CN106075396A

CN106075396A - The application of Cul4 albumen

Info

Publication number: CN106075396A
Application number: CN201610547977.4A
Authority: CN
Inventors: 楼慧强; 曹勤红; 张晶晶; 孙海涛
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2016-07-12
Filing date: 2016-07-12
Publication date: 2016-11-09
Anticipated expiration: 2036-07-12
Also published as: CN106075396B

Abstract

The invention provides the application of Cul4 albumen, belong to gene therapy technology field.The present invention, by process LAN Rtt101 albumen in yeast, is equivalent to the Cul4 albumen of the mankind, finds that it can suppress Eco1 gene delection and the growth defect that causes.Therefore the invention provides the application in the genetic diseases medicine that preparation treatment ESCO2 (Eco1 homologous protein in people's cell is ESCO1 and ESCO2) gene mutation, disappearance or ESCO2 protein function disappearance cause of the Cul4 albumen, and then treatment ESCO2 gene mutation, disappearance or ESCO2 protein function lack the correlated inheritance disease caused, such as Luo Baici syndrome, there is good potential applicability in clinical practice, and significant social benefit can be obtained.

Description

The application of Cul4 albumen

Technical field

The invention belongs to gene therapy technology field, specifically, relate to Cul4 albumen (including Cul4A and Cul4B) and Application in its growth defect caused at treatment ESCO2 gene lacks functionality.

Background technology

DNA replication dna is the basis that all life is movable, and the generation of about 40 kinds of diseases is relevant with DNA replication dna, the most at least 14 kinds of drug targetings act on the albumen during DNA replication dna.The relation that researching DNA replicates with human diseases can be dug from profound level The pick pathogenetic mechanism of disease, provides fundamental basis for new drug development and disease treatment.Correctly transmitting genome of hereditary material Stability most important, sister chromatid sticks in and wherein plays indispensable effect.

Sister chromatid adhesion (sister chromatid cohesion, SCC) is that two sister chromatids combine Setting up adhesion the process dissociated, its process is strictly regulated and controled together, and SCC sets up the separation for sister chromatid Correct transmission with hereditary material has great importance.The performance of SCC function relies primarily on Fibronectin and regulation albumen thereof Jointly completing, wherein Fibronectin is the quaternary cyclic compounds being made up of Smc1, Smc3, Scc1 and Scc3.At cell cycle The G1 phase, Fibronectin is attached on chromosome, now under the effect of negative regulatory factor, in conjunction with being unstable, annular Fibronectin can slide on chromosome；Along with the traveling of cell cycle, cell enters the S phase, and Acetylase Eco1 will The Smc3 subunit of Fibronectin carries out acetylation, and the Fibronectin stable bond after acetylation is on chromosome；G2 phase, sister Chromatid adhesion is stably set up, and the effect of energy antagonism negative regulatory factor；After cell enters the later stage of mitotic phase, point Being cut by the Scc1 subunit of Fibronectin from enzyme, Fibronectin departs from from chromosome, and deacetylase Hos1 is to Smc3 Carrying out deacetylation, two sister chromatids are divided to the two poles of the earth of two daughter cells, it is ensured that the stability of hereditary material.SCC Not being only involved in DNA replication dna, the various biological process such as DNA damage reparation is also required to the participation of SCC.Existing document report, works as SCC Foundation generation problem after, it will causing and include melanoma, colon cancer, embryonal carcinoma, breast carcinoma, carcinoma of prostate etc. is interior many Plant the generation of serious disease.The foundation of research SCC and the relation of disease, it will bring new wishing to the multiple genetic diseases for the treatment of Hope.

The foundation of sister chromatid adhesion needs Acetylase Eco1 to participate.Eco1 is the discovery that first at yeast In mutant, this mutant shows chromosome loss rate and improves, and the most defective in heterochromatin regrouping process.Subsequently, Eco1 is found in succession in other biology, and is all indispensable gene.By the sequence of Eco1 in different plant species is compared Different to the N end length finding different plant species, but its C terminal sequence is the most conservative, for acetyltransferase activity center.Lack The cell losing acetyltransferase activity can produce substantial amounts of sister chromatid adhesion defect, then causes death, shows Eco1 Major function be the effect of its Acetylase.

In people's cell, there is homologous protein ESCO1 and ESCO2 of two kinds of Eco1, these two kinds of albumen can be to Smc3 Carry out acetylation, but their function is the most different, not fully redundance.No matter lack which ESCO albumen, another egg All cannot cover its caused defect completely in vain.A kind of growth error disease, referred to as Luo Baici can be caused after ESCO2 sudden change to combine Close disease (Roberts syndrome, RBS).Luo Baici syndrome (Roberts Syndrome) be by and only by ESCO2 The disease that the sudden change of gene causes, symptom includes that patient's growth retardation, limbs occur deformity, hands deformity, craniofacial deformity etc., also The exception of heart, kidney, genitals and hair can be caused.

The transcription product of ESCO2 gene has 3376 nucleotide, ripe mRNA to be made up of 1806 nucleotide, coding 601 aminoacid.ESCO2 albumen n end contains the domain being combined with chromatin, and C end has acetyltransferase activity.ESCO2 Sudden change can cause Luo Baici syndrome.Except two exceptions, major part sudden change is all frameshift mutation or nonsense mutation, causes protein Truncate or non-functional protein.Other two examples belong to missense mutation, due to the ammonia of Acetylase domain high conservative Base acid residue is substituted, and causes acetyltransferase activity to lose.In people's cell, ESCO2 is to set up chromatid adhesion to be musted Need.

Duplication and the repair process of DNA are regulated by ubiquitination, especially by Cullin 4 (Cul4)-RING The regulation and control of E3 ubiquitin ligase.All of Cullin passes through C-end regions and RING finger protein Rbx1/Hrt1 phase Interaction, then recruits E2 ubiquitin binding enzyme.The N-terminal domains of Cullin respectively with the joint of different types of substrate specificity Albumen (adaptor) interacts.The homologous protein of human genome two kinds of Cul4 of expression: Cul4A albumen and Cul4B albumen, it By N-end regions and Ddb1 protein-interacting, the then adaptor protein phase interaction of Ddb1 albumen and various substrate specificities With.These adaptor proteins (adaptor) are called DCAFs (Ddb1-Cul4associated factors).But, multiple for DNA The regulatory mechanism that in system and reparation, ubiquitination substrate and DCAFs participate in is unclear.

The most conventional gene therapy method has two kinds: a kind of method is " in vitro method ", will import external by exogenous gene The recipient cell cultivated, through suitable screening technique, feeds back the recipient cell of restructuring in the patient, allows exogenous gene expression Play a role, with patients in remission.Another kind is referred to as " intracorporal method ", refers to directly be injected in body by foreign DNA, and DNA can With simple injection, it is also possible to inject together with adminicle such as liposome, make exogenous gene transcribe in vivo, translate and play treatment Effect.The gene therapy mode of intracorporal method is simpler than in vitro method, direct, economical, and curative effect is also the most definite.Conventional mode is ill Poison mediation, oligonucleotide direct injection, liposome-mediated and internal gene direct injection etc..

In prior art, the research relating to Cul4 albumen is mainly reflected in the activity by reducing Cul4B, thus suppression is swollen The growth (patent No. CN201210313850.8, CN201380055020.2) of oncocyte.Without reference to Cul4 albumen at ESCO2 Research report in terms of the genetic diseases that genetic flaw causes.

Summary of the invention

It is an object of the invention to for current gene therapy exist targeting not accurately, needs exploitation more treats Gene is to obtain the present situation of more preferable curative effect, it is provided that the gene relevant to the genetic diseases that ESCO2 sudden change causes and application thereof.

For realizing the purpose of the present invention, the present invention (is equivalent to the Cul4 egg of the mankind by process LAN Rtt101 in yeast In vain), the growth defect finding process LAN Cul4 albumen can suppress Eco1 gene delection and to cause.

And then, the invention provides Cul4 albumen at preparation treatment ESCO2 gene mutation, disappearance or ESCO2 protein function Application in the disease medicament that disappearance causes, described Cul4 albumen contains the aminoacid sequence as shown in SEQ ID NO.1 or contains Just like the aminoacid sequence shown in SEQ ID NO.2.

In above-mentioned application, described disease is Luo Baici syndrome.

The invention provides the gene of coding Cul4 albumen at preparation treatment ESCO2 gene mutation, disappearance or ESCO2 albumen Application in the disease medicament that afunction causes, the gene of described coding Cul4 albumen contains as shown in SEQ ID NO.3 Nucleotide sequence or containing nucleotide sequence as shown in SEQ ID NO.4.

In above-mentioned application, described disease is Luo Baici syndrome.

The invention provides a kind of protein overexpression accelerator in preparation ESCO2 gene mutation, disappearance or ESCO2 albumen merit Can lack the application in the disease therapeuticing medicine caused, described albumen contains Cul4A albumen or Cul4B albumen；Described Cul4A egg White containing the aminoacid sequence as shown in SEQ ID NO.1；Described Cul4B albumen contains the amino as shown in SEQ ID NO.2 Acid sequence.

In above-mentioned application, described disease is Luo Baici syndrome.

The invention provides the biomaterial containing Cul4 protein coding gene to treat ESCO2 gene mutation in preparation, lack Losing or ESCO2 protein function lacks the application in the disease medicament caused, described Cul4 protein coding gene contains such as SEQ ID Nucleotide sequence shown in NO.3 or containing nucleotide sequence as shown in SEQ ID NO.4.

In above-mentioned application, described biomaterial is expression vector or host cell.Described disease is that Luo Baici is comprehensive Disease.

Present invention also offers the medicine containing Cul4 albumen or its encoding gene, described Cul4 albumen contains such as SEQ ID Aminoacid sequence shown in NO.1 or containing aminoacid sequence as shown in SEQ ID NO.2；Cul4 protein coding gene contains Nucleotide sequence as shown in SEQ ID NO.3 or containing the nucleotide sequence as shown in SEQ ID NO.4.

The present invention can solve the problem that the deficiency that current gene therapy exists: targeting is the most accurate；Need exploitation more Therapeutic gene is to obtain more preferable curative effect.In the present invention find Cul4 gene can as new therapeutic gene, have wide before Scape.The growth defect (Fig. 1) that present invention discover that in yeast process LAN Rtt101 can suppress Eco1 gene delection and to cause, with Time can also cover the decline (Fig. 2) of the Smc3 Acetylation Level caused due to Eco1 gene delection.This mechanism is at eucaryon Biology is conservative.Therefore, ESCO2 gene function defect is caused to the patient of pernicious Luo Baici syndrome, this area skill Art personnel can be achieved through the following technical solutions the treatment of this disease: (1) imports Cul4 gene in somatic cell and (comprises Cul4A and/or Cul4B gene), utilize one of viral methods or non-viral methods two ways.Viral methods can use by Cul4 builds to adenovirus vector, and exogenous dna fragment can be introduced directly into cell by non-viral methods.Make Cul4 albumen At process LAN in the patient, to suppress ESCO2 gene function defect, reach the purpose for the treatment of.(2) direct injection Cul4 restructuring egg In vain, ESCO2 gene function defect is made up.Construction expression Cul4 recombiant protein plasmid, makes Cul4 recombiant protein great expression, to table The Cul4 recombiant protein reached is purified, by Cul4 albumen direct injection after purification to Luo Baici syndrome patients's body.

Accompanying drawing explanation

Fig. 1 is overexpression ubiquitin ligase complex Rtt101^Mms1Rtt101 subunit can suppress eco1-1 mutant High growth temperature defect schematic diagram.With each mutant strain of gradient dilution laboratory observation at 25 DEG C, 30 DEG C, 34 DEG C, the growth of 37 DEG C Situation.Experimental result shows, overexpression Rtt101 makes at 30 DEG C, 34 DEG C, and 37 DEG C of lethal mutants are able to normal growth. AD-Eco1 is positive control.

Fig. 2 is overexpression ubiquitin ligase complex Rtt101^Mms1Rtt101 subunit can repair eco1-1 mutant The acetylation defect schematic diagram of middle Smc3, the whole-cell protein extracted by TCA in wild type and each mutants which had is used respectively Antibody shown in figure carries out immunoblotting (Western Blot) detection.Result shows overexpression in eco1-1 mutant During Rtt101, can by mutant relatively low amount Smc3 acetylation covering to wild type same level.Wherein Western Blot result compares using tubulin (Tubulin) as applied sample amount.AD is the abbreviation of carrier pGADT7, refers in yeast cells Have expressed the empty carrier of pGADT7 as comparison.AD-Rtt101 is the abbreviation of carrier pGADT7-Rtt101, in yeast cells Have expressed pGADT7-Rtt101 as experimental group.α-ac-Smc3 refers to identify the acetylizad antibody of Smc3, and α-Smc3 refers to identify The antibody of Smc3, α-Tubulin refers to identify the antibody of Tubulin.

Fig. 3 behaves cell ESCO2 and yeast Eco1 protein sequence comparison result figure, ESCO2 and Eco1 in NCBI No. gi Being respectively gi62899035 and gi14318550, as can be seen from the figure these two kinds of albumen n ends change greatly, but C end acetyl Transferring enzyme domain is very conservative (ESCO2 534-601 amino acids, Eco1 211-281 amino acids).

Detailed description of the invention

Following example are used for illustrating the present invention, but are not limited to the scope of the present invention.If not specializing, embodiment In the conventional means that is well known to those skilled in the art of technological means used, raw materials used be commercial goods.

In the following example, Phusion exo+ polymerase is public purchased from full formula gold biology purchased from Thermo fisher, Pfu Department, Tag polymerase is purchased from Takara company, and restricted enzyme is bought from NEB company, and T4 ligase is bought from NEB company, PRS313, pRS316, pGADT7, pAG25 are purchased from Addgene, and primer is synthesized by Sheng Gong biotech firm.

The structure of embodiment 1 eco1-1 mutants which had

1, the expression vector of Acetylase Eco1 in structure saccharomyces cerevisiae: pRS316-Eco1, pRS313-Eco1

The Yeast expression carrier that pRS316 is is nutrition selection markers with URA,

The Yeast expression carrier that pRS313 is is nutrition selection markers with HIS

(1) with the genomic DNA of saccharomyces cerevisiae (Saccharomyces cerevisiae) BY4741 as template, Pfu is used The fragment of polymerase PCR amplification Eco1 mesh:

Eco1-F:5 '-CGCGGATCCCAATTTGATCTTTTTATAAA-3 '；

Eco1-R:5 '-CCGGAATTCTCATATGTATACCGGCAATA-3 '

Then PCR primer is reclaimed with multifunctional dna purification kit.

(2) with fragment and the carrier pRS316 of BamH I and EcoR I double digestion Eco1 mesh.Reaction system: reaction buffer 5 μ L, is separately added into BamH I and EcoR I 1.5 μ L, DNA2 μ g, adds water to 50 μ L, 37 DEG C of enzyme action 2 hours.

(3) electrophoresis, reclaims test kit with glue and reclaims digestion products.

(4) take 3 μ L recovery products and carry out electrophoresis, estimate DNA concentration.Coupled reaction system is set: carrier 100ng, purpose Fragment (purpose fragment and carrier mol ratio are 3:1-10:1), T4DNA ligase 1 μ L, add water to 10 μ L, 16 DEG C overnight connect.

(5) take 5 μ L to connect products and convert bacillus coli DH 5 alphas, coat LB solid medium (containing ammonia benzyl mycin), 37 DEG C It is inverted and cultivates 16 hours.

(6) picking colony is in 5mL LB fluid medium (containing ammonia benzyl mycin), 37 DEG C, 220rpm cultivates 12 hours.

(7) alkaline lysis method of extracting plasmid is used.

(8) plasmid being carried out enzyme action qualification, reaction system is: each 0.5 μ L of reaction buffer 1 μ L, BamH I and EcoR I, matter Grain 3 μ L, add water to 10 μ L, 37 DEG C of enzyme action 1 hour, electrophoresis detection size.

(9) send order-checking by plasmid correct for enzyme action, obtain correct pRS316-Eco1 carrier, pRS313-Eco1 carrier Build identical with the construction method of pRS316-Eco1 carrier.

2, the expression vector of Acetylase Eco1 mutant eco1-1 in saccharomyces cerevisiae is built

pRS313-eco1-1

(1) design mutational site primer.Point mutation primer is:

Eco1-1 (G211D)-F:

5-CCCGATTTTAAGATTGACATATCGAGAATTTGGGTGTG-3’；

Eco1-1 (G211D)-R:

5-CCAAATTCTCGATATGTCAATCTTAAAATCGGGGTAC-3’。

(2) with pRS316-Eco1, pRS313-Eco1 is template, carries out PCR.PCR reaction system: 5 × HF is set Buffer10μL；dNTPs(10mM)1μL；Template(5-50ng)1μL；The each 0.5 μ L of above-mentioned upstream and downstream primer；Phusion is high Proofreading polymerase 0.5 μ L；DMSO 1.5 μ L adds H₂O to 50 μ L.Notice that Phusion polymerase needs thermal starting, should be eventually adding, Immediate response after addition.Response procedures: 98 DEG C 5 minutes；98 DEG C 10 seconds, 58 DEG C 30 seconds, 72 DEG C of 4 minutes (extension of time=templates Length/2kb/ minute), 17 circulations；72 DEG C 20 minutes；As above PCR system and program is used to carry out PCR amplification.

(3) take 10 μ L PCR primer and add 1 μ L Dpn I, 37 DEG C of digestion templates (because there is the modification that methylates in plasmid DNA, And PCR primer does not methylate modification, and Dpn I acts only on and there is the DNA modified that methylates).

(4) postdigestive system is taken 5 μ L and converts DH5 α, transformant is extracted plasmid and checks order.Obtain correct PRS313-eco1-1 carrier.

3, Plasmid Shuffling experiment is used to obtain eco1-1 mutant strain

Because Acetylase is required for the growth of saccharomyces cerevisiae, therefore the ECO1 gene on genome is changed When making, a plasmid that can express Eco1 albumen need to be proceeded in advance.

(1) yeast conversion of pRS316-Eco1 and pRS313-eco1-1 plasmid

1) liquid culture is accessed using saccharomyces cerevisiae (Saccharomyces cerevisiae) BY4741 as background strain In base, cultivate to 2 × 10 for 30 DEG C⁷Individual cell/mL (OD600=1.0).

2) cell is collected to aseptic 1.5mL centrifuge tube by the cultivation bacterium solution of 5mL with the centrifugal condition of 2500g, 30s, goes Fall supernatant liquid culture medium.

3) by cell suspension in the aseptic ultra-pure water of 1mL, then cell is collected in centrifugal with the centrifugal condition of 2500g, 30s Guan Zhong, removes supernatant.

4) by cell suspension in 1mL 0.1mol/L lithium acetate solution, then with the centrifugal condition of 2500g, 30s by cell It is collected in centrifuge tube, removes supernatant.

5) 1mL single-stranded vector DNA sample is boiled 5min, quickly cool down in frozen water.

6) conversion mixed liquor is added on the cell upper strata after centrifugal, converts mixed liquor composition as follows, adds in the following order: PEG3350 (50%W/V) 240 μ L, 1mol/L LiOAc (Quilonorm (SKB)) 36 μ L, single-stranded vector DNA (2mg/mL) 50 μ L, needs to convert The each 1 μ L of pRS316-Eco1 and pRS313-eco1-1, aseptic ultra-pure water 32 μ L, cumulative volume 360 μ L.Add

7) with 2500g, cell is collected in centrifuge tube by the centrifugal condition of 30s, removes supernatant.

8) by cell suspension in the aseptic ultra-pure water of 1mL, then cell is collected in centrifugal with the centrifugal condition of 2500g, 30s Guan Zhong, removes supernatant.

9) by cell suspension in the 100 aseptic ultra-pure waters of μ L, uniform application on SC-URA-HIS solid medium, 30 DEG C It is inverted and cultivates 24-72h, the i.e. available bacterial strain with pRS316-Eco1 and pRS313-eco1-1 plasmid: BY4741 pRS316-ECO1pRS313-eco1-1。

(2) utilize homologous recombination that the ECO1 on genome is knocked out

1) with pAG25 plasmid as template, design 5 ' ends contain the one of target sequence position upstream and downstream each 39nt homology arm To primer, PCR expands this displacement fragment.The primer is as follows:

eco1-del-F:

5’-ACATATTAGGGTTCAACAGAATATAAATCGTTGCACAAAACATGGAGGCCCAGAATACCCT–3’；

eco1-del-R:

5’-ATTTTTCCAGTGTCCCTTCTCGCTGTCTTTTCGAAAGAGCAGTATAGCGACCAGCATTCAC–3’。

2) with pAG25 plasmid as template, with Tag polymerase PCR amplification can homology replace ECO1 on genome with table Reach the purpose fragment of NAT resistance.PCR reaction system: 2 × Tag polymerase 25 μ L；Template(5-50ng)1μL；Primer F 2μL；Primer R 2μL；；Add H₂O to 50 μ L.Response procedures: 95 DEG C 5 minutes；95 DEG C 1 minute, 58 DEG C 30 seconds, 72 DEG C 2 minutes (extension of time=template length/1kb/ minute), 30 circulations；72 DEG C 20 minutes；As above PCR system and program is used to carry out PCR expands.

(3) target fragment utilizing the method for above-mentioned yeast conversion to be obtained by PCR proceeds to BY4741 pRS316-Eco1 In pRS313-eco1-1 bacterial strain.Uniform application, in the solid medium of SC-URA-HIS+NAT, is inverted and is cultivated.Picking transformant Single bacterium colony, lines on new solid plate.Picking thalline, rapid extraction Yeast genome, whether PCR identification of dna fragment occurs Displacement.Finally obtain the bacterial strain that ECO1 on genome knocks out: BY4741 eco1 Δ:: NAT pRS316-Eco1 pRS313- eco1-1。

(4) Plasmid Shuffling experiment is used to obtain eco1-1 mutant strain.5-fluororotic acid (5-FOA) is to make Bearing screening of medicaments for one, when yeast cells can express URA3, the enzyme of URA3 gene code can make 5-FOA become cell Virose material, makes yeast cells can not grow in the culture medium containing 5-FOA.And the pRS316-that above-mentioned experiment is mentioned Eco1 plasmid can express URA3, therefore can screen the bacterial strain of pRS316-Eco1 loss by adding 5-FOA.

The bacterial strain that above-mentioned steps is obtained: BY4741 eco1 Δ:: NAT pRS316-Eco1pRS313-eco1-1 draws The enterprising row filter of flat board of SC-HIS+5-FOA, the bacterial strain obtained is Acetylase defect mutant eco1-1:BY4741 eco1Δ::NAT pRS313-eco1-1。

Embodiment 2 ubiquitin ligase Rtt101^-Mms1Subunit Rtt101 cover Acetylase defect mutant eco1-1 Qualification

1, ubiquitin ligase Rtt101^-Mms1The relevant carriers pGADT7-of covering Acetylase defect mutant eco1-1 The structure of Eco1, pGADT7-Rtt101

The Yeast expression carrier that pGADT7 is is nutrition selection markers with LEU

(1) with the genomic DNA of saccharomyces cerevisiae (Saccharomycescerevisiae) BY4741 as template, gather with Pfu The purpose fragment of synthase PCR amplification Eco1, Rtt101.

The primer sequence is as follows:

Eco1-2-F:5 '-CCGGAATTCATGAAAGCTAGGAAATCGCA-3 '

Eco1-2-R:5 '-CGCGGATCCTCATATGTATACCGGCAATA-3 '

Rtt101-F:5 '-TCCCCCCGGGACAGGAACAATGATAAATGAGAG-3 '

Rtt101-R:5 '-

ACGCGTCGACTCGAGAGATGGCACCAGTCTTAGTAC-3’

Then PCR primer is reclaimed with multifunctional dna purification kit.

(2) with BamH I and EcoR I double digestion purpose fragment ECO1 and carrier pGADT7.Reaction system: reaction buffer 5 μ L, is separately added into BamH I and EcoR I 1.5 μ L, DNA 2 μ g, adds water to 50 μ L, 37 DEG C of enzyme action 2 hours.

(3) with Xma I and Xho I double digestion purpose fragment Rtt101 and carrier pGADT7.Reaction system: reaction buffer 5 μ L, is separately added into Xma I and Xho I 1.5 μ L, DNA2 μ g, adds water to 50 μ L, 37 DEG C of enzyme action 2 hours.

(4) electrophoresis, reclaims test kit with glue and reclaims digestion products.

(5) take 3 μ L recovery products and carry out electrophoresis, estimate DNA concentration.Coupled reaction system is set: carrier 100ng, purpose Fragment (purpose fragment and carrier mol ratio are 3:1-10:1), T4DNA ligase 1 μ L, add water to 10 μ L, 16 DEG C overnight connect.

(6) take 5 μ L to connect products and convert bacillus coli DH 5 alphas, coat LB solid medium (containing ammonia benzyl mycin), 37 DEG C It is inverted and cultivates 16 hours.

(7) picking colony is in 5mLLB fluid medium (containing ammonia benzyl mycin), 37 DEG C, 220rpm cultivates 12 hours.

(8) alkaline lysis method of extracting plasmid is used.

(9) plasmid carries out enzyme action qualification, 1) pGADT7-Eco1 reaction system is: reaction buffer 1 μ L, BamH I He EcoR I each 0.5 μ L, plasmid 3 μ L, add water to 10 μ L, 37 DEG C of enzyme action 1 hour, electrophoresis detection size.2) pGADT7-Mms1 reaction System is: reaction buffer 1 μ L, Xma I and Xho I each 0.5 μ L, plasmid 3 μ L, adds water to 10 μ L, 37 DEG C of enzyme action 1 hour, electrophoresis Detected magnitude.

(10) send order-checking by plasmid correct for enzyme action, obtain correct pGADT7-Eco1, pGADT7-Rtt101 carrier.Structure Build and obtain ubiquitin ligase Rtt101^-Mms1Covering Acetylase defect mutant eco1-1 relevant carriers pGADT7-Eco1, pGADT7-Rtt101。

2, ubiquitin ligase complex Rtt101^-Mms1The strain construction of covering Acetylase defect mutant eco1-1

The expression vector obtained in step 1 is proceeded to the Acetylase that embodiment 1 prepares by the method utilizing yeast conversion In defect mutant eco1-1 i.e.: BY4741 eco1 Δ:: in NATpRS313-eco1-1, finally obtain ubiquitin ligase and be combined The overexpression covering bacterial strain of thing subunit.

1) in the Acetylase defect mutant eco1-1 prepared with embodiment 1 i.e.: BY4741eco1 Δ:: NAT PRS313-eco1-1 accesses in fluid medium as background strain, cultivates to 2 × 10 for 30 DEG C⁷Individual cell/mL (OD600= 1.0)。

6) conversion mixed liquor is added on the cell upper strata after centrifugal, converts mixed liquor as follows by forming, adds in the following order Add: PEG3350 (50%W/V) 240 μ L, 1mol/L LiOAc (Quilonorm (SKB)) 36 μ L, single-stranded vector DNA (2mg/mL) 50 μ L, need PGADT7, pGADT7-Eco1, or the pGADT7-Rtt101 1 μ L converted, aseptic ultra-pure water 32 μ L, cumulative volume 360 μ L.Add After completing, acutely concussion to whole system mixes completely, is placed in 3min on ice.

7) 42 DEG C of heat shock 40min.

8) with 2500g, cell is collected in centrifuge tube by the centrifugal condition of 30s, removes supernatant.

9) by cell suspension in the aseptic ultra-pure water of 1mL, then cell is collected in centrifugal with the centrifugal condition of 2500g, 30s Guan Zhong, removes supernatant.

10) by cell suspension in the 100 aseptic ultra-pure waters of μ L, uniform application on SC-HIS-LEU solid medium, 30 DEG C be inverted cultivate 24-72h.

11) picking transformant list bacterium colony, lines on new solid plate.

12) simultaneously (i.e. background strain in the normally functioning cell of Acetylase Eco1

13) the overexpression covering bacterial strain of ubiquitin ligase complex subunit is finally obtained.I.e.

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7；

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7-ECO1；

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7-RTT101；

3, by immunoblot experiment detection ubiquitin ligase Rtt101 to Acetylase defect mutant eco1-1's Covering.

(1) TCA-acetone method extracts yeast cells total protein and collects the yeast cells of 5OD, uses 1mL 0.25mol/L NaOH, the 1% resuspended thalline of beta-mercaptoethanol, with pipettor piping and druming uniformly, place 10min on ice.Add 160 μ L 50%TCA molten Liquid, vibration mixes rearmounted 10min on ice.With 15000g rotating speed, 4 DEG C of centrifugal 10min, eliminate supernatant.Resuspended with the pre-cold acetone of 1mL Precipitation, uses micropipettor piping and druming fully dispersed to being precipitated to it, with 15000g rotating speed, 4 DEG C of centrifugal 10min, eliminates supernatant. Drying will be deposited in 60 DEG C of baking ovens, suspend with 1 × SDS albumen sample loading buffer and precipitate, boiling water bath 5min.Wherein 1 × SDS egg White sample loading buffer component: Tris-Cl (pH6.8) 50mmol/L, SDS 2%, bromine phenol 0.1%, glycerol 10%, beta-mercaptoethanol 100mM。

(2) above-mentioned sample is carried out the PAGE gel separation of 8% by immunoblotting.The SDS-PAGE completing electrophoresis is coagulated Glue is positioned in transferring film buffer balance.Cut the pvdf membrane big with gel etc., methanol soaks after 1min activates, be placed in transferring film Buffer balances.Open clamping plate, black clamping plate side is soaked in transferring film buffer, places the most respectively and soak The filter paper of size is fitted in the foam-rubber cushion crossed and two opening and closing.Whole it is partially submerged in transferring film buffer, prevents bubble from producing.At filter paper On with from top to bottom order place, gel, pvdf membrane and two filter paper soaked.Whole action is immersed in transferring film buffer In to prevent bubble from producing.Finally place the sponge soaked and be padded on the superiors, tighten up Guan Bi transferring film clamping plate, aligning electrodes, insert Enter in transferring film groove.250mA, 1h, 4 DEG C of transferring film electrophoresis.After transferring film completes, take out pvdf membrane, be placed in 5% defat with PBST preparation In milk, room temperature closes 1h.Remove confining liquid, 2% skim milk that antibody PBST prepares is diluted to suitable concn, room temperature Hatch 1h.(anti-ac-Smc3, anti-Smc3, anti-Tubulin) removes an anti-liquid, washes pvdf membrane 3 with PBST under room temperature Secondary, each 10min.2% skim milk of corresponding two anti-PBST preparations is diluted to suitable concn, incubated at room 1h.Remove Two anti-Incubating Solutions, wash pvdf membrane 3 times with PBST under room temperature, each 10min.After ECL nitrite ion A, B mixed in equal amounts, with PVDF Film room temperature reaction 3min, removes unnecessary nitrite ion on film, is fixed in camera obscura after being sealed by pvdf membrane, darkroom exposure imaging.Knot Fruit sees Fig. 2.

In embodiment 3 yeast, process LAN Rtt101 (being equivalent to the Cul4 albumen of the mankind) can suppress Eco1 gene delection And the growth defect caused

Gradient sensing experiment is carried out with embodiment 2 obtains bacterial strain.That is:

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7；

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7-ECO1；

BY4741 eco1Δ::NAT pRS313-eco1-1 pGADT7-RTT101；

Concrete operations are as follows:

1) by above-mentioned bacterial strains incubated overnight, cell is counted by experimental day, and by dense for the cell of all experimental strains Degree water is adjusted to 2 × 10⁶Individual cell/mL.

2) draw 250 microlitre each experimental strain cell, be added drop-wise to 96 orifice plate first rows, with multi-channel micropipettor 96 Orifice plate secondary series is to the 5th row dropping 200 microliters of sterile ultra-pure waters.

3) set five dilution factors altogether from 96 orifice plate first rows to the 6th row, use multi-channel micropipettor to inhale from first row The cell taking 50 microlitres fully mixes to secondary series, then draws 50 microlitres of cells to the 3rd row from secondary series, carries out 5 with this step Gradient dilution again.

4) use multi-channel micropipettor absorption to draw 5 microlitres of cells from each dilution factor and drop to-HIS-LEU flat board On, the distance between the yeast speckle of each dilution factor dropping is 1.5cm.Thermograde flat board respectively at 25 DEG C, 30 DEG C, 34 DEG C Cultivate with 37 DEG C.

5) carrying out Taking Pictures recording experimental result after 48 hours of incubation, result is shown in Fig. 1.Fig. 1 is that overexpression ubiquitin connects Multienzyme complex Rtt101^Mms1Rtt101 subunit can suppress the high growth temperature defect schematic diagram of eco1-1 mutant.Dilute by gradient Release each mutant strain of laboratory observation

Because the mechanism of chromatid adhesion (SCC) is all conservative from yeast to people, the acetylation of people acetylation Smc3 Eco1 in enzyme ESCO2 and yeast is also high conservative (Fig. 3), so this result can apply to be caused by mankind ESCO2 Disease treatment.

Although, used general explanation, detailed description of the invention and test, the present invention made detailed retouching Stating, but on the basis of the present invention, can make some modifications or improvements it, this is apparent to those skilled in the art 's.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to claimed Scope.

Claims

1.Cul4 albumen is in the disease medicament that preparation treatment ESCO2 gene mutation, disappearance or ESCO2 protein function disappearance cause Application, described Cul4 albumen contains the aminoacid sequence as shown in SEQ ID NO.1 or containing as shown in SEQ ID NO.2 Aminoacid sequence.

Applying the most as claimed in claim 1, described disease is Luo Baici syndrome.

3. the gene of coding Cul4 albumen causes in preparation treatment ESCO2 gene mutation, disappearance or ESCO2 protein function disappearance Application in disease medicament, the gene of described coding Cul4 albumen contains the nucleotide sequence as shown in SEQ ID NO.3 or contains Just like the nucleotide sequence shown in SEQ ID NO.4.

Applying the most as claimed in claim 3, described disease is Luo Baici syndrome.

5. a protein overexpression accelerator is preparing the disease that ESCO2 gene mutation, disappearance or ESCO2 protein function disappearance cause Application in sick medicine, described albumen contains Cul4A albumen or Cul4B albumen；Described Cul4A albumen contains such as SEQ ID Aminoacid sequence shown in NO.1；Described Cul4B albumen contains the aminoacid sequence as shown in SEQ ID NO.2.

Applying the most as claimed in claim 5, described disease is Luo Baici syndrome.

7. contain the biomaterial of Cul4 protein coding gene in preparation treatment ESCO2 gene mutation, disappearance or ESCO2 albumen merit Can lack the application in the disease medicament caused, described Cul4 protein coding gene contains the nucleoside as shown in SEQ ID NO.3 Acid sequence or containing nucleotide sequence as shown in SEQ ID NO.4.

Applying the most as claimed in claim 7, described biomaterial is expression vector or host cell.

Applying the most as claimed in claim 7, described disease is Luo Baici syndrome.

10. containing the medicine of Cul4 albumen or its encoding gene, described Cul4 albumen contains the amino as shown in SEQ ID NO.1 Acid sequence or containing aminoacid sequence as shown in SEQ ID NO.2；Cul4 protein coding gene contains such as SEQ ID NO.3 institute The nucleotide sequence that shows or containing the nucleotide sequence as shown in SEQ ID NO.4.