CN106048002A - Method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells - Google Patents
Method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells Download PDFInfo
- Publication number
- CN106048002A CN106048002A CN201610372267.2A CN201610372267A CN106048002A CN 106048002 A CN106048002 A CN 106048002A CN 201610372267 A CN201610372267 A CN 201610372267A CN 106048002 A CN106048002 A CN 106048002A
- Authority
- CN
- China
- Prior art keywords
- cell
- gene promoter
- detection method
- glioma
- pancreatin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses a method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells; comprising the steps: first, extracting glial cells; second, culturing the cells; third, treating with a drug; fourth, extracting mRNA; fifth, reacting: pre-denaturing at 95 DEG C for 30 s, denaturing at 95 DEG C for 20 S, annealing at 60 DEG C for 15 s, extending at 72 DEG C for 15 s, and amplifying by 40 loops; sixth, calculating: using mRNA expression of GAPDH gene as an internal reference for a sample, and calculating expression level of relative mRNA of a target gene in in various samples through a relative quantitation method (2- CT). Sequences of a primer include: GAPDH: F: 5' TCCCTCAAGATTGTCAGCAA3'; R: 5' AGATCCACAACGGATACATT3'; GDNF: F: 5' GACTTGGGTTTGGGCTACGA3'; R: 5' TGGTAAACCAGGCTGTCGTC3'. Through a treatment process of the invention, the expression level of the detected glial cell 2^- CT is higher; meanwhile, through variance comparison, the method of the invention enables more stable expression level of 2^- CT.
Description
Technical field
The present invention relates to medical detecting method, gdnf gene promoter in a kind of glioma cell
Detection method.
Background technology
Glial cellline-derived neurotrophic factor (GDNF) be the glioma property sent out glioma cell important growth promotion because of
Son, in the abnormal rising of constitutional samples of human glioma and multiple glioma cell line transcription.At present, gene height is transcribed glioma
The research of undesired cell proliferation and migration mechanism a lot, but the rarely seen report that its height is transcribed mechanism.This problem
The research of group early stage finds, the height of gdnf gene is transcribed unrelated with gene mutation, thus it is speculated that based on the change of non-DNA sequence apparent
Genetic modification may participate in its high transcriptional control process.Recent studies have shown that, after translation, the acetylation modification of histone is being adjusted
Joint gene transcription process has played important function.
By the development of prior art, GDNF gene mRNA expression and the acetyl of promoter I district histone H 3 K9 thereof
Changing decorating state, on GDNF gene, mRNA and gene canceration have important relationship, detection GDNF base the most on the books in prior art
Because of the method for upper mRNA, but method of the prior art is due to excessive by ectocine, and the prepattern detected is not
High.
Summary of the invention
The deficiency existed for prior art, it is an object of the invention to provide in a kind of high stability glioma cell
Gdnf gene promoter mRNA detection method.
For achieving the above object, the technical scheme is that
Gdnf gene promoter mRNA detection method in a kind of glioma cell, step one: extract glioma cell: take in 48h
Glioma sample, first shred and with clean, add 0.25 % trypsin solution under the conditions of 37 DEG C, digest 5min；Collect cell
It is incubated at the DMEM/F12 culture fluid containing 10% hyclone, changes weekly liquid twice；After original cuiture 7-9 days, by culture bottle
Being placed in constant-temperature table 37 DEG C, 200rpm, 20h shake purification, to remove microglia and oligodendrocyte；
Be considered as the cell of maturation through the cell that GFAP identified by immunofluorescence is positive, the exponential phase that is in taking for the 4th generation is colloid
Tumor cell strain；
Step 2: cell is cultivated: glioma cell line is with containing 10% hyclone, 100U/ml penicillin, 100U/ml streptomycin
Culture medium, be placed in 37 DEG C, in 5% CO2 incubator cultivate；
Step 3: drug treating: trophophase cell of taking the logarithm carries out drug treating after cultivating 24 h synchronizations, adds final concentration of
The curcumin of 25 ~ 100 μm ol/L continues to cultivate 24h；
Step 4: mRNA extracts, and uses TRIzol one-step method to extract total serum IgE from cell, takes RNA template 2 μ g Prime
Script II Reverse Transcriptase kit row reverse transcription reaction synthesis cD-NA the first chain, then using reverse transcription reaction liquid 1 μ l as template,
Adding corresponding primer and carry out PCR amplification, the sequence of described primer is:
GAPDH:F:5 ' TCCCTCAAGATTGTCAGCAA3 '
R:5’ AGATCCACAACGGATACATT3’
GDNF: F:5’ GACTTGGGTTTGGGCTACGA3’
R:5’ TGGTAAACCAGGCTGTCGTC3’；
Step 5: reaction: 95 DEG C of denaturations 30s；95 DEG C of degeneration 20S, 60 DEG C of annealing 15s;72 DEG C extend 15s, expand 40
Circulation；
Step 6: calculate: sample is using the mrna expression of GAPDH gene as internal reference, by relative quantification (2^-△ △ CT)
Method calculates the genes of interest expression relative to mRNA in each sample.
As a further improvement on the present invention: in described step one, after being shredded by sample, the ethanol by 75% is carried out
Once clean, after passing through afterwards cleanout fluid soaks 15min, rinsing at least three times, under described cleanout fluid includes with cleanout fluid
Row weight portion forms:
Deionized water 800 ~ 1000 parts
5 ~ 10 parts of sodium chloride
0.1 ~ 1 part of potassium chloride
Potassium dihydrogen phosphate 0.1 ~ 1 part
Disodium hydrogen phosphate 1 ~ 2 part
Phosphoglycerol 1 ~ 2 part
Trehalose 0.1 ~ 1 part；
Adding 0.25 % trypsin solution and digest 5min under the conditions of 37 DEG C, described trypsin solution includes: the pancreatin of 0.25%,
The EDTA of 0.02%, the trehalose of 0.02%, the glycerol of 5%, the phosphoglycerol of 0.5%, surplus is PBS.
As a further improvement on the present invention: in described step 2, culture medium is with DMEM/F12 culture fluid as matrix, then
Adding trehalose, chitosan, mercaptoethanol, sodium selenite, described trehalose addition is DMEM/F12 culture fluid quality
0.5%, chitosan is 1 ~ 5 % of DMEM/F12 culture fluid quality, and described sodium selenite ultimate density is 5 ~ 7ng/L.
As a further improvement on the present invention: in described step 3, add curcumin carry out acetylizad during, with
Time add demethoxycurcumin, described demethoxycurcumin consumption is the 1 ~ 5% of curcumin consumption.
As a further improvement on the present invention: in described step one, after trypsin solution completes digestion, add pancreatin inhibitor
Release the Digestion of trypsin solution, add PBS afterwards, glyceryl alcohol is diluted, by high speed centrifuge by whole
Mixed liquor is centrifuged, and after being discarded by supernatant, collects cell and is incubated at the DMEM/F12 culture fluid containing 10% hyclone.
As a further improvement on the present invention: described step is a kind of, after isolated removes the cell of pancreatin, then by cleaning
Immersion bubble 5min, is using abluent to clean at least three times after immersion, is collecting cell and be incubated at containing 10% hyclone
DMEM/F12 culture fluid.
As a further improvement on the present invention: in the culture medium in described step 2, be also added with carrier, described carrier is
The micropore material that polylactic acid, starch, polystyrene are generated by polyreaction with D/W for medium at 60 ~ 80 DEG C
Material.
As a further improvement on the present invention: in described carrier in parts by weight: polystyrene is 30 ~ 50 parts, polylactic acid
Being 5 ~ 15 parts, starch is 5 ~ 15 parts, and D/W concentration is 5 ~ 10%.
As a further improvement on the present invention: in described step 2, in incubation, be kept stirring for, described stirring speed
Degree is 30 ~ 50r/min.
As a further improvement on the present invention: in described step 3, when extracting cell, first add in step 2 culture medium
Enter 0.25% pancreatin, the EDTA of 0.02%, the trehalose of 0.02%, the glycerol of 5%, the phosphoglycerol of 0.5%, surplus be PBS delay
Rush liquid, after digestion 5min so that cell comes off from carrier, take out carrier, rinsed at least three times by PBS, sweep away
The liquid come refunds former culture medium, adds pancreatin inhibitor and releases the Digestion of trypsin solution, add afterwards PBS,
Glyceryl alcohol is diluted, and the cell arrived after telling and being centrifuged, trophophase cell of taking the logarithm is carried out after cultivating 24 h synchronizations
Drug treating, the curcumin adding final concentration of 25 ~ 100 μm ol/L continues to cultivate 24h.
