simple and convenient to operate, the used polymerase generally contains DTT, and the molecule has strong affinity with mercury ions, so that the detection of trace mercury ions is interfered, and the problems of low sensitivity, poor reproducibility and the like are caused. The invention provides a simple and easy solution for eliminating DTT by using hydrogen peroxide aiming at the problem of the interference of DTT in the application of a nucleic acid isothermal amplification technology in the aspect of mercury ion detection, can effectively eliminate the interference of DTT molecules in polymerase, improves the nucleic acid amplification efficiency, and has important application prospect.
Drawings
FIG. 1 is a schematic diagram of the reaction scheme of the present invention.
FIG. 2 is a schematic representation of the enhancement effect of hydrogen peroxide on existing nucleic acid amplification techniques.
Fig. 3 is a schematic diagram for verifying the effect of DTT on mercury ion detection and hydrogen peroxide elimination.
Detailed Description
The present invention will be described in detail with reference to the accompanying drawings.
Example one
The method for eliminating DTT interference during the detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide comprises the following steps:
(1) mixing a primer containing a mismatch site and initiating nucleic acid isothermal amplification with a recognition sequence of a template according to the concentration of 100nM with equal volume, wherein the recognition sequence can form a stable hybridization structure which can be recognized by polymerase after being combined with mercury ions in a mercury-containing solution to be detected;
(2) mixing the stable hybridization structure combined with the mercury ions with a hydrogen peroxide solution, an amplification substrate, DNA polymerase KF, SYBR Green I and an amplification reaction buffer solution for reaction at 37 ℃ for 15 min; the concentrations of the components in the mixture are respectively as follows: primer concentration 100nM, template concentration 100nM, hydrogen peroxide concentration 0.01%, amplification substrate 40 μ M, DNA polymerase KF 0.5U, SYBR Green I concentration 2 × SYBR Green I, amplification reaction buffer 10mM Tris,75mM KAc,10mM Mg (Ac)2The pH value is 7.9; the primer and the template form a stable hybridization structure, then the 3' end is exposed, and the amplification reaction is initiated under the action of polymerase, so that double-stranded DNA is generated. SYBR Green I can be specifically combined on double-stranded DNA molecules and simultaneously emits a fluorescent signal;
(3) the amplified sequence is characterized by using a dissolution curve and agarose gel electrophoresis, and the hydrogen peroxide is verified to eliminate DTT interference, wherein the conditions for preparing the dissolution curve are as follows: real-time fluorescent PCR was used to scan the fluorescent signal over a range of 60-95 ℃. The agarose gel electrophoresis characterization conditions are as follows: electrophoresis was performed for 30min at a concentration of 2% agarose gel and a voltage of 60V.
The nucleotide sequence (5 'to 3') of the recognition sequences of the primer and the template containing the mismatch site and initiating isothermal amplification of nucleic acids:
mismatch primer: TAGAGGTT
Template: TGAGGCTAGAGCGAGCTGAGGCGGATATGGAATACTACCTCTAAA are provided.
The mercury-containing solution: and mercury nitrate.
The amplification substrate is a commercially available dNTPs mixture.
As can be seen from FIG. 1, after the recognition sequence containing the mismatch site and having the primer and the template for initiating isothermal amplification of nucleic acid recognizes and binds mercury ions, the 3 'end recognized by polymerase is exposed, and under the action of the polymerase, the 3' end of the DNA recognition element initiates amplification with itself as the template. However, since the polymerase KF contains the biological thiol molecule DTT, the molecule can compete with the recognition sequence to bind mercury ions, which causes unstable hybridization between the primer and the template, and thus hinders nucleic acid amplification. When a proper amount of hydrogen peroxide is added into the reaction system, the hydrogen peroxide can oxidize the DTT to ensure that the DTT cannot be combined with mercury ions, so that a hybridization structure triggered by the mercury ions can exist stably, and a nucleic acid chain is extended through nucleic acid amplification to generate a signal amplification effect. The characterization method comprises the steps of specifically combining a fluorescent dye SYBR Green I with double-stranded nucleic acid, and scanning a dissolution curve by using real-time fluorescent PCR; and secondly, characterizing the double-stranded product by agarose gel electrophoresis.
Referring to FIG. 2, the dissolution curves of the enhanced effect of hydrogen peroxide on the existing nucleic acid amplification technology are compared. Curves a, b represent the background and signal, respectively, of the reaction system without the addition of hydrogen peroxide. Curves c and d show the background and signal when hydrogen peroxide was added to the reaction system. The inset shows electropherograms corresponding to a, b, c, d, respectively. As can be seen from the figure, a significant fluorescence signal was generated only when hydrogen peroxide was contained in the reaction system for detecting mercury ions. Compared with a reaction system without hydrogen peroxide, the fluorescence signal is enhanced by nearly 6 times. From the electropherograms, it can also be concluded that a double-stranded product is produced by amplification only in the presence of hydrogen peroxide in the system for detecting mercury ions. Therefore, the amplification reaction can be efficiently carried out only when mercury ions are triggered and hydrogen peroxide exists, and meanwhile, the interference of a reaction system is shown, so that the stable combination of the mercury ions and the recognition sequence is influenced.
Referring to fig. 3, the effect of DTT on mercury ion detection and the elimination of hydrogen peroxide were verified. To verify that the interference of the reaction system on mercury ion detection comes from DTT. And comparing the influence of the DTT on the fluorescence signal of the mercury ion detection system and the change of the fluorescence signal of the system after the DTT is eliminated by hydrogen oxide. Curves a, b represent the fluorescence intensity of the background and signal, respectively, of the reaction system after addition of hydrogen peroxide. Curves c and d show the fluorescence intensity of the background and the signal after addition of DTT to the reaction systems (a and b) to which hydrogen peroxide was added, respectively. Curves e and f show the fluorescence intensity of the background and the signal after hydrogen peroxide was added again to the reaction systems (c and d) to which DTT was added, respectively. As can be seen from the figure, when the reaction system is added with hydrogen peroxide for the first time, the mercury ion-containing system generates an obvious fluorescence signal, and the fluorescence signal is enhanced by nearly 6 times, which shows the enhancement effect of the hydrogen peroxide on the amplification reaction. And when DTT is added into the reaction system independently, the signal is obviously reduced and is close to the background, which shows that DTT actually competes with the recognition sequence for combining mercury ions, so that the mercury ions cannot be stably combined with the recognition sequence, and further the amplification reaction cannot be carried out. When hydrogen peroxide is added again into the reaction system added with DTT, the fluorescence signal is recovered again, and the signal is enhanced by nearly 4 times, which shows that DTT with reduction property is oxidized by hydrogen peroxide, so that the interference of DTT on the detection of mercury ions is reduced, and the amplification reaction is performed efficiently.
Example two
The remaining steps in this example are identical except that the hydrogen peroxide concentration in the mixture described in step (2) is 0.5%.
The detection result shows that compared with a reaction system without hydrogen peroxide, the fluorescence signal is enhanced by about 5 times.
EXAMPLE III
The remaining steps in this example are identical except that the hydrogen peroxide concentration in the mixture described in step (2) is 0.2%.
The detection result shows that compared with a reaction system without hydrogen peroxide, the fluorescence signal is enhanced by nearly 6 times.
Comparative example 1
The remaining steps in this example are identical except that the hydrogen peroxide concentration in the mixture described in step (2) is 0.005%.
The detection result shows that compared with a reaction system without adding hydrogen peroxide, the fluorescence signal is enhanced by about 4 times, but the effect is lower than 0.01 percent.
Comparative example No. two
The remaining steps in this example are identical except that the hydrogen peroxide concentration in the mixture described in step (2) is 0.06%.
The detection results show that the fluorescence signal is enhanced by about 4 times compared with the reaction system with 0.05% of hydrogen peroxide, but the effect is much lower than 0.05%.
By combining the comparative examples, the optimum concentration of hydrogen peroxide addition is between 0.01% and 0.5%.
Claims (4)
1. The method for eliminating the DTT interference during the detection of the mercury ions by the isothermal amplification of the nucleic acid by using the hydrogen peroxide is characterized by comprising the following steps of:
(1) mixing a primer containing a mismatch site and initiating nucleic acid isothermal amplification with a recognition sequence of a template according to the concentration of 100nM with equal volume, wherein the recognition sequence can form a stable hybridization structure which can be recognized by polymerase after being combined with mercury ions in a mercury-containing solution to be detected;
(2) mixing the stable hybridization structure combined with the mercury ions with a hydrogen peroxide solution, an amplification substrate, DNA polymerase KF, SYBRGreen I and an amplification reaction buffer solution for reaction at 37 ℃ for 15 min; the concentrations of the components in the mixture are respectively as follows: primer concentration 100nM, template concentration 100nM, hydrogen peroxide concentration 0.01% -0.5%, amplification substrate 40 μ M, DNA polymerase KF 0.5U, SYBR Green I concentration 2 × SYBR Green I, amplification reaction buffer 10mM Tris,75mM KAc,10mM Mg (Ac)2The pH value is 7.9; exposing the 3' end after the primer and the template form a stable hybridization structure, and initiating an amplification reaction under the action of polymerase to generate double-stranded DNA; SYBR Green I can be specifically combined on double-stranded DNA molecules and simultaneously emits a fluorescent signal;
(3) the amplified sequence is characterized by using a dissolution curve and agarose gel electrophoresis, and the hydrogen peroxide is verified to eliminate DTT interference, wherein the conditions for preparing the dissolution curve are as follows: scanning fluorescence signals by real-time fluorescence PCR at the temperature of 60-95 ℃; the agarose gel electrophoresis characterization conditions are as follows: performing electrophoresis for 30min at the agarose gel concentration of 2% and the voltage of 60V;
the nucleotide sequence of the recognition sequence containing the mismatch site and having the primer and the template for initiating isothermal amplification of nucleic acid is 5 'to 3':
mismatch primer: TAGAGGTT
Template: TGAGGCTAGAGCGAGCTGAGGCGGATATGGAATACTACCTCTAAA are provided.
2. The method for eliminating DTT interference during nucleic acid isothermal amplification detection of mercury ions by using hydrogen peroxide according to claim 1, wherein the mercury-containing solution: and mercury nitrate.
3. The method for eliminating DTT interference during nucleic acid isothermal amplification and mercury ion detection by using hydrogen peroxide as claimed in claim 1, wherein the amplification substrate is a commercially available dNTPs mixture.
4. The method for eliminating DTT interference during nucleic acid isothermal amplification detection of mercury ions by hydrogen peroxide according to claim 1, wherein the concentration of hydrogen peroxide is 0.01%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610460402.9A CN106086187B (en) | 2016-06-22 | 2016-06-22 | Method for eliminating DTT interference during detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610460402.9A CN106086187B (en) | 2016-06-22 | 2016-06-22 | Method for eliminating DTT interference during detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106086187A CN106086187A (en) | 2016-11-09 |
| CN106086187B true CN106086187B (en) | 2020-01-14 |
Family
ID=57252129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610460402.9A Expired - Fee Related CN106086187B (en) | 2016-06-22 | 2016-06-22 | Method for eliminating DTT interference during detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106086187B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102778492A (en) * | 2012-07-13 | 2012-11-14 | 首都师范大学 | Electrochemical transducer for mercury ion detection and manufacturing method and detection method thereof |
| CN103305612A (en) * | 2013-06-04 | 2013-09-18 | 西安交通大学 | Lead ion detection kit based on constant-temperature cascade nucleic acid amplification and detection method of lead ion detection kit |
| CN103760205A (en) * | 2014-02-26 | 2014-04-30 | 长沙理工大学 | Method for dithiothreitol membrane mercury ion selective electrode |
| CN104198557A (en) * | 2014-09-03 | 2014-12-10 | 大连理工大学 | Enzyme based electrochemical biosensing method applied to detection of trace mercury ions |
| CN105256033A (en) * | 2015-10-22 | 2016-01-20 | 西安交通大学 | Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof |
-
2016
- 2016-06-22 CN CN201610460402.9A patent/CN106086187B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102778492A (en) * | 2012-07-13 | 2012-11-14 | 首都师范大学 | Electrochemical transducer for mercury ion detection and manufacturing method and detection method thereof |
| CN103305612A (en) * | 2013-06-04 | 2013-09-18 | 西安交通大学 | Lead ion detection kit based on constant-temperature cascade nucleic acid amplification and detection method of lead ion detection kit |
| CN103760205A (en) * | 2014-02-26 | 2014-04-30 | 长沙理工大学 | Method for dithiothreitol membrane mercury ion selective electrode |
| CN104198557A (en) * | 2014-09-03 | 2014-12-10 | 大连理工大学 | Enzyme based electrochemical biosensing method applied to detection of trace mercury ions |
| CN105256033A (en) * | 2015-10-22 | 2016-01-20 | 西安交通大学 | Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof |
Non-Patent Citations (5)
| Title |
|---|
| Fidelity quantification of mercury(II) ion via circumventing biothiols-induced sequestration in enzymatic amplification system;Yue Zhao等;《The Royal Society of Chemistry》;20160812;第6卷;第80296-80301页 * |
| G-quadruplex-based DNAzyme for sensitive mercury detection with the naked eye;Tao Li等;《The Royal Society of Chemistry》;20091231;第24卷;第1-3页 * |
| Incorporation of Thymine Nucleotides by DNA Polymerases through T–HgII–T Base Pairing;Hidehito Urata等;《Angewandte Chemie》;20101231;第49卷;第6516-6519页 * |
| Label-free colorimetric detection of Hg2+ based on Hg2+-triggered exonuclease III-assisted target recycling and DNAzyme amplification;WangRen等;《Biosensors and Bioelectronics》;20150103;第68卷;第266-271页 * |
| Ultrasensitive and selective detection of mercury(II) in aqueous solution by polymerase assisted fluorescence amplification;Xiao Zhu等;《Biosensors and Bioelectronics》;20110115;第26卷(第5期);第2666-2669页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106086187A (en) | 2016-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8383795B2 (en) | Detection and quantification of biomolecules using mass spectrometry | |
| US8133701B2 (en) | Detection and quantification of biomolecules using mass spectrometry | |
| JP5382802B2 (en) | Detection and quantification of biomolecules using mass spectrometry | |
| JP2008513011A (en) | Compositions, methods and kits for identifying and quantifying low molecular weight RNA molecules | |
| CN105256033B (en) | Mercury ion detection kit and its detection method based on constant-temperaturecascade cascade nucleic acid amplification | |
| Guo | Mass spectrometry in DNA analysis | |
| KR101820440B1 (en) | Method for detection of target nucleic acids | |
| EP3643789A1 (en) | Pcr primer pair and application thereof | |
| Xi et al. | A highly sensitive strategy for base excision repair enzyme activity detection based on graphene oxide mediated fluorescence quenching and hybridization chain reaction | |
| KR20120018549A (en) | Method for detecting metal ions using unnatural polymerase activity and logic gate using the same | |
| CN104212792A (en) | Nicking endonuclease-based netted rolling cycle amplification system and use thereof | |
| Cheng et al. | Ligase chain reaction coupled with rolling circle amplification for high sensitivity detection of single nucleotide polymorphisms | |
| AU737087C (en) | Method for determining polynucleotide sequence variations | |
| CN108753933B (en) | Real-time fluorescent quantitative PCR detection method and kit based on metal ruthenium complex | |
| CN106086187B (en) | Method for eliminating DTT interference during detection of mercury ions by nucleic acid isothermal amplification by using hydrogen peroxide | |
| CN106086188B (en) | DNA structure probe for detecting mercury ions based on nucleic acid isothermal amplification technology | |
| Li et al. | A primer-initiated strand displacement amplification strategy for sensitive detection of 5-Hydroxymethylcytosine in genomic DNA | |
| Tang et al. | A simple and rapid dual-cycle amplification strategy for microRNA based on graphene oxide and exonuclease III-assisted fluorescence recovery | |
| Zhang et al. | A novel bioluminescent detection of exonuclease I activity based on terminal deoxynucleotidyl transferase‐mediated pyrophosphate release | |
| Suprun et al. | Artificial Modified Nucleotides for the Electrochemical Detection of Nucleic Acid Amplification Products | |
| Sun et al. | Label-free amplified fluorescence detection of DNA biomarkers based on KFP polymerase-driven double strand displacement reactions and magnetic nanoprobes | |
| CN113088564B (en) | Method for detecting mercury ions based on PCR | |
| CN110577985A (en) | Method for detecting DNA methylation | |
| Grokhovsky et al. | Ultrasonic cleavage of DNA in complexes with Ag (I), Cu (II), Hg (II) | |
| KR101227649B1 (en) | Method for Detecting Metal Ions Using Unnatural Polymerase Activity and Logic Gate Using the Same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200114 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |