CN106053817A - A double-antibody sandwich kit for detecting a toxoplasma gondii circulating antigen and a preparing method thereof - Google Patents
A double-antibody sandwich kit for detecting a toxoplasma gondii circulating antigen and a preparing method thereof Download PDFInfo
- Publication number
- CN106053817A CN106053817A CN201610279352.4A CN201610279352A CN106053817A CN 106053817 A CN106053817 A CN 106053817A CN 201610279352 A CN201610279352 A CN 201610279352A CN 106053817 A CN106053817 A CN 106053817A
- Authority
- CN
- China
- Prior art keywords
- liquid
- sag3
- antibody
- value
- substrate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56905—Protozoa
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/44—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from protozoa
- G01N2333/45—Toxoplasma
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Food Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
A double-antibody sandwich kit for detecting a toxoplasma gondii circulating antigen and a preparing method thereof are disclosed. A double-antibody sandwich ELISA process is established by utilizing two anti-SAG3 monoclonal antibodies and used for detecting the toxoplasma gondii circulating antigen in pig serum. The kit and the method overcome disadvantages, such as low detection specificity, low sensitivity and high requirements on persons and instruments in pig serum toxoplasma gondii circulating antigen detection at present, and provide a process for detecting early infection of toxoplasmosis in pigs.
Description
Technical field
The present invention discloses a kind of double crush syndrome test kit detecting arch insect circulating antigen and preparation method thereof, relates to
And one toxoplasma detection method, belong to technical field of immunological detection.
Background technology
Toxoplasmosis is a kind of serious parasitic zoonoses caused by Toxoplasma gondii, in worldwide distribution.Several
Infect all of homoiothermic animal and include people and domestic animal.The whole world has the population of 1/3 to infect this pathogen, in domestic animal
Pig, cattle, sheep etc. all can infect this disease.According to Dubey(2009) infection rate of report countries in the world pig toxoplasma is up to 90.4%.I
State 2009-2013 infection rate of pig in animal reaches 23.4%, and mortality rate is up to more than 60%, and this disease all has phase in China various places
Close report.Toxoplasma is also a kind of food-borne parasite, and people can feel by having eaten the Carnis Sus domestica carrying cyst of toxoplasma gonndii
Dye toxoplasmosis, has important meaning in the propagation of pig toxoplasma.So, toxplasmosis in pigs is to pig farm and human health band
Threaten greatly.Thus it is extremely necessary for setting up a kind of convenient, fast, sensitive, special pig toxoplasma diagnostic method.
It is currently used for In Diagnostic Technology of Toxoplasmosis and has a lot, such as: etiological diagnosis method is simple to operate is a kind of direct
The method of detection polypide, but danger is the highest and sensitivity is low, easy mistaken diagnosis or fail to pinpoint a disease in diagnosis；Molecular biology method is such as: PCR is quick
Perception is high but higher to experimental apparatus and personnel requirement, and false positive easily occurs.Immunological method is such as: dye test is warp
The specific serological method of allusion quotation, sensitivity is high, high specificity but complex operation, cost are high, dangerous greatly.And enzyme linked immunological
Adsorption test (ELISA) have sensitivity height, high specificity, reproducible, simple to operate and be applicable to detect sample many
The advantages such as grass-roots unit and be widely used.
The detection of toxoplasmosis mainly with detection specific antibody be main, but with detect circulating antigen compare, the method
Cannot distinguish between previous infection and Current Infection.Circulating antigen be toxoplasma be discharged in host secretion, metabolism, pyrolysis product
The antigenic component formed, in the body fluid or serum of arch insect infection early stage, content is higher, can be as toxoplasma early infection weight
Want diagnosis index.For improving specificity and the sensitivity of ELISA method, the present invention uses double crush syndrome method.And arch
Worm surface antigen S AG3 is a kind of all to have expression in toxoplasma each period and participate in polypide to the invasion of host cell and glutinous
Attached important albumen.Monoclonal antibody prepared by current SAG3 sets up double crush syndrome method to detect pig toxoplasma blood
Circulating antigen in Qing has no report.
Summary of the invention
It is an object of the invention to provide a kind of double antibodies sandwich test kit detecting arch insect circulating antigen in porcine blood serum and
Preparation method, utilizes two strains anti-SAG3 monoclonal antibody, establishes the double crush syndrome side of circulating antigen in detection porcine blood serum
Method also assembles test kit.