Beneficial effects of the present invention, carries out the table of the glioma cell gdnf gene mRNA detected by the method for the present invention
Reach more stable.
First, the glioma cell processed through step one, it is possible to after having been processed, is maintained to preferably
Activity, adds pancreatin, will separate, in order to the cell that subsequent treatment can be can be deposited with individual cells between cell with cell
?.The process time of pancreatin is unsuitable long, and long meeting causes cell to be decomposed by pancreatin, thus destroyed.Thin by separate afterwards
Born of the same parents put in culture medium and cultivate.This makes it possible to turn out the preferable cell of integrity.Finally prepare cell strain.
Being cultivated further by cell strain afterwards, hyclone is mainly to cell growth offer nutrition, and penicillin and chain
Mycin mainly ensures that cell will not be infected, it is ensured that while the survival rate of cell, also ensure to import other DNA or
RNA。
And in step 3, select curcumin as acetylizad reagent, it is possible to preferably by histone acetylation.Acetyl
Change degree is higher.During making to enter the extraction of step 4 mRNA afterwards, the expression of reverse transcription is more accurate.
In step 5, by the parameter set, it is possible to obtain verse more accurately.Finally by contrast, obtain
The expression of mRNA.
And in step one, first by sample fragment by alcohol washes, first tentatively wash and be attached on sample cell surface
Impurity, soaked by abluent afterwards, the deionized water in abluent, sodium chloride, potassium chloride, potassium dihydrogen phosphate, phosphoric acid hydrogen
Disodium can form the system adapting to cells survival, and particularly glioma cell, its cytoactive can obtain greatly
Ensure, simultaneously by phosphoglycerol and the addition of trehalose, it is possible to be further ensured that the work of the activity of cell, particularly protein
Property, the expression of the later stage mRNA being is more accurate.Meanwhile, in trypsin solution, EDTA can improve point cellifugal effect of pancreatin
Really, the addition of trehalose, glycerol, phosphoglycerol simultaneously, on the one hand ensure that the activity of trypsin solution, the cell of liquid protection simultaneously
Tissue will not be caused cell inactivation by pancreatin excessive decomposition.
Culture medium in step 2 is additionally added trehalose, chitosan, mercaptoethanol, sodium selenite, trehalose energy
Enough playing a protective role tumor cell so that cytoactive is higher, sodium selenite can provide cell growth required simultaneously
Trace element, and chitosan not only can play protection cell, improves activity, additionally it is possible to adjusts the thickness of unitary fluid
Degree, is so that the environment of cells survival is more stable.
The long middle addition demethoxycurcumin of curcumin acetylation in step 3, it is possible to increase stablizing of curcumin
Property, improve its acetylizad expression.
In step one, after completing trypsinization, can thoroughly be suppressed the decomposition of pancreatin by the addition of pancreatin inhibitor
Reaction so that pancreatin inactivates, without causing the inactivation of tumor cell, the most again in cleaning process, the glyceryl alcohol of addition is also same
Sample can form protection to tumor cell in order to prevent pancreatin inhibitor from tumor cell is produced damage.
After separating pancreatin, soaking and washing liquid is also for removing beyond the impurity of tumor cell surface, additionally it is possible to
Tumor cell is played a protective effect.The later stage is made before cultivating, to ensure that the activity of tumor cell.
It addition, in incubation, add carrier, the carrier prepared by polylactic acid, starch, polystyrene, is one
Planting environment-friendly type carrier, provide the environment of a high-quality to cell growth, carrier is the cell growth energy that a porous material is
Enough there is more adherent area, preferably simulate the environment in organism, it is ensured that the survival rate of its cell cultivation and work
Property.
And after using carrier, so that cell comes off from carrier and is accomplished by soaking with trypsin solution, afterwards
Rinsing, the flushing liquor rinsed in order to make full use of, be backed in culture medium, be carried out the extraction of tumor cell.
Detailed description of the invention
Embodiment:
Step one: extract glioma cell: take the glioma sample in 48h, first shreds and with cleaning, adds 0.25 % pancreatin
Solution digests 5min under the conditions of 37 DEG C；Collect cell and be incubated at the DMEM/F12 culture fluid containing 10% hyclone, change weekly
Liquid twice；After original cuiture 7-9 days, culture bottle being placed in constant-temperature table 37 DEG C, 200rpm, 20h shake purification, little to remove
Glial cell and oligodendrocyte；
Be considered as the cell of maturation through the cell that GFAP identified by immunofluorescence is positive, the exponential phase that is in taking for the 4th generation is colloid
Tumor cell strain；
In described step one, after sample is shredded, once cleaned by the ethanol of 75%, afterwards by cleanout fluid soaks
After bubble 15min, rinsing at least three times with cleanout fluid, described cleanout fluid includes that following weight portion forms:
Deionized water 800 ~ 1000 parts
5 ~ 10 parts of sodium chloride
0.1 ~ 1 part of potassium chloride
Potassium dihydrogen phosphate 0.1 ~ 1 part
Disodium hydrogen phosphate 1 ~ 2 part
Phosphoglycerol 1 ~ 2 part
Trehalose 0.1 ~ 1 part；
Adding 0.25 % trypsin solution and digest 5min under the conditions of 37 DEG C, described trypsin solution includes: the pancreatin of 0.25%,
The EDTA of 0.02%, the trehalose of 0.02%, the glycerol of 5%, the phosphoglycerol of 0.5%, surplus is PBS.
In described step one, after isolated removes the cell of pancreatin, then soak 5min by cleanout fluid, make after immersion
Clean at least three times with abluent, collect cell and be incubated at the DMEM/F12 culture fluid containing 10% hyclone.
Step 2: cell is cultivated: glioma cell line is with containing 10% hyclone, 100U/ml penicillin, 100U/ml chain
The culture medium of mycin, is placed in 37 DEG C, cultivates in 5% CO2 incubator；In described step 2, culture medium is to cultivate with DMEM/F12
Liquid is matrix, then adds trehalose, chitosan, mercaptoethanol, sodium selenite, and described trehalose addition is that DMEM/F12 cultivates
The 0.5% of liquid quality, chitosan is 1 ~ 5 % of DMEM/F12 culture fluid quality, and described sodium selenite ultimate density is 5 ~ 7ng/L.
Being also added with carrier in culture medium in described step 2, described carrier is that polylactic acid, starch, polystyrene are water-soluble with glucose
Liquid is the poromerics that medium is generated by polyreaction at 60 ~ 80 DEG C.In incubation, it is kept stirring for, described stirring
Speed is 30 ~ 50r/min.
, polylactic acid is 5 ~ 15 parts in described carrier in parts by weight: polystyrene is 30 ~ 50 parts, and starch is 5 ~ 15 parts, Portugal
Grape sugar aqueous solution concentration is 5 ~ 10%.
Step 3: drug treating: trophophase cell of taking the logarithm carries out drug treating after cultivating 24 h synchronizations, adds the denseest
Degree is that the curcumin of 25 ~ 100 μm ol/L continues to cultivate 24h；
In described step 3, add curcumin carry out acetylizad during, be simultaneously introduced demethoxycurcumin, described in go
Methoxyl group curcumin consumption is the 1 ~ 5% of curcumin consumption.
As a further improvement on the present invention: in described step one, after trypsin solution completes digestion, add pancreatin inhibitor
Release the Digestion of trypsin solution, add PBS afterwards, glyceryl alcohol is diluted, by high speed centrifuge by whole
Mixed liquor is centrifuged, and after being discarded by supernatant, collects cell and is incubated at the DMEM/F12 culture fluid containing 10% hyclone.
In described step 3, when extracting cell, first add in step 2 culture medium 0.25% pancreatin, 0.02%
EDTA, the trehalose of 0.02%, the glycerol of 5%, the phosphoglycerol of 0.5%, surplus is PBS, after digestion 5min so that
Cell comes off from carrier, takes out carrier, is rinsed at least three times by PBS, and the liquid swept away refunds former culture medium,
Add pancreatin inhibitor and release the Digestion of trypsin solution, add PBS afterwards, glyceryl alcohol is diluted, Jing Guogao
Telling the cell arrived after being centrifuged, trophophase cell of taking the logarithm carries out drug treating after cultivating 24 h synchronizations, adds final concentration of
The curcumin of 25 ~ 100 μm ol/L continues to cultivate 24h.
Step 4: mRNA extracts, and uses TRIzol one-step method to extract total serum IgE from cell, takes RNA template 2 μ g and uses
Prime Script II Reverse Transcriptase kit row reverse transcription reaction synthesis cD-NA the first chain, then make with reverse transcription reaction liquid 1 μ l
For template, adding corresponding primer and carry out PCR amplification, the sequence of described primer is:
GAPDH:F:5 ' TCCCTCAAGATTGTCAGCAA3 '
R:5’ AGATCCACAACGGATACATT3’
GDNF: F:5’ GACTTGGGTTTGGGCTACGA3’
R:5’ TGGTAAACCAGGCTGTCGTC3’；
Step 5: reaction: 95 DEG C of denaturations 30s；95 DEG C of degeneration 20S, 60 DEG C of annealing 15s;72 DEG C extend 15s, expand 40
Circulation；
Step 6: calculate: sample is using the mrna expression of GAPDH gene as internal reference, by relative quantification (2^-△ △ CT)
Method calculates the genes of interest expression relative to mRNA in each sample.
Beneficial effects of the present invention, carries out the table of the glioma cell gdnf gene mRNA detected by the method for the present invention
Reach more stable.
First, the glioma cell processed through step one, it is possible to after having been processed, is maintained to preferably
Activity, adds pancreatin, will separate, in order to the cell that subsequent treatment can be can be deposited with individual cells between cell with cell
?.The process time of pancreatin is unsuitable long, and long meeting causes cell to be decomposed by pancreatin, thus destroyed.Thin by separate afterwards
Born of the same parents put in culture medium and cultivate.This makes it possible to turn out the preferable cell of integrity.Finally prepare cell strain.
Being cultivated further by cell strain afterwards, hyclone is mainly to cell growth offer nutrition, and penicillin and chain
Mycin mainly ensures that cell will not be infected, it is ensured that while the survival rate of cell, also ensure to import other DNA or
RNA。
And in step 3, select curcumin as acetylizad reagent, it is possible to preferably by histone acetylation.Acetyl
Change degree is higher.During making to enter the extraction of step 4 mRNA afterwards, the expression of reverse transcription is more accurate.
In step 5, by the parameter set, it is possible to obtain verse more accurately.Finally by contrast, obtain
The expression of mRNA.
And in step one, first by sample fragment by alcohol washes, first tentatively wash and be attached on sample cell surface
Impurity, soaked by abluent afterwards, the deionized water in abluent, sodium chloride, potassium chloride, potassium dihydrogen phosphate, phosphoric acid hydrogen
Disodium can form the system adapting to cells survival, and particularly glioma cell, its cytoactive can obtain greatly
Ensure, simultaneously by phosphoglycerol and the addition of trehalose, it is possible to be further ensured that the work of the activity of cell, particularly protein
Property, the expression of the later stage mRNA being is more accurate.Meanwhile, in trypsin solution, EDTA can improve point cellifugal effect of pancreatin
Really, the addition of trehalose, glycerol, phosphoglycerol simultaneously, on the one hand ensure that the activity of trypsin solution, the cell of liquid protection simultaneously
Tissue will not be caused cell inactivation by pancreatin excessive decomposition.
Culture medium in step 2 is additionally added trehalose, chitosan, mercaptoethanol, sodium selenite, trehalose energy
Enough playing a protective role tumor cell so that cytoactive is higher, sodium selenite can provide cell growth required simultaneously
Trace element, and chitosan not only can play protection cell, improves activity, additionally it is possible to adjusts the thickness of unitary fluid
Degree, is so that the environment of cells survival is more stable.
The long middle addition demethoxycurcumin of curcumin acetylation in step 3, it is possible to increase stablizing of curcumin
Property, improve its acetylizad expression.
In step one, after completing trypsinization, can thoroughly be suppressed the decomposition of pancreatin by the addition of pancreatin inhibitor
Reaction so that pancreatin inactivates, without causing the inactivation of tumor cell, the most again in cleaning process, the glyceryl alcohol of addition is also same
Sample can form protection to tumor cell in order to prevent pancreatin inhibitor from tumor cell is produced damage.
After separating pancreatin, soaking and washing liquid is also for removing beyond the impurity of tumor cell surface, additionally it is possible to
Tumor cell is played a protective effect.The later stage is made before cultivating, to ensure that the activity of tumor cell.
It addition, in incubation, add carrier, the carrier prepared by polylactic acid, starch, polystyrene, is one
Planting environment-friendly type carrier, provide the environment of a high-quality to cell growth, carrier is the cell growth energy that a porous material is
Enough there is more adherent area, preferably simulate the environment in organism, it is ensured that the survival rate of its cell cultivation and work
Property.
And after using carrier, so that cell comes off from carrier and is accomplished by soaking with trypsin solution, afterwards
Rinsing, the flushing liquor rinsed in order to make full use of, be backed in culture medium, be carried out the extraction of tumor cell.
Comparative example 1:
Selecting the rat C6 glioma cell line of Chinese Academy of Sciences's cell bank, rat C6 glioma cell line is with containing 10% tire
Ox blood serum, 100U/ml penicillin, the DMEM/F12 culture medium of 100U/ml streptomycin, it is placed in 37 DEG C, 5% CO2 incubator is trained
Support.Trophophase cell of taking the logarithm carries out drug treating after cultivating 24 h synchronizations, is separately added into Curcumin and continues to cultivate
24h。
Use TRIzol one-step method to extract total serum IgE from cell, take RNA template 2 μ g Prime ScriptTM II inverse
Transcript reagent box row reverse transcription reaction synthesis cD-NA the first chain, then using reverse transcription reaction liquid 1 μ l as template, add and draw accordingly
Thing carries out PCR amplification.Primer sequence is shown in Table 1.Reaction condition is provided that 95 DEG C of denaturations 30s；95 DEG C of degeneration 20S, 60 DEG C
Annealing 15s;72 DEG C extend 15s, expand 40 circulations.PCR product specificities is analyzed by solubility curve.Each sample with
The mrna expression of GAPDH gene, as internal reference, calculates genes of interest in each sample by relative quantification (2-△ △ CT) method
In expression relative to mRNA.
Comparative example two:
The bilateral cerebral cortex of the SD rat in raw 48 h of taking-up, shreds and rinses for several times with PBS, add 0.25 % pancreatin 37
DEG C digestion 5min.Collect cell and be incubated at the DMEM/F12 culture fluid containing 10% hyclone, change weekly liquid twice.Primary
After cultivating 7-9 days, culture bottle being placed in constant-temperature table 37 DEG C, 200rpm, 20h shake purification, to remove microglia and to lack
Prominent glial cell.The astrocyte of maturation it is considered as through the cell that GFAP identified by immunofluorescence is positive.Take being in of the 4th generation
The cell of exponential phase is used for experimentation.
Use TRIzol one-step method to extract total serum IgE from cell, take RNA template 2 μ g Prime ScriptTM II inverse
Transcript reagent box row reverse transcription reaction synthesis cD-NA the first chain, then using reverse transcription reaction liquid 1 μ l as template, add and draw accordingly
Thing carries out PCR amplification.Primer sequence is shown in Table 1.Reaction condition is provided that 95 DEG C of denaturations 30s；95 DEG C of degeneration 20S, 60 DEG C
Annealing 15s;72 DEG C extend 15s, expand 40 circulations.PCR product specificities is analyzed by solubility curve.Each sample with
The mrna expression of GAPDH gene, as internal reference, calculates genes of interest in various kinds by relative quantification (2^-△ △ CT) method
Expression relative to mRNA in product.
Above-described embodiment and comparative example one all do 10 detections, and comparative example two is blank assay matched group, and remember
Record its 2^-△ △ CT, contrast, record its standard deviation simultaneously.
Table 1
By above-mentioned data, it can be deduced that, in cancerous tumor cell, the expression of 2-△ △ CT is significantly improved.Pass through simultaneously
Embodiment and the contrast of comparative example one, it is possible to, after processing procedure of the present invention, through the glioma cell 2^-△ of detection
△ CT expression is higher, is contrasted by both variances simultaneously, and the detection method of the present invention, the expression of 2^-△ △ CT is more
Add stable.
The above is only the preferred embodiment of the present invention, and protection scope of the present invention is not limited merely to above-mentioned enforcement
Example, all technical schemes belonged under thinking of the present invention belong to protection scope of the present invention.It should be pointed out that, for the art
Those of ordinary skill for, some improvements and modifications without departing from the principles of the present invention, these improvements and modifications are also
Should be regarded as protection scope of the present invention.
Claims (10)
1. gdnf gene promoter detection method in a glioma cell, it is characterised in that:
Step one: extract glioma cell: take the glioma sample in 48h, first shreds and with cleaning, adds 0.25 % pancreatin
Solution digests 5min under the conditions of 37 DEG C；Collect cell and be incubated at the DMEM/F12 culture fluid containing 10% hyclone, change weekly
Liquid twice；After original cuiture 7-9 days, culture bottle being placed in constant-temperature table 37 DEG C, 200rpm, 20h shake purification, little to remove
Glial cell and oligodendrocyte；
Be considered as the cell of maturation through the cell that GFAP identified by immunofluorescence is positive, the exponential phase that is in taking for the 4th generation is colloid
Tumor cell strain；
Step 2: cell is cultivated: glioma cell line is with containing 10% hyclone, 100U/ml penicillin, 100U/ml streptomycin
Culture medium, be placed in 37 DEG C, in 5% CO2 incubator cultivate；
Step 3: drug treating: trophophase cell of taking the logarithm carries out drug treating after cultivating 24 h synchronizations, adds final concentration of
The curcumin of 25 ~ 100 μm ol/L continues to cultivate 24h；
Step 4: mRNA extracts, and uses TRIzol one-step method to extract total serum IgE from cell, takes RNA template 2 μ g Prime
Script II Reverse Transcriptase kit row reverse transcription reaction synthesis cD-NA the first chain, then using reverse transcription reaction liquid 1 μ l as template,
Adding corresponding primer and carry out PCR amplification, the sequence of described primer is:
GAPDH:F:5 ' TCCCTCAAGATTGTCAGCAA3 '
R:5’ AGATCCACAACGGATACATT3’
GDNF: F:5’ GACTTGGGTTTGGGCTACGA3’
R:5’ TGGTAAACCAGGCTGTCGTC3’；
Step 5: reaction: 95 DEG C of denaturations 30s；95 DEG C of degeneration 20S, 60 DEG C of annealing 15s;72 DEG C extend 15s, expand 40
Circulation；
Step 6: calculate: sample is using the mrna expression of GAPDH gene as internal reference, by relative quantification (2^-△ △ CT)
Method calculates the genes of interest expression relative to mRNA in each sample.
Gdnf gene promoter detection method in rat C6 glioma cell the most according to claim 1, its feature exists
In: in described step one, after sample is shredded, once cleaned by the ethanol of 75%, afterwards by cleanout fluid soaks
After 15min, rinsing at least three times with cleanout fluid, described cleanout fluid includes that following weight portion forms:
Deionized water 800 ~ 1000 parts
5 ~ 10 parts of sodium chloride
0.1 ~ 1 part of potassium chloride
Potassium dihydrogen phosphate 0.1 ~ 1 part
Disodium hydrogen phosphate 1 ~ 2 part
Phosphoglycerol 1 ~ 2 part
Trehalose 0.1 ~ 1 part；
Adding 0.25 % trypsin solution and digest 5min under the conditions of 37 DEG C, described trypsin solution includes: the pancreatin of 0.25%,
The EDTA of 0.02%, the trehalose of 0.02%, the glycerol of 5%, the phosphoglycerol of 0.5%, surplus is PBS.
Gdnf gene promoter detection method in glioma cell the most according to claim 1, it is characterised in that: described step
In rapid two, culture medium is with DMEM/F12 culture fluid as matrix, then adds trehalose, chitosan, mercaptoethanol, sodium selenite,
Described trehalose addition is the 0.5% of DMEM/F12 culture fluid quality, and chitosan is 1 ~ 5 % of DMEM/F12 culture fluid quality,
Described sodium selenite ultimate density is 5 ~ 7ng/L.
Gdnf gene promoter detection method in glioma cell the most according to claim 1, it is characterised in that: described step
In rapid three, add curcumin carry out acetylizad during, be simultaneously introduced demethoxycurcumin, described de-methoxy Rhizoma Curcumae Longae
Element consumption is the 1 ~ 5% of curcumin consumption.
Gdnf gene promoter mRNA detection method in glioma cell the most according to claim 1, it is characterised in that: institute
State in step one, after trypsin solution completes digestion, add pancreatin inhibitor and release the Digestion of trypsin solution, add afterwards
PBS, glyceryl alcohol are diluted, and are centrifuged by whole mixed liquor by high speed centrifuge, after being discarded by supernatant, receive
Collection cell is incubated at the DMEM/F12 culture fluid containing 10% hyclone.
Gdnf gene promoter detection method in glioma cell the most according to claim 5, it is characterised in that: described step
Rapid a kind of, after isolated removes the cell of pancreatin, then soak 5min by cleanout fluid, after immersion, use abluent to clean extremely
Few three times, collect cell and be incubated at the DMEM/F12 culture fluid containing 10% hyclone.
Gdnf gene promoter detection method in glioma cell the most according to claim 1, it is characterised in that: described step
Being also added with carrier in culture medium in rapid two, described carrier is that polylactic acid, starch, polystyrene are with D/W for being situated between
The poromerics that matter is generated by polyreaction at 60 ~ 80 DEG C.
Gdnf gene promoter mRNA detection method in glioma cell the most according to claim 7, it is characterised in that: institute
State in carrier in parts by weight: polystyrene is 30 ~ 50 parts, and polylactic acid is 5 ~ 15 parts, and starch is 5 ~ 15 parts, D/W
Concentration is 5 ~ 10%.
Gdnf gene promoter detection method in glioma cell the most according to claim 8, it is characterised in that: described step
In rapid two, in incubation, being kept stirring for, described mixing speed is 30 ~ 50r/min.
Gdnf gene promoter detection method in glioma cell the most according to claim 9, it is characterised in that: described
In step 3, when extracting cell, the first pancreatin of addition 0.25%, the EDTA of 0.02%, the sea of 0.02% in step 2 culture medium
Algae sugar, the glycerol of 5%, the phosphoglycerol of 0.5%, surplus is PBS, after digestion 5min so that cell is de-from carrier
Falling, take out carrier, rinsed at least three times by PBS, the liquid swept away refunds former culture medium, adds pancreatin inhibitor
Release the Digestion of trypsin solution, add PBS afterwards, glyceryl alcohol is diluted, arriving after high speed centrifugation
Cell, trophophase cell of taking the logarithm carries out drug treating after cultivating 24 h synchronizations, adds final concentration of 25 ~ 100 μm ol/L
Curcumin continues to cultivate 24h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610372267.2A CN106048002A (en) | 2016-05-31 | 2016-05-31 | Method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610372267.2A CN106048002A (en) | 2016-05-31 | 2016-05-31 | Method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106048002A true CN106048002A (en) | 2016-10-26 |
Family
ID=57173108
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610372267.2A Pending CN106048002A (en) | 2016-05-31 | 2016-05-31 | Method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106048002A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676000A (en) * | 2016-12-30 | 2017-05-17 | 上海星耀医学科技发展有限公司 | Multi-cavity gene analysis reaction device |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1425075A (en) * | 2000-02-22 | 2003-06-18 | 牛津生物医学（英国）有限公司 | Differential expression screening method |
| CN103215225A (en) * | 2012-01-18 | 2013-07-24 | 孙勇 | Construction method of glial cell line-derived neurotrophic factor gene-modified embryo neural stem cell |
-
2016
- 2016-05-31 CN CN201610372267.2A patent/CN106048002A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1425075A (en) * | 2000-02-22 | 2003-06-18 | 牛津生物医学（英国）有限公司 | Differential expression screening method |
| CN103215225A (en) * | 2012-01-18 | 2013-07-24 | 孙勇 | Construction method of glial cell line-derived neurotrophic factor gene-modified embryo neural stem cell |
Non-Patent Citations (2)
| Title |
|---|
| 倪海波等: "大鼠C6胶质瘤细胞中gdnf基因启动子Ⅰ区组蛋白高乙酰化可能参与了其高转录调控过程", 《现代生物医学进展》 * |
| 戴燕燕等: "人脑胶质瘤GDNF基因启动子Ⅰ区H3组蛋白乙酰化修饰情况研究", 《中国现代医生》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676000A (en) * | 2016-12-30 | 2017-05-17 | 上海星耀医学科技发展有限公司 | Multi-cavity gene analysis reaction device |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105647969B (en) | Method for breeding zebra fish with stat1a gene deletion by gene knockout | |
| CN107385059B (en) | Molