CN105296520A - Preparation method and enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag - Google Patents
Preparation method and enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag Download PDFInfo
- Publication number
- CN105296520A CN105296520A CN201510882724.8A CN201510882724A CN105296520A CN 105296520 A CN105296520 A CN 105296520A CN 201510882724 A CN201510882724 A CN 201510882724A CN 105296520 A CN105296520 A CN 105296520A
- Authority
- CN
- China
- Prior art keywords
- 3h11ag
- antigen
- enzyme
- solution
- pbs
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
A high-solubility and high-expression tumor antigen 3H11Ag protein is prepared by virtue of a molecular cloning method, and a corresponding polyclonal antibody is prepared by virtue of immune animal purification. On this basis, an ELISA kit capable of detecting 3H11Ag is prepared by taking a monoclonal antibody, the polyclonal antibody and an antigen protein of the antigen as main active components. According to the kit, a method for rapidly, simply and conveniently determining the protein concentration of 3H11Ag in supernatant of tumor cells is provided; the kit can be applied to the scientific research or the clinical diagnosis of relevant diseases of cancers.
Description
Technical field
The invention belongs to biomedicine technical field, the design of the preparation method relating in particular to a kind of human tumor antigen 3H11Ag and the enzyme-linked immunologic detecting kit detecting this antigen, and preparation method thereof.
Background technology
Immunodetection is the analytical procedure of a kind of specific recognition based on antigen, antibody reaction, can by marking (as enzyme, fluorescent substance, labelled with radioisotope etc.) antigen or antibody, utilize the signal amplification of marker, combine with modern test technology, qualitative, quantitative mensuration is carried out to target compound specific in sample, there is high specificity, highly sensitive, method is convenient, cost is low and can systematize, business-like feature.
The ultimate principle of enzyme-linked immunosorbent assay (ELISA) is that enzyme molecule is combined with antibody or anti-antibody molecule covalent, and this kind of combination can not change the immunological characteristic of antibody, does not also affect the biologic activity of enzyme.This kind of enzymic-labelled antibody can with the antigen be adsorbed on solid phase carrier or antibody generation specific binding.After dripping substrate solution, substrate can make the hydrogen donor contained by it become coloured oxidized form by colourless reduced form under enzyme effect, occurs color reaction.Therefore, the color reaction by substrate determines whether corresponding immune response, and in the depth of color reaction and sample, the amount of corresponding antibodies or antigen is proportional.This kind of color reaction carries out quantitative assay by microplate reader, and the susceptibility of so just zymochemistry being reacted and the specific binding of antigen antibody reaction get up, and makes the detection method that enzyme-linked immunosorbent assay becomes a kind of not only special but also responsive.
Double crush syndrome refers to that detected antigen is combined between two antibody, and one of them antibody bag is fixed on solid phase carrier, i.e. capture antibodies, and it can catch the antigen in sample.Another is then detect antibody, directly measures the amount of antigen after this antibody available enzyme mark; Or do not mark, then measure the amount of antigen by the secondary antibody of enzyme labelling.The method has highly sensitive, the high narrow spectrum feature of detection.
China investigator is by obtaining mouse monoclonal antibody 3H11 with tumour cell immune mouse, and it can be combined with kinds of tumors tissue and cell-specific, once attempts clinically being used for tumor imaging determination tumor tissues position and size.By with 3H11 antibody screening tumour cell cDNA library, obtaining can by the 3H11Ag tumour antigen of 3H11 monoclonal antibody specific recognition.It comes from centrosome protein CEP290 (CentrosomalProteinof290kDa, Genebank sequence number 80184).Because 3H11Ag tumour antigen comes from an intracellular protein, after some cell cancerates, it can express the biological cells and tissues surface of cancerating, and whether also there is 3H11Ag tumour antigen and also do not report at present in tumor cell culture supernatant and affinity antibody to SpA.The application successfully clonal expression 3H11Ag in E.coli first, and obtain polyclonal antibody for 3H11Ag with the 3H11Ag of the application's expression and purification as immunogen immune rabbit.In addition, the application, also using 3H11Ag as standard substance, utilizes the design of 3H11 monoclonal antibody to prepare Double-antibody sandwich enzymelinked immunosorbent detection kit.This test kit can be used for detection and determines whether also there is 3H11Ag tumour antigen in tumor cell culture supernatant and affinity antibody to SpA.This invention can be scientific research and pathological research provides corresponding Detection of antigen instrument.Also can be used for tumour patient clinical detection and screening in addition.
Summary of the invention
The present invention for template with the cDNA of clinical former stomach organization, by PCR reaction amplification 3H11Ag, builds suitable expression vector, obtains the 3H11Ag that high expression level height dissolves; Corresponding antigen protein is utilized to prepare its polyclonal antibody; And then set up a kind of can the measuring method of fast and simple mensuration 3H11Ag protein concentration, for corresponding the scientific research even clinical study of cancer-related diseases are provided convenience.
A first aspect of the present invention is to provide the high solvable preparation method of a kind of human tumor antigen 3H11Ag albumen high expression level.
With stomach organization cDNA for template, according to the CEP290 gene coded sequence announced, design primer amplification 3H11Ag gene, is connected in intestinal bacteria cold shock expression vector pCold-GST, is built the expression vector of 3H11Ag.Transform with expression vector and express bacterium, expressed the 95kD fusion rotein of band GST label by low temperature induction.The fusion rotein that purifying marks with GST, removes GST label, obtains not containing the 69kD3H11Ag albumen of label.
Through experiment sieving, the present invention devises the specificity amplification primer of following sequence:
3H11Ag_T_F:5 ' GAAGTAAATGAGCTAAAAAGTG (SEQIDNo.2) and 3H11Ag_T_R:5 ' CTGAAATTTGGCTATCACTGTC (SEQIDNo.3).
Although the present invention finds that expression vector as known in the art is a lot, a lot of expression vectors cannot obtain the solubility expression of 3H11Ag, and expression amount is limited.Through experimental study, the present inventor finds with pCold-GST construction of expression vector pCold-GST-3H11Ag, and its expression 3H11Ag albumen solubility is high and expression amount large, and after removing GST label, the purity not containing the 3H11Ag albumen of label is still high.
In the present invention, expressing bacterium can be BL21 (DE3), C41, C43 etc., and be preferably BL21 (DE3), its expressing quantity is apparently higher than other bacterium.
The e. coli bl21 having transformed expression vector expresses 95kDGST-3H11Ag fusion rotein by low temperature induction, and inducing temperature is 12-16 DEG C, preferred 14-15 DEG C.By microorganism collection after induction, ultrasonic treatment, collects albumen supernatant after high speed centrifugation.
In the present invention, the 3H11Ag albumen preferably using GST affinity chromatography column purification to mark with GST, removes GST label by HRV3C proteolytic enzyme, obtains not containing the 69kD3H11Ag albumen of any label.
Second aspect of the present invention is to provide a kind of preparation method of 3H11Ag protein polyclone antibody of improvement.
Prepare and the 3H11Ag protein immune animal of purifying with preceding method of the present invention, get the serum of immune animal, obtain the polyclonal antibody of 3H11Ag through purifying of saltouing.
Immunized animal can be rabbit, sheep, mouse, horse etc.As preferably, described animal is rabbit or sheep.Be more preferably New Zealand white rabbit.
The program of immune animal is four immunity, first time immunity, subcutaneous injection immune animal after mixing with Freund's complete adjuvant with antigen, second time and third time immunity, subcutaneous injection immune animal after mixing with freund 's incomplete adjuvant with antigen, last immunity, with antigen intravenous immune animal.
The mass ratio of preferred antigens and Freund's complete adjuvant or freund 's incomplete adjuvant is 1:0.5-3, is preferably 1:0.8-2, more preferably 1:0.9-1.5, most preferably is about 1:1.
The total injection volume of preferred first time immunizing antigen is 1mg; Second time and third time immunity, the total injection volume of each antigen is 0.5mg; Last immunity, antigen injection amount is 1mg.
Preferably, each immunization interval 10 days.
In the present invention, saltout purified polyclonal antibodies method be preferably: the polyclonal antibody of saltouing with saturated ammonium sulphate solution in purified blood serum.More preferably: the mode of about 1:1 by volume, adds saturated ammonium sulphate solution, get precipitation after centrifugal in animal serum; The PBS solution of described precipitation 1MpH7.4 is suspended, adds equal-volume saturated ammonium sulphate solution, after centrifugal, get precipitation, described step repetitive operation two to four times.Last gained precipitation be dissolved in the PBS of appropriate 1MpH7.4, the PBS solution being placed in 1MpH7.4 is dialysed.
In the how anti-0.1MpH7.4PBS be stored in containing 30% glycerine, 0.01% Thiomersalate after purifying, many anti-final concentrations are 1mg/ml.
3rd aspect of the present invention is to provide the ELISA kit detecting 3H11Ag.
Comprise in described test kit: the solid phase carrier of 3H11Ag monoclonal antibody bag quilt, 3H11Ag protein standard substance, the positive reference substance of 3H11Ag, the polyclonal antibody of anti-3H11Ag, ELIAS secondary antibody.Or comprise: the solid phase carrier of 3H11Ag monoclonal antibody bag quilt, 3H11Ag protein standard substance, the positive control sample of 3H11Ag, the polyclonal antibody of the anti-3H11Ag of enzyme mark.
Can comprise further: substrate nitrite ion, stop buffer, washings and/or diluent.
In the present invention, preferred described 3H11Ag and 3H11Ag polyclonal antibody is that the preparation method recorded by the present invention prepares.Preferred described 3H11Ag polyclonal antibody is rabbit polyclonal antibody.
Described 3H11 monoclonal antibody can adopt the hybridoma technology etc. of this area monoclonal antibody to prepare.
In test kit, the bag of 3H11Ag monoclonal antibody can be 1-10 μ g/ml by concentration, and preferred 3-7 μ g/ml, most preferably is 5 μ g/ml.Coating buffer is the PBS of 0.2MpH7.4.
In the present invention, the material of described solid phase carrier can be selected from but be not limited to polyvinyl chloride, the solid phase carrier material of Enzyme-linked Immunosorbent Assay that polystyrene, poly-this area such as propionic acid amide and Mierocrystalline cellulose are commonly used; Its form can be selected from but be not limited to shrinkage pool flat board, test tube, bead etc.In preferred version of the present invention, described solid phase carrier is that shrinkage pool is dull and stereotyped, is preferably polystyrene shrinkage pool dull and stereotyped, is preferably polystyrene 96 orifice plate.
Preferably with monoclonal antibody bag by after solid phase carrier, process with confining liquid, do not wrap the site of quilt to close.Described confining liquid can be the PBS solution of 1MpH7.4 containing 1%-5%BSA, or the PBS solution of 1MpH7.4 containing 0.5%-3% fully skimmed milk powder, is preferably the PBS solution of the 1MpH7.4 containing 1% fully skimmed milk powder.
In the present invention, enzyme used can be selected from but be not limited to is horseradish peroxidase, alkaline phosphatase, glucose oxidase, vitamin H etc.Enzyme and antibody linked, can adopt conventional glutaraldehyde method and periodates oxidation style.In a preferred embodiment of the invention, enzyme used is horseradish peroxidase.
Described substrate display liquid can be selected according to enzyme used, such as, to horseradish peroxidase, can use tetramethyl benzidine (TMB)-H
2o
2system, and ABTS [2,2 "-Bian nitrogen base-bis-(3-ethyl benzo thiophene pyrroline-6 sulfonic acid)]-H
2o
2system, O-Phenylene Diamine-H
2o
2system, dianisidine-H
2o
2system, 5-aminosalicylic acid-H
2o
2system, o-tolidine-H
2o
2system; To alkaline phosphatase, para-nitro-pheneye phosphate can be used; To vitamin H, Avidin can be used.In a preferred embodiment of the invention, according to horseradish peroxidase used, use TMB-H
2o
2system substrate nitrite ion.
Described diluent is for diluting antigen standard, antigen positive reference substance, many anti-, ELIAS secondary antibody.Described diluent can be the PBS solution of 1MpH7.4, or the PBS solution of 1MpH7.4 containing 1%-3%BSA, or the PBS solution of 1MpH7.4 containing 0.5%-3% fully skimmed milk powder.The diluent being preferred for diluting antigen standard, antigen positive reference substance and ELIAS secondary antibody is the PBS solution of 1MpH7.4, for diluting the PBS solution that many anti-diluents are the 1MpH7.4 containing 0.5% fully skimmed milk powder.Experimental study of the present invention finds, by diluent of optionally arranging in pairs or groups, adopts the array configuration of the preferred diluent in the present invention, can reduce background noise to greatest extent, improves the final signal to noise ratio detected.
Consisting of of preferred test kit of the present invention:
1, enzyme plate: the enzyme plate of 5 μ g/ml3H11Ag monoclonal antibody bag quilts;
2, diluent: the diluent of 3H11Ag standard substance, positive reference substance and ELIAS secondary antibody is the PBS of 1MpH7.4, the how anti-diluent of rabbit is the PBS of the 1MpH7.4 containing 0.5% fully skimmed milk powder;
The PBS of 3, washings: 1MpH7.4, wherein containing 0.05% polysorbas20;
4, the goat anti-rabbit igg that ELIAS secondary antibody: HRP marks, dilutes with 1MpH7.4PBS1:10000 during use;
5,3H11Ag standard substance: the 1MpH7.4PBS solution of 3H11Ag albumen, 3H11Ag final concentration is 10ug/ml;
6,3H11Ag positive reference substance: the 1MpH7.4PBS solution of 3H11Ag albumen, 3H11Ag final concentration is 1mg/ml;
7, rabbit resists more: many anti-1MpH7.4PBS solution, 1:100000 dilution during use;
8, substrate nitrite ion: TMB-H
2o
2system,
1. substrate solution A: citric acid: 0.1M; Sodium phosphate dibasic: 0.2M;
2. substrate solution B:TMB2mg/ml;
During use, the working concentration of citric acid is 0.025M, and Sodium phosphate dibasic is 0.05M, TMB is 0.1mg/ml.
9, stop buffer: 2MH
2sO
4solution.
Described test kit can contain or not containing confining liquid, described confining liquid is preferably the PBS solution of the 1MpH7.4 containing 1% fully skimmed milk powder.
Use the method for test kit of the present invention test sample as follows:
1, testing sample, standard substance, positive reference substance are processed: with diluent, sample is suitably diluted, positive reference substance 1:10 is diluted; Standard substance diluted becomes 10ug/ml, 1ug/ml, 0.1ug/ml, 0.05ug/ml, 0.01ug/ml five gradients;
2, testing sample, standard substance, positive reference substance are added successively in enzyme mark hole, every hole 100 μ l, hatch 2 hours for 37 DEG C, washings washs 3 times, and each washing all pats dry liquid in hole;
3, add in enzyme mark hole by the rabbit of anti-3H11Ag resisting, every hole 100 μ l, hatch 1 hour for 37 DEG C, washings washs 3 times more;
4, add ELIAS secondary antibody, every hole 100 μ l, hatch 30 minutes for 37 DEG C, washings washs 3 times, and each washing all pats dry liquid in hole;
5, add substrate nitrite ion, every hole 50 μ l, incubated at room added stop buffer after 15 minutes, every hole 50 μ l;
6, under 450nm wavelength, absorbancy is measured by microplate reader, and the reference wavelength absorbancy of 630nm.
In the present invention, the PBS of 1MpH7.4 consists of: containing NaCl8.18g, KCl0.201g, Na in every premium on currency
2hPO
412H
2o3.58g, KH
2pO
40.228g, adjusts pH to 7.4.
The PBS of 0.1MpH7.4, does 10 times of dilutions by the PBS of 1MpH7.4 and obtains.
The PBS of 0.2MpH7.4, does 5 times of dilutions by the PBS of 1MpH7.4 and obtains.
Accompanying drawing illustrates:
Fig. 1: express and purifying after 3H11Ag albumen and its rabbit polyclonal antibody Western-Blot detect figure.In figure, right side is molecular weight markers.
Fig. 2: the typical curve of the standard substance set up with ELISA experimental technique of the present invention.In figure, X-coordinate is the logarithmic value of standard concentration, and ordinate zou is OD
450nm-OD
630nm.
Embodiment
Embodiment 1
Preparation 3H11Ag
1, the acquisition of 69kD3H11Ag protein fragments:
With clinical former stomach organization cDNA for template, design primer:
Upstream primer 5 ' GAAGTAAATGAGCTAAAAAGTG;
Downstream primer 5 ' CTGAAATTTGGCTATCACTGTC.
CEP290 the 36th is to the 634th amino acids sequence (SEQIDNo.1) in amplification.
PCR100ul system: 10 × PCRbuffer10ul, Mg
2+6ul, dNTP8ul, primer-F0.5ul, primer-R0.5ul, ddH2O72.5ul, rTaq2ul, DNA profiling 0.5ul.
The condition of PCR: 95 degree of sex change 30 seconds; 55 degree of annealing 30 seconds; 72 degree of extensions 2 minutes.Totally 25 circulations.Afterwards, 72 degree of maintenances 30 minutes.PCR terminates, 4 degree of preservations.
Pcr amplification product carries out the checking of nucleic acid glue, shows to increase successfully.
On selection optimization expression carrier, invention has been a large amount of trial.First, to pRSF-duet (T7 system), pQE60 (T5 system) and pCold system have been carried out sample and have been expressed trial.
The target protein expression contrast table of the different expression vector of table 1
| Expression vector | Target protein expression amount | Target protein solubility |
| PRSF-due (T7 system) | Low | Soluble |
| PQE60 (T5 system) | Low | Soluble |
| PCold system | High | Solvable |
In pCold system, the label that the present invention has attempted different molecular weight is on the impact of expression amount and solubility, and such as His6, Trx, Sumo, GST, MBP, TF2, finally have selected the strong and pCold-GST expression vector that expression amount is high of solubility.
Pcr amplification product is connected in intestinal bacteria cold shock expression vector pCold-GST, construction of expression vector pCold-GST-3H11Ag.The specific operation process of construction of expression vector:
1. 10ul linked system is prepared: PCR primer 7ul, carrier pCold-GST1ul, 10 × T
4ligasebuffer1ul, T
4ligase1ul;
2. will 1. 16 DEG C connect 1 hour;
3. nucleic acid gel electrophoresis checking successful connection.
Verify positive colony by bacterium colony PCR, and extract the plasmid DNA of positive colony, check order, result shows that its gene fragment is correctly cloned into expression vector.
When selecting suitable competent cell, the present invention has attempted BL21 (DE3), C41, C43 tri-kinds of Host Strains.Wherein BL21 (DE3) is optimal selection.
The target protein expression contrast table of table 2 different host strain
| Host Strains | Target protein expression amount |
| BL21(DE3) | The highest (often liter of bacterium can obtain 2mg albumen) |
| C41 | Generally |
| C43 | Less |
By expression vector pCold-GST vector BL21 (DE3), the condition of conversion and operation:
1. take out competence BL21 (DE3) from-80 DEG C of refrigerators, ice melts 3 minutes;
2. 10ul connects product and adds in 100ul competence BL21, ice bath 30 minutes, 42 DEG C of heat shocks 90 seconds, ice bath 2-5 minute;
3. add 400ulLB substratum, put into 37 DEG C of incubators, incubation 30 minutes;
4. 5000rpm × 5 minute, centrifugal, abandon supernatant to retaining 100ul coated plate, flat board is ammonia benzyl resistance.Second day, select positive colony from flat board.
2, the preparation and purification of the 3H11Ag protein fragments of 69kD:
Positive colony is inoculated in 10mlLB substratum, then transfers in 1LLB substratum, OD
600nmvalue when being 0.4, cold shock half an hour, then add 1MIPTG solution 400ul, 14.5 DEG C of inductions 24 hours.
Ultrasonic degradation after receipts bacterium, lysate formula is: 100mMNaCl, 50mMNa
2hPO
4, 1mMEDTA, 5% glycerine, 0.1mg/ml N,O-Diacetylmuramidase.
At 4 DEG C, 12000 revs/min, centrifugal 30 minutes.The 3H11Ag antigen protein that albumen supernatant uses GST affinity column (purchased from GEHealthcare) purifying to mark with GST, obtains a large amount of 95kDGST-3H11Ag fusion rotein.
Remove GST label by HRV3C proteolytic enzyme, its enzyme cutting buffering liquid formula is 100mMNaCl, 50mMNa
2hPO
4, 1mMEDTA, 5% glycerine, 0.1mg/mlHRV3C proteolytic enzyme, at 4 DEG C, enzyme cuts 12 hours, obtains not containing the 69kD3H11Ag antigen protein of any label.
3, the qualification of 69kD3H11Ag Antigenic Protein Fragments:
Above-mentioned antigen protein is through SDS-PAGE protein electrophoresis and coomassie dyeing display, a newly-increased band near 69kD, through Westernblotting qualification, can with 3H11 monoclonal antibody generation strong positive reaction, illustrate that the 3H11Ag antigen protein of this 69kD has stronger immunogenicity.
Embodiment 2
Prepare the polyclonal antibody of anti-3H11Ag
1, animal immune:
By the 3H11Ag prepared in embodiment 1, be all mixed and made into mixture according to mass ratio 1:1 with Freund's complete adjuvant, freund 's incomplete adjuvant respectively.
Immune animal uses New Zealand white rabbit.
First time immunity: the mixture of rabbit dorsal sc injection antigen and Freund's complete adjuvant 1:1, the total injection volume of antigen is 1mg.For preventing immunological tolerance, backbone both sides, back, select 8 injections.
Second time immunity: with first time immunization interval 10 days, the mixture of rabbit dorsal sc injection antigen and freund 's incomplete adjuvant 1:1, the total injection volume of antigen is 0.5mg.
Third time immunity: with second time immunity.
Last immunity: tire to improve, is directly slowly injected into 3H11Ag albumen 1mg in rabbit body by rabbit auricular vein.
All first being used for detection from rabbit auricular vein blood drawing 0.5-1ml before each immunity to tire, reaching 1: one hundred ten thousand to tiring.
2, bloodletting and separation of serum:
Rabbit Aorta gets blood, each 40ml, 4 DEG C leave standstill within 30 minutes, solidify after, centrifugal 15 minutes of 3000rpm, obtain serum, serum is frozen in-80 DEG C of refrigerators.
3, many anti-purifying:
At 4 DEG C, get 40ml rabbit anteserum and be placed in 100ml beaker, dropwise add 40ml saturated ammonium sulphate solution wherein.Beaker is placed on magnetic stirring apparatus, built-in lesser trochanter.Centrifugal 10 minutes of gained solution 3000 revs/min, abandons supernatant, retains precipitation.Add in the PBS solution of 40ml1MpH7.4 by upper step precipitation, dropwise add 40ml saturated ammonium sulphate solution, centrifugal 10 minutes of gained solution 3000 revs/min, abandons supernatant, retains precipitation.This step repetitive operation three times.
Be dissolved in the PBS of 5ml1MpH7.4 by last gained precipitation, the PBS solution 4 DEG C being placed in 4L1MpH7.4 is dialysed 12 hours.
Concentrate afterwards, be stored in the 0.1MpH7.4PBS containing 30% glycerine, 0.01% Thiomersalate, many anti-final concentrations are 1mg/ml.
Titration step:
1. envelope antigen: be 5 micrograms/hole by 3H11Ag do dilution with coating buffer, every hole adds 100ul, and 37 DEG C of incubations are after 1 hour, and 16 ~ 18h placed by 4 DEG C of refrigerators.
Coating buffer: 1.59gNa
2cO
32.93gNaHCO
3, constant volume is to 1L, pH9.6
2. wash: to the greatest extent liquid in plate hole, fill it up with washings, quietly put three minutes, liquid in hole to the greatest extent.Washings is PBST:NaCl8.18g, KCl0.201g, Na
2hPO
412H
2o3.58g, KH
2pO
40.228g, adds distilled water to 1000ml, adjusts pH to 7.4, then adds the polysorbas20 of 0.05%.
3. add confining liquid 100 microlitre, place 2h for 37 DEG C.Consisting of of confining liquid: bovine serum albumin (BSA) 1g, adds PBST to 100ml.Washing after closing, working method is same 2..
4. add rabbit to resist: do the dilution of a series of concentration gradient with washings by how anti-for rabbit more, as diluted 100 times, 1000 times, 10000 times, 100000 times, 1000000 times.Every hole adds 50 microlitres.Compare with diluent simultaneously.Place washing after 1 hour for 37 DEG C.
5. add two to resist: add horseradish peroxidase goat anti-rabbit igg, every hole 50ul, places 37 DEG C and wash after 0.5 hour.
6. substrate solution: join 10ml substrate solution: citric acid: 0.1M; Sodium phosphate dibasic: 0.2M; Add TMB2mg/ml again; Add the 30%H of 5-10ul before use again
2o
2.
7. add substrate solution 50ul/ hole, lucifuge reacts 10 minutes.Add stop buffer 2MH again
2sO
4: every hole 50ul.
8. with enzyme-linked immunosorbent assay instrument record 450nm reading.Detected value: negative value >2.1, namely thinks the positive.
The OD value of the enzyme linked immunosorbent detection of the how anti-different weaker concn of table 3
Embodiment 3
The preparation of 3H11AgELISA detection kit
1, agents useful for same:
(1) coating buffer (pH7.40.2MPBS damping fluid): NaCl8.18g, KCl0.201g, Na
2hPO
412H
2o3.58g, KH
2pO
40.228g, adds distilled water to 1000ml, adjusts pH to 7.4, redilution 5 times.
(2) diluent (pH7.41MPBS damping fluid): NaCl8.18g, KCl0.201g, Na
2hPO
412H
2o3.58g, KH
2pO
40.228g, adds distilled water to 1000ml, adjusts pH to 7.4.
(3) confining liquid (3%BSA/PBS solution): BSA300mg, 1MpH7.4PBS10ml.
(4) washings (PBST): 0.05%PBST, the i.e. PBS of 1MpH7.4, wherein containing 0.05% polysorbas20.
(5) ELIAS secondary antibody (the goat-anti rabbit of HRP mark is how anti-): the goat anti-rabbit igg that the horseradish peroxidase (HRP) of purchased from American Millipore marks, during use, the PBS of 1MpH7.4 dilutes according to 1:10000.
(6) 3H11Ag protein standard substance: the 1MPBS solution of the 3H11Ag albumen of 69kD prepared by embodiment 1, pH7.4, containing 5% glycerine, 3H11Ag final concentration is 1mg/ml, during use by diluted to 10ug/ml, 1ug/ml, 0.1ug/ml, 0.05ug/ml, 0.01ug/ml five gradients.
(7) positive reference substance of 3H11Ag: the 1MPBS solution of 3H11Ag albumen, pH7.4, containing 5% glycerine, the final concentration of 3H11Ag is 1mg/ml, does 1:10 dilution during use with diluent.
(8) rabbit of anti-3H11Ag resists more: how anti-PBS solution prepared by embodiment 2, containing the 0.1MpH7.4PBS of 30% glycerine, 0.01% Thiomersalate, does 1:100000 dilution during use with diluent.
(9) substrate nitrite ion (TMB-H
2o
2system):
1. substrate solution A:
Citric acid: 0.1M (19.2g/L) 24.3ml; Sodium phosphate dibasic: 0.2M (28.4g/L) 25.7ml; Adding distil water 50ml again;
2. substrate solution B:
TMB2mg/ml, i.e. TMB1mg, add dehydrated alcohol 0.5ml;
3. add colour developing substrate solution A10ml and substrate solution B0.5ml to be mixed in first 10 minutes, then add 5ul30%H
2o
2as substrate nitrite ion.
(10) stop buffer (2MH
2sO
4solution).
2, key instrument:
(1) microplate reader: BioTekSynergy.
(2) ELISA Sptting plate: Denmark Nunc96 orifice plate.
One, chessboard method selects the best bag of monoclonal antibody by titre
1. after 3H11 monoclonal antibody being done a series of dilution with coating buffer, every hole 100 μ l, hatches one hour for 37 DEG C, and 4 DEG C of bags were by 8 hours, and PBST washs 3 times, eliminates liquid in hole;
2. add 3H11Ag protein standard substance and 3H11Ag positive control, hatch, washing;
3. add how anti-solution, hatch, washing;
4. add ELIAS secondary antibody, hatch, washing;
5. add substrate colour developing, after 15 minutes, add stop buffer;
6. read light absorption value, choosing 3H11Ag positive control light absorption value is 0.6 to 1.0, and the light absorption value of negative control is less than the monoclonal antibody bag of 0.1 by concentration---5ug/ml as the best bag by concentration.
Two, test kit is prepared
1, envelope antigen: 3H11 monoclonal antibody pH7.40.2MPBS damping fluid is diluted to 5ug/ml, wraps by 96 orifice plates, every hole 100 μ l, hatches 1 hour for 37 DEG C, 4 DEG C 8 hours.
2, wash: PBST washs 3 times, first time expresses 10 seconds, washes slowly for latter twice, each standing three minutes, then pats dry, eliminates liquid in hole.
3, add confining liquid: 3%BSA150ul, 4 DEG C are spent the night.Washing is with step 2.
Reagent set in corresponding reagent box becomes:
1. enzyme plate: 96 orifice plates of the 3H11 monoclonal antibody bag quilt prepared by abovementioned steps 1-3;
The 1MPBS of 2. diluent: pH7.4;
3. washings (PBST): 0.05%PBST, the i.e. 1MPBS of pH7.4, wherein containing 0.05% polysorbas20;
4. the goat anti-rabbit igg that ELIAS secondary antibody: HRP marks;
5. 3H11Ag standard substance;
6. 3H11Ag positive reference substance;
7. the rabbit of anti-3H11Ag resists more;
8. substrate nitrite ion: TMB-H
2o
2system;
9. stop buffer: 2MH
2sO
4solution.
Three, mentioned reagent box is utilized to detect the method for 3H11Ag concentration in tissue or cells and supernatant:
1. testing sample, standard substance, positive reference substance are processed: with diluent cells and supernatant sample is carried out 10 times of dilutions, positive control 1:10 dilutes; Standard substance diluted becomes 10ug/ml, 1ug/ml, 0.1ug/ml, 0.05ug/ml, 0.01ug/ml five gradients;
2. testing sample, standard substance, positive reference substance are added successively in enzyme mark hole, every hole 100 μ l, hatch 2 hours for 37 DEG C, PBST washs 3 times, and each washing all pats dry liquid in hole;
3. add in enzyme mark hole by the rabbit of anti-3H11Ag resisting, every hole 100 μ l, hatch 1 hour for 37 DEG C, PBST washs 3 times more;
4. add ELIAS secondary antibody, every hole 100 μ l, hatch 30 minutes for 37 DEG C, PBST washs 3 times, and each washing all pats dry liquid in hole;
5. add substrate solution, every hole 50 μ l, incubated at room added stop buffer after 15 minutes, every hole 50 μ l;
6. under 450nm wavelength, measure absorbancy by microplate reader, then deduct the reference wavelength absorbancy of 630nm, make the typical curve of different concns standard substance, described typical curve is shown in accompanying drawing 2.
Testing sample comes from cells and supernatant, cell used: HCT116 (colon cancer cell), SW480 (rectum cancer cell), HELF (normal cell), HEK293 (normal cell).
Nutrient solution: DMEM90%, foetal calf serum 10%.
Culture condition: 37 DEG C, 5%CO
2incubator.
1. take out freeze-stored cell recovery, the cell of having recovered is added nutrient solution DMEM90%, in foetal calf serum 10%.
2. 37 DEG C, 5%CO
2incubator culturing cell, interval two days passes a generation, pass two generations stable after get cells and supernatant.
The determination data of table 4 standard substance Criterion curve
| 3H11Ag concentration (ug/ml) | OD 450nm-OD 630nm |
| 10 | 0.639 |
| 1 | 0.363 |
| 0.1 | 0.161 |
| 0.05 | 0.135 |
| 0.01 | 0.11 |
| 0 | 0.034 |
The different cells and supernatant ELISA determination data of table 5
| Cell culture supernatant | OD 450nm-OD 630nm |
| HCT116 | 0.137 |
| SW480 | 0.142 |
| HELF | 0.054 |
| HEK293 | 0.05 |
| Nutrient solution | 0.045 |
| Negative control | 0.042 |
Claims (10)
1. prepare the method for human tumor antigen 3H11Ag for one kind, it is characterized in that, with stomach organization cDNA for template, amplification 3H11Ag gene, construction of expression vector pCold-GST-3H11Ag, transforms with expression vector and expresses bacterium, the 95kD fusion rotein of band GST label is expressed by low temperature induction, the fusion rotein that purifying marks with GST, removes GST label, obtains not containing the 69kD3H11Ag albumen of label.
2. preparation method as claimed in claim 1, is characterized in that, the sequence of amplification the primer is: upstream primer 5 ' GAAGTAAATGAGCTAAAAAGTG; Downstream primer 5 ' CTGAAATTTGGCTATCACTGTC.
3. preparation method as claimed in claim 1 or 2, it is characterized in that, described expression bacterium is e. coli bl21 (DE3).Preferably inducing temperature is 12-16 DEG C further, is more preferably 14-15 DEG C.
4. prepare a method for human tumor antigen 3H11Ag polyclonal antibody, it is characterized in that, the 3H11Ag immune animal of preparing by preparation method described in any one of claim 1-3, gets the serum of immune animal, and purifying of saltouing obtains 3H11Ag polyclonal antibody.Preferred described animal is New Zealand white rabbit.The program of preferred immune animal is four immunity, first time immunity, subcutaneous injection immune animal after mixing with Freund's complete adjuvant with antigen, second time and third time immunity, subcutaneous injection immune animal after mixing with freund 's incomplete adjuvant with antigen, last immunity, with antigen intravenous immune animal.The mass ratio of preferred antigens and Freund's complete adjuvant or freund 's incomplete adjuvant is 1:0.5-3, is preferably 1:0.8-2, more preferably 1:0.9-1.5, most preferably is about 1:1.The total injection volume of preferred first time immunizing antigen is 1mg; Second time and third time immunity, the total injection volume of each antigen is 0.5mg; Last immunity, antigen injection amount is 1mg.Preferably, each immunization interval 10 days.
5. preparation method as claimed in claim 4, described in purification process of saltouing be that the mode of about 1:1 by volume, adds saturated ammonium sulphate solution, get precipitation after centrifugal in animal serum; The PBS solution of described precipitation 1MpH7.4 is suspended, adds equal-volume saturated ammonium sulphate solution, after centrifugal, get precipitation, described step repetitive operation two to four times; Last gained precipitation be dissolved in the PBS of appropriate 1MpH7.4, the PBS solution being placed in 1MpH7.4 is dialysed.
6. one kind is detected the enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag, it is characterized in that comprising: the solid phase carrier of 3H11Ag monoclonal antibody bag quilt, 3H11Ag protein standard substance, the positive reference substance of 3H11Ag, the polyclonal antibody of anti-3H11Ag, ELIAS secondary antibody; Or comprise: the solid phase carrier of 3H11Ag monoclonal antibody bag quilt, 3H11Ag protein standard substance, the positive reference substance of 3H11Ag, the polyclonal antibody of the anti-3H11Ag of enzyme mark.
7. enzyme-linked immunosorbent assay kit as claimed in claim 6, it is characterized in that, the bag of 3H11Ag monoclonal antibody is 1-10 μ g/ml by concentration, and preferred 3-7 μ g/ml, most preferably is 5 μ g/ml.
8. enzyme-linked immunosorbent assay kit as claimed in claims 6 or 7, is characterized in that, comprise substrate nitrite ion, stop buffer, washings and/or diluent further.Preferred diluent is the PBS solution of 1MpH7.4, or the PBS solution of 1MpH7.4 containing 1%-3%BSA, or the PBS solution of 1MpH7.4 containing 0.5%-3% fully skimmed milk powder.The diluent being preferred for diluting antigen standard, antigen positive reference substance and ELIAS secondary antibody is further the PBS solution of 1MpH7.4, for diluting the PBS solution that many anti-diluents are the 1MpH7.4 containing 0.5% fully skimmed milk powder.
9. the enzyme-linked immunosorbent assay kit as described in any one of claim 6-8, is characterized in that consisting of:
The enzyme plate of 5 μ g/ml3H11Ag monoclonal antibody bag quilts;
Diluent: the diluent of 3H11Ag standard substance, positive reference substance and ELIAS secondary antibody is the PBS of 1MpH7.4, the how anti-diluent of rabbit is the PBS of the 1MpH7.4 containing 0.5% fully skimmed milk powder;
The PBS of washings: 1MpH7.4, wherein containing 0.05% polysorbas20;
The goat anti-rabbit igg that ELIAS secondary antibody: HRP marks;
3H11Ag standard substance: the 1MpH7.4PBS solution of 3H11Ag albumen, 3H11Ag final concentration is 10ug/ml;
3H11Ag positive reference substance: the 1MpH7.4PBS solution of 3H11Ag albumen, 3H11Ag final concentration is 1mg/ml;
Rabbit resists more: many anti-1MpH7.4PBS solution;
Substrate nitrite ion: TMB-H
2o
2system;
Stop buffer: 2MH
2sO
4solution;
Wherein: the formula of the PBS damping fluid of 1MpH7.4 is: containing NaCl8.18g, KCl0.201g, Na in every premium on currency
2hPO
412H
2o3.58g, KH
2pO
40.228g.
10. detect a method for 3H11Ag content in sample, it is characterized in that, use the enzyme-linked immunosorbent assay kit described in any one of claim 6-9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510882724.8A CN105296520B (en) | 2015-12-04 | 2015-12-04 | A kind of preparation method and its enzyme-linked immunologic detecting kit of human tumor antigen 3H11Ag |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510882724.8A CN105296520B (en) | 2015-12-04 | 2015-12-04 | A kind of preparation method and its enzyme-linked immunologic detecting kit of human tumor antigen 3H11Ag |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105296520A true CN105296520A (en) | 2016-02-03 |
| CN105296520B CN105296520B (en) | 2019-01-15 |
Family
ID=55194347
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510882724.8A Active CN105296520B (en) | 2015-12-04 | 2015-12-04 | A kind of preparation method and its enzyme-linked immunologic detecting kit of human tumor antigen 3H11Ag |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105296520B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834327A (en) * | 2017-03-10 | 2017-06-13 | 江苏省农业科学院 | The solubility expression preparation method of Patatin samples phosphatidase III |
| CN107602706A (en) * | 2017-10-16 | 2018-01-19 | 湖北大学 | A kind of HRV3C protease substrates mutant of cutting efficiency enhancing and its application |
| CN111551748A (en) * | 2020-05-29 | 2020-08-18 | 临沂大学 | Enzyme-linked immunosorbent assay kit for trichosanthin and use method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101091800A (en) * | 2006-07-27 | 2007-12-26 | 北京大学 | Medicine in use for diagnosing gastric cancer, and preparation method |
| CN102875671A (en) * | 2012-09-27 | 2013-01-16 | 南京农业大学 | Clothianidin antigen, antibody and application thereof |
| CN103091492A (en) * | 2011-11-04 | 2013-05-08 | 中国科学院上海生命科学研究院 | Diagnostic reagent and kit for cancer |
| US20150182634A1 (en) * | 2012-12-28 | 2015-07-02 | Cody P. Coyne | Molecular Design and Chemical Synthesis of Pharmaceutical-Ligands and Pharmaceutical-Pharmaceutical Analogs with Multiple Mechanisms of Action |
| CN104792997A (en) * | 2014-01-22 | 2015-07-22 | 天津汇滨生物科技有限公司 | Human procalcitonin immunodetection kit, and preparation method and application thereof |
-
2015
- 2015-12-04 CN CN201510882724.8A patent/CN105296520B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101091800A (en) * | 2006-07-27 | 2007-12-26 | 北京大学 | Medicine in use for diagnosing gastric cancer, and preparation method |
| CN103091492A (en) * | 2011-11-04 | 2013-05-08 | 中国科学院上海生命科学研究院 | Diagnostic reagent and kit for cancer |
| CN102875671A (en) * | 2012-09-27 | 2013-01-16 | 南京农业大学 | Clothianidin antigen, antibody and application thereof |
| US20150182634A1 (en) * | 2012-12-28 | 2015-07-02 | Cody P. Coyne | Molecular Design and Chemical Synthesis of Pharmaceutical-Ligands and Pharmaceutical-Pharmaceutical Analogs with Multiple Mechanisms of Action |
| CN104792997A (en) * | 2014-01-22 | 2015-07-22 | 天津汇滨生物科技有限公司 | Human procalcitonin immunodetection kit, and preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 陈东海 等: "单克隆抗体3H11对应抗原的全长cDNA克隆及表达", 《中华医学杂志》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834327A (en) * | 2017-03-10 | 2017-06-13 | 江苏省农业科学院 | The solubility expression preparation method of Patatin samples phosphatidase III |
| CN107602706A (en) * | 2017-10-16 | 2018-01-19 | 湖北大学 | A kind of HRV3C protease substrates mutant of cutting efficiency enhancing and its application |
| CN107602706B (en) * | 2017-10-16 | 2020-12-04 | 湖北大学 | HRV3C protease substrate mutant with enhanced cleavage efficiency and application thereof |
| CN111551748A (en) * | 2020-05-29 | 2020-08-18 | 临沂大学 | Enzyme-linked immunosorbent assay kit for trichosanthin and use method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105296520B (en) | 2019-01-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107255726B (en) | Quantitatively detect the fluorescence immune chromatography test paper and preparation method thereof of human parathyroid hormone | |
| He et al. | Development of sandwich ELISA for testing bovine β-lactoglobulin allergenic residues by specific polyclonal antibody against human IgE binding epitopes | |
| CN101160526B (en) | Antibody directed against gastrin-releasing peptide precursor and use thereof | |
| CN102087279A (en) | Enzyme linked immunosorbent assay kit for combined diagnosis of gastrosis or evaluation of gastric cancer risks | |
| CN105541655B (en) | The general artificial semiantigen of Capsaicinoids, artificial complete antigen and its application | |
| CN106432508B (en) | A kind of PLA2R THSD7A fusion proteins and its application and kit | |
| Kawahara et al. | Antibodies to human gastric epithelial cells and heat shock protein 60 in Helicobacter pylori positive mucosa associated lymphoid tissue lymphoma | |
| CN104792997A (en) | Human procalcitonin immunodetection kit, and preparation method and application thereof | |
| CN102421799A (en) | Novel monoclonal antibody for analyzing high-molecular weight adiponectin and utilization of same | |
| CN105296520A (en) | Preparation method and enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag | |
| CN103045541A (en) | Hybridoma cell strain and monoclonal antibody of anti-heart-type fatty acid-binding protein generated by same | |
| CN104360065B (en) | Vibrio parahemolyticus enzyme-linked immunologic detecting kit | |
| CN102206270A (en) | Saxitoxin artificial antigen, anti-saxitoxin antibody prepared by the saxitoxin artificial antigen, and their preparation methods and application | |
| CN102608332B (en) | Enzyme-linked immunoassay (ELISA) method of grass carp interleukin 10 | |
| CN101981452B (en) | Method for detection of pneumococcus | |
| CN101368953A (en) | Chemical luminescence ELISA detection reagent kit of ciprofloxacin | |
| CN107402300B (en) | A kind of method of quick identification human parathyroid | |
| JPS63292061A (en) | Selective immunological measuring method of complete flaw-free pracollagen peptide (iii type) and procollagen (iii type) | |
| US8048637B2 (en) | Diagnostic composition and method for the detection of a Trichinella infection | |
| CN111944049B (en) | Preparation method and application of SLC12A9 antibody | |
| CN105223362B (en) | Campylobacter jejuni enzyme-linked immunologic detecting kit | |
| CN110275014B (en) | Method for rapidly identifying metastasis of papillary thyroid carcinoma cervical lymph nodes in operation | |
| CN111220802B (en) | Clenbuterol hydrochloride small molecule hapten high sensitivity detection test paper based on nano antibody and preparation method thereof | |
| CN102944682A (en) | Crab type antibody repertoire detection kit | |
| CN114181909B (en) | Hybridoma cell strain, monoclonal antibody thereof and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230419 Address after: 350109 18th floor, building 1, Sanchuang Industrial Park, No. 10 Yaoxi Road, Nanyu Town, Minhou County, Fuzhou City, Fujian Province Patentee after: Fujian Yitong Biotechnology Co.,Ltd. Address before: Fuzhou City, Fujian province 350002 Yangqiao Road No. 155 Patentee before: FUJIAN INSTITUTE OF RESEARCH ON THE STRUCTURE OF MATTER, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right |