Invention further provides the preparation method of the double antibodies sandwich test kit of detection arch insect circulating antigen, be a kind of
Simple to operate and sensitivity is high, high specificity, reproducible, be applicable to the double crush syndrome reagent of vast grass-roots unit
Box.
The double crush syndrome test kit of detection arch insect circulating antigen of the present invention, it is characterised in that mainly by
Form with lower part:
Capture antibody, the detection antibody of HRP labelling, be coated liquid, sample diluting liquid and cleaning mixture, confining liquid, substrate solution, termination
Liquid, standard positive serum (positive control), standard female serum (negative control), removable polystyrene plastics Sptting plate etc..
Described capture antibody is that (titer is 12800 to toxoplasma SAG3 monoclonal antibody 7 (Anti-A-SAG3-7), hypotype
For G2a)；
(titer is to detect the toxoplasma SAG3 monoclonal antibody 23 (HRP-Anti-A-SAG3-23) that antibody is HRP labelling
12800, hypotype is G2b)
Be coated liquid be pH value be the 0.05M carbonate buffer solution of 9.6；
Sample diluting liquid (PBS) and cleaning mixture (PBST) are the phosphate buffers containing 0.5% Tween-20；
Confining liquid is 1%BSA；
Substrate nitrite ion is tmb substrate solution；
Stop buffer is the H of 2mol/L2SO4Solution.
The preparation method of the double crush syndrome test kit of detection arch insect circulating antigen of the present invention, including with
Lower step:
1) capture antibody and two strain monoclonal antibody, i.e. Anti-A-SAG3-7 and Anti-A-that detection antibody is anti-equal SAG3
SAG3-23；
2) liquid (the 0.05M carbonate buffer solution of pH value 9.6) it is coated: weigh the NaCO of 1.59g3, the NaHCO of 2.93g3；Steam
Distilled water 80mL, after it dissolves, adjusts pH value 9.6, is settled to 100 mL, and 4 DEG C save backup；
3) confining liquid: (1%BSA solution) weighs 1g BSA addition PBST and is dissolved to 100mL.
4) sample diluting liquid (PBS): weigh the NaCl of 8g；The KCl of 0.2；The NaHPO of 2.9g4.12H2O；0.2g's
KH2PO4；Adjust pH value 7.4, be settled to 1000mL；
5) cleaning mixture (PBST): add the Tween-20 of 0.5mL on the basis of 1L PBST；
6) tmb substrate nitrite ion: weigh TMB 200mg, adds dehydrated alcohol 100mL, adjusts pH value 5.0, adds distilled water and be settled to
1000mL makes substrate A liquid；Weigh citric acid 9.33g, Na2HPO414.60g, adds 6.4mL H2O2 , adjust pH value 5.0, add double
Steaming water is settled to 1000mL and makes substrate B liquid；By substrate A liquid: substrate A liquid is that 1:1 adds colour developing；
7) stop buffer: concentrated sulphuric acid 22.2mL；Distilled water 178.8mL；
8) standard positive serum；
9) standard female serum；
10) above-mentioned material is assembled i.e. obtain the present invention.
The two strains anti-SAG3 monoclonal antibody prepared, sets up double crush syndrome method, to the bow in porcine blood serum
Shape insect circulating antigen detects.Solving circulating antigen detection specificity in current porcine blood serum weak, sensitivity is low, to personnel,
Instrument and equipment requires the shortcomings such as high, and the early infection for detection toxplasmosis in pigs provides method.
The Cleaning Principle of detection kit of the present invention: resisting toxoplasmosis surface antigen S AG3 monoclonal antibody is coated in enzyme mark
Plate, forms solid phase carrier, and washing removes free antibodies, adds Serum Circulating Antigen to be checked, and antigen can be with the list on solid phase carrier
Clonal antibody combines, and forms sandwich structure, again washes away free fraction or combine unstable part, adds HRP
Another strain monoclonal antibody of labelling, combines with the antigen-antibody complex in ELISA Plate, washes plate and removes free fraction or combination
Unstable part.Add tmb substrate nitrite ion, then terminate reaction.Microplate reader measures the absorbance when 450nm wavelength
Value (OD450nm value), the depth of color after terminating reacting, OD450nm value size is followed with the toxoplasma in corresponding measuring samples
How many correlations of the content of ring antigen.
The present invention has the active effect that
Simple to operation, less demanding with operator to instrument and equipment.The present invention utilizes two strain SAG3 monoclonal antibodies, and one
Strain as capture antibody, another strain through HRP labelling monoclonal antibody as detection antibody, set up double crush syndrome side
Method, has stronger specificity, reduces the non-specific binding of ELISA, also improves the susceptiveness of the method simultaneously, and
Repeatability is preferably.The advantages such as this detection kit also has testing cost cheap, environmentally safe.Additionally main in test kit
Reagent (provides well-to-do reagent to use leeway for the most sufficiently washing) in addition to cleaning mixture is 20 times of dilutions, and remaining is all with work
The form of liquid provides, it is not necessary to dilution, easy to use.So this invention be pressed for time, clinical basic unit that measuring samples quantity is big examines
Disconnected and Epidemiological study provides a kind of amynologic diagnostic method reliably, simultaneously for prevention ahead of time and treatment toxplasmosis in pigs
Provide foundation.
Detailed description of the invention:
The present invention is described further with following example, but present disclosure is not limited in below example.
Embodiment 1:
Use HRP labeled monoclonal antibody
Description labelling Anti-A-SAG3-23 monoclonal antibody according to Glue activation horseradish peroxidase test kit.Step
Rapid as follows:
(1) take McAb-23 solution 100ug, add 100ul REAGENT I A type activation horseradish peroxidase.
(2) fully mix after adding REAGENT II and adjust pH value 9.5 with PH reagent paper, being placed in 37 DEG C, 30min.
(3) with the rifle head of 200ul, insert in sodium borohydride powder, most advanced and sophisticated it can be seen that during white powder at rifle head, by its turn
Move in enzyme mark thing, mixing.
(4) add REAGEN III (REAGENT II of about 3 times of volumes) and guarantee that enzyme conjugates PH is about 7.0.
(5) addition glycerol is to the 50% of cumulative volume, with stable enzyme conjugates activity ,-20 DEG C of preservations.
Embodiment 2:
The determination of traget antibody optimum dilution degree
With coated elisa plate 4 DEG C after the positive of standard, negative sample doubling dilution overnight, 5% defatted milk with PBST dilution is closed
Powder, dilutes HRP-Anti-A-SAG3-with PBST by the dilution ratio of 1:400,1:800,1:1600,1:3200,1:6400
23, then develop the color, terminate reaction.Measure OD450nmValue, takes OD450nmValue is HRP labelling closest to the dilution ratio in hole when 1
The best effort concentration of antibody.Dilution ratio at 1:3200 is its best effort concentration.
Embodiment 3:
The foundation of double crush syndrome method
1, coated antibody and the determination of the optimal dilution ratio of serum antigen
The method using chessboard square formation, presses 1:400 doubling dilution with Anti-A-SAG3-7 as capture antibody and indulges to 1:12800
To coated elisa plate, 100 μ L/ holes, 4 DEG C overnight.Next day knockout plate washing 3 times with PBST, each 3min.With PBST dilution 5%
Defatted milk powder as sealer, 100 μ L/ holes, hatch 2h for 37 DEG C.Wash plate ibid, by positive for pig toxoplasma equal with negative serum
The most then add ELISA Plate 100 μ L/ hole after being diluted by 1:10,1:20,1:40,1:80 with PBST, hatch 2h for 37 DEG C.Wash
Plate ibid, by it has been determined that the Anti-A-SAG3-23 monoclonal antibody of HRP labelling of optimum diluting multiple is in 1:3200 ratio
Add ELISA Plate, 100 μ L/ holes, hatch 1h for 37 DEG C.Wash plate ibid, add tmb substrate nitrite ion 100 μ L/ hole, hatch for 37 DEG C
15min.Add 2 mol/L H2SO4 100 μ L/ holes terminate reaction, measure OD450nmValue.Blank to be set, positive control (P)
With negative control (N), then select the best effort concentration of coated antibody and serum to be checked.The extension rate of optimal coated antibody
Being 1:3200, serum optimum dilution degree is that 1:80(is shown in Table 1).
2, the selection of optimal sealer
Fixed optimal coated antibody, enzyme labelled antibody diluted concentration under, select 4 kinds of sealers (include 5% defatted milk powder,
10% hyclone, 5%BSA, 1%BSA) close.1%BSA for optimal sealer (see Table 2).
3, the judgement of double crush syndrome marginal value
Through 18 parts of known pig arch insect circulating antigen negative serums of double crush syndrome detection, after measuring OD 450nm value, meter
The meansigma methods calculated is 0.074, and standard deviation (SD) is that 0.024(is shown in Table 3), the detection lower limit of positive is X+3SD=0.146, for
Avoid false-positive occurring calculating suspicious interval.Thus when OD450nm >=0.170 is set to the positive, i.e. sample bends without pig
Shape insect circulating antigen；When 0.122≤OD450nm ＜ 0.170 is judged to suspicious, but again detect, again judge；When
OD450nm ＜ 0.122 is judged to feminine gender, i.e. without pig arch insect circulating antigen in sample.
4, the mensuration of performance
(1) sensitivity tests
In the case of other conditions are constant, use it has been determined that double crush syndrome method, by pig toxoplasma positive serum
By 1:40 to 1:1280 doubling dilution.Judge the sensitivity of the method.The susceptiveness of the method is that 1:640(is shown in Table 4).
(2) specific test
Through double crush syndrome method, using pig toxoplasma positive serum and pig toxoplasma negative serum as reference, detect two parts
Pork measles positive serum, carries out serum cross reaction test, determines the specificity (see Table 5) of the method, and result shows that this has relatively
High specific.
(3) replica test
The double crush syndrome method selecting 11 parts of serum to be set up obtains after criticizing interior replica test between carrying out criticizing, heavy in batch
The coefficient of variation maximum of renaturation test is 4.38%, and interassay coefficient of variation maximum is 10.1%, shows the method repeatability relatively
Good (see Table 6).
Embodiment 4
The assembling of the dual anti-good woods ELISA kit of arch insect circulating antigen in detection porcine blood serum
ELISA detection kit includes following components:
1, capture antibody and two strain monoclonal antibody, i.e. Anti-A-SAG3-7 and Anti-A-that detection antibody is anti-equal SAG3
SAG3-23；
2, liquid (the 0.05M carbonate buffer solution of pH value 9.6) it is coated: weigh NaCO31.59g； NaHCO3 2.93g；Distilled water
80mL, after it dissolves, adjusts pH value 9.6, is settled to 100 mL, and 4 DEG C save backup；
3, confining liquid: (1%BSA solution) weighs 1g BSA addition PBST and is dissolved to 100mL；
4, sample diluting liquid (PBS): weigh NaCl 8g；KCl 0.2；NaHPO4.12H2O 2.9g；KH2PO40.2g；Adjust PH
Value 7.4, is settled to 1000mL；
5, cleaning mixture (PBST): add the Tween-20 of 0.5mL on the basis of 1L PBST；
6, tmb substrate nitrite ion: (weighed TMB 200mg, add dehydrated alcohol 100mL, adjust pH value 5.0 by substrate A liquid, add double
Steam water and be settled to 1000mL), (weigh citric acid 9.33g, Na with substrate B liquid2HPO414.60g, adds 6.4mL H2O2 , adjust PH
Value 5.0, adds distilled water and is settled to 1000mL) 1:1 adds colour developing；
7, stop buffer: concentrated sulphuric acid 22.2mL；Distilled water 178.8mL；
8 standard positive serums；
9, standard female serum；
10, above-mentioned material is assembled i.e. obtain the present invention.
Preservation condition: standard positive and negative serum and two strain monoclonal antibody (Anti-A-SAG3-7 and Anti-A-SAG3-
23) it is-20 DEG C of preservations.The storage temperature of remaining component of test kit is 4 DEG C of preservations.
Embodiment 5
Double crush syndrome detection kit is to the detection of arch insect circulating antigen in porcine blood serum
The test kit of the present invention 94 parts of samples and 94 parts, Jilin Area sample respectively to In Guangdong Province are utilized to enter arch insect infection feelings
The detection of condition, its step is as follows:
(1) it is coated in Anti-A-SAG3-7 and ELISA Plate in the ratio of 1:3200 with being coated liquid, hatches 2h for 37 DEG C；
(2) liquid in plate is dried, cleaning mixture washing 3 times, 3min/ time；
(3) add confining liquid, 100uL/ hole, the repetition of 3, each sample, hatch 2h for 37 DEG C；
(4) liquid in plate is dried, cleaning mixture washing 3 times, 3min/ time；
(5) measuring samples is added: the measuring samples that addition PBS is diluted by 1:80,100uL/ hole, the repetition of 3, each sample, 37 DEG C
Hatch 2h；
(6) liquid in plate is dried, cleaning mixture washing 3 times, 3min/ time；
(7) detection antibody is added: with PBST by 1:3200 dilution detection antibody 100uL/ hole, add ELISA Plate 37 DEG C and hatch 1h；
(8) liquid in plate is dried, cleaning mixture washing 4-5 time, 3min/ time；
(9) colour developing: add tmb substrate nitrite ion, 100uL/ hole, hatch 15min for 37 DEG C；
(10) stop buffer, 100uL/ hole are added；
(11) OD value is surveyed: measure OD450 value by microplate reader；
(12) result judges: survey each hole value with blank control wells after returning to zero, after measuring OD450nm value, according to formula: when
OD450nm >=0.170 is set to the positive；When 0.122≤OD450nm ＜ 0.170 is judged to suspicious, but again detect, carry out again
Secondary judgement；When OD450nm ＜ 0.122 is judged to feminine gender.
94 parts of sample detection of result In Guangzhou Area, showing 19 parts is positive serum, and positive rate is 20.2%(19/94),
94 parts, Jilin Area sample detection, having 11 parts is positive serum, and positive rate is 11.7%(11/94).
SEQ no.1
<110>Jilin University
<120>
<140>
<160> 1
<210> 1
<211> 1038
<212> DNA
<213>Toxoplasma gondii (Toxoplasma godii)
<400> 1
1 GAGCACGGAC TGTTCGTCGC CGCAGGGAAA TCGAGAAGTA AGATAACCTATTTTGGCACG
61 CTCACTCAGA AGGCTCCGAA CTGGTACCGC TGCTCTTCAA CGAGGGCGAATGAAGAGGTC
121 GTAGGACATG TGACGCTGAA CAAAGAGCAC CCTGATATGA CAATTGAATGCGTCGACGAC
181 GGCTTGGGCG GAGAGTTTTT GCCGCTCGAA GGCGCGACGT CGTCGTACCCGCGAGTATGT
241 CACATTGATG CCAAGGACAA GGGCGACTGC GAGCGCAACA AGGGCTTTCTGACCGACTAC
301 ATACCGGGCG CGAAGCAGTA CTGGTACAAG ATAGAAAAGG TGGAGAACAACGGCGAGCAA
361 TCCGTTCTGT ACAAATTCAC AGTTCCTTGG ATATTCCTTC CGCCCGCCAAGCAGCGATAC
421 AAGGTTGGAT GCCGATACCC GAACCACGAG TATTGCTTTG TTGAGGTCACCGTCGAACCC
481 ACGCCGCCAA TGGTCGAAGG CAAGAGAGTG ACCTGCGGGT ACCCCGAGTCCGGCCCCGTG
541 AATCTCGAGG TGGACTTGTC AAAGGACGCG AACTTTATCG AGATTCGGTGCGGCGAACAG
601 CACCACCCGC AGCCGTCGAC CTACACGCTG CAGTACTGCT CAGGTGACTCGGTGGACCCG
661 CAGAAGTGTT CGCCGCAGTC CCTGACGAAC ATTTTTTATG ACTACAGCTCTTCGTGGTGG
721 AAGGGGAAAC TGAACGGGCC TGACGGGGCA ACTCTCACCA TTCCACCCGGCGGGTTCCCC
781 GAAGAAGACA AATCTTTTCT TGTCGGGTGT TCACTCACTG TGGACGGGCCGCCCTTCTGC
841 AACGTCAAAG TGAGAGTTGC CGGGAACCCC AGAAAGTGGG GGAGAGGCGGAGGCGGCCAT
901 CCAGGAAGCG GAGGATTGCA GCCGGGAACT GAAGGGGAAA GTCAAGCTGGAACAGAAAGT
961 TCAGCCGGCG CGAGTTCGCG AATGGCTTCC GTTGCCCTGG CGTTCCTTCTCGGTCTCCTT
1021 GTGCATGTGG CTGCCTAA
Claims (2)
1. the double crush syndrome test kit detecting arch insect circulating antigen, it is characterised in that main by with lower part group
Become:
Capture antibody, the detection antibody of HRP labelling, be coated liquid, sample diluting liquid and cleaning mixture, confining liquid, substrate solution, termination
Liquid, standard positive serum (positive control), standard female serum (negative control)；
Described capture antibody is that (titer is 12800 to toxoplasma SAG3 monoclonal antibody 7 (Anti-A-SAG3-7), and hypotype is
G2a)；
(titer is to detect the toxoplasma SAG3 monoclonal antibody 23 (HRP-Anti-A-SAG3-23) that antibody is HRP labelling
12800, hypotype is G2b)；
Be coated liquid be pH value be the 0.05M carbonate buffer solution of 9.6；
Sample diluting liquid (PBS) and cleaning mixture (PBST) are the phosphate buffers containing 0.5% Tween-20；
Confining liquid is 1%BSA；
Substrate nitrite ion is tmb substrate solution；
Stop buffer is the H of 2mol/L2SO4Solution.
2. the preparation method of double crush syndrome test kit of the detection arch insect circulating antigen described in claim 1, including with
Lower step:
1) capture antibody and two strain monoclonal antibody, i.e. Anti-A-SAG3-7 and Anti-A-that detection antibody is anti-equal SAG3
SAG3-23；
2) liquid (the 0.05M carbonate buffer solution of pH value 9.6) it is coated: weigh the NaCO of 1.59g3, the NaHCO of 2.93g3；Steam
Distilled water 80mL, after it dissolves, adjusts pH value 9.6, is settled to 100 mL, and 4 DEG C save backup；
3) confining liquid: (1%BSA solution) weighs 1g BSA addition PBST and is dissolved to 100mL；
4) sample diluting liquid (PBS): weigh the NaCl of 8g；The KCl of 0.2；The NaHPO of 2.9g4.12H2O；The KH of 0.2g2PO4
；Adjust pH value 7.4, be settled to 1000mL；
5) cleaning mixture (PBST): add the Tween-20 of 0.5mL on the basis of 1L PBST；
6) tmb substrate nitrite ion: weigh TMB 200mg, adds dehydrated alcohol 100mL, adjusts pH value 5.0, adds distilled water and be settled to
1000mL makes substrate A liquid；Weigh citric acid 9.33g, Na2HPO414.60g, adds 6.4mL H2O2 , adjust pH value 5.0, add double
Steaming water is settled to 1000mL and makes substrate B liquid；By substrate A liquid: substrate A liquid is that 1:1 adds colour developing；
7) stop buffer: concentrated sulphuric acid 22.2mL；Distilled water 178.8mL；
8) standard positive serum；
9) standard female serum；
10) above-mentioned material is assembled i.e. obtain the present invention.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610279352.4A CN106053817A (en) | 2016-05-03 | 2016-05-03 | A double-antibody sandwich kit for detecting a toxoplasma gondii circulating antigen and a preparing method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610279352.4A CN106053817A (en) | 2016-05-03 | 2016-05-03 | A double-antibody sandwich kit for detecting a toxoplasma gondii circulating antigen and a preparing method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106053817A true CN106053817A (en) | 2016-10-26 |
Family
ID=57176539
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610279352.4A Pending CN106053817A (en) | 2016-05-03 | 2016-05-03 | A double-antibody sandwich kit for detecting a toxoplasma gondii circulating antigen and a preparing method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106053817A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109283348A (en) * | 2018-11-19 | 2019-01-29 | 中国农业大学 | Detect the double-antibody sandwich elisa kit and preparation method and application of arch insect circulating antigen in many animals serum |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090252760A1 (en) * | 2005-11-01 | 2009-10-08 | Ricardo Tostes Gazzinelli | Construction of Recombinant Adenovirus With Genes That Codify for SAG1, SAG2 and SAG3 |
| CN102010468A (en) * | 2010-08-27 | 2011-04-13 | 吉林大学 | Toxoplasma circulating antigen double antibody sandwich ELISA (Enzyme-Linked Immuno Sorbent Assay) detection method |
| CN102288768A (en) * | 2011-09-19 | 2011-12-21 | 厦门市湖里区妇幼保健院 | Toxoplasma gondii IgG (immunoglobulin G) antibody immunoblotting kit and preparation method thereof |
| CN102304578A (en) * | 2011-08-29 | 2012-01-04 | 浙江大学 | Kit for detecting cysticercus cellulosae, swine trichinella and swine toxoplasmosis and application |
| US20130273094A1 (en) * | 2010-11-04 | 2013-10-17 | The University Of Chicago | Vaccines against toxoplasma gondii |
-
2016
- 2016-05-03 CN CN201610279352.4A patent/CN106053817A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090252760A1 (en) * | 2005-11-01 | 2009-10-08 | Ricardo Tostes Gazzinelli | Construction of Recombinant Adenovirus With Genes That Codify for SAG1, SAG2 and SAG3 |
| CN102010468A (en) * | 2010-08-27 | 2011-04-13 | 吉林大学 | Toxoplasma circulating antigen double antibody sandwich ELISA (Enzyme-Linked Immuno Sorbent Assay) detection method |
| US20130273094A1 (en) * | 2010-11-04 | 2013-10-17 | The University Of Chicago | Vaccines against toxoplasma gondii |
| CN102304578A (en) * | 2011-08-29 | 2012-01-04 | 浙江大学 | Kit for detecting cysticercus cellulosae, swine trichinella and swine toxoplasmosis and application |
| CN102288768A (en) * | 2011-09-19 | 2011-12-21 | 厦门市湖里区妇幼保健院 | Toxoplasma gondii IgG (immunoglobulin G) antibody immunoblotting kit and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 马亮: "弓形虫表面抗原SAG3单克隆抗体的制备及应用研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109283348A (en) * | 2018-11-19 | 2019-01-29 | 中国农业大学 | Detect the double-antibody sandwich elisa kit and preparation method and application of arch insect circulating antigen in many animals serum |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110862881B (en) | Special cleaning solution or diluent for full-automatic chemiluminescence determinator and preparation method thereof | |
| CN104655847A (en) | Enzyme linked immunosorbent assay kit (ELISA kit) for detecting adprin and detection method thereof | |
| CN104655846A (en) | Enzyme linked immunosorbent assay kit for detecting progesterone and detection method thereof | |
| CN103018450A (en) | Chloramphenicol chemiluminescence enzyme-linked immunodetection kit | |
| Lei et al. | A sensitive and specific enzyme immunoassay for detecting tartrazine in human urinary samples | |
| CN104101702A (en) | Indirect competition ELISA (enzyme-linked immunosorbent assay method) for tetrabromo bisphenol A | |
| CN104076154A (en) | Enzyme linked immunosorbent assay kit detecting folic acid and application thereof | |
| CN106093383A (en) | Porcine reproductive and respiratory syndrome virus antibody ELISA diagnosis reagent kit and preparation method thereof | |
| CN102206270B (en) | Saxitoxin artificial antigen and anti-saxitoxin antibody, their preparation methods and application | |
| CN101893636A (en) | Enzyme-linked immunosorbent assay method for egg allergen ovalbumin in foods | |
| CN106053817A (en) | A double-antibody sandwich kit for detecting a toxoplasma gondii circulating antigen and a preparing method thereof | |
| CN102798713B (en) | Detection kit for food red 10 and preparation method thereof | |
| CN102331500A (en) | Method and enzyme linked immunosorbent assay kit for detecting lemon yellow | |
| CN103145633B (en) | Novel melamine antigen and antibody and application | |
| CN101413944B (en) | Enzyme-linked immunologic detection method of full fluorine caprylic acid | |
| CN105296520A (en) | Preparation method and enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag | |
| CN102296049A (en) | ELISA (enzyme-linked immunosorbent assay) kit for quickly detecting gonyautoxin GTX2/3 and preparation method thereof | |
| CN103217524B (en) | Cystic echinococcosis cyst fluid degreasing antigen for detecting alveolar echinococcosis antibody, and preparation method thereof | |
| CN102507945A (en) | Sulfamethazine enzyme-linked immunoassay kit | |
| CN104897651A (en) | Chemiluminescent kit for aflatoxin M1 and application thereof | |
| CN110618274B (en) | Chimeric ELISA kit for simultaneously and quantitatively detecting total amount of aflatoxin and zearalenone in edible oil | |
| CN102942519A (en) | Nitenpyram hapten, artificial antigen and antibody, their preparation methods and application thereof | |
| CN106872708B (en) | Competitive ELISA detection kit and its application in lead ion environmental pollution | |
| CN106841627B (en) | Heavy metal molybdenum ion competitive ELISA detection kit and its application | |
| CN1624480A (en) | Fenvalerate direct competition enzyme joint immune absorption analysis technology and its kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20161026 |
|
| WD01 | Invention patent application deemed withdrawn after publication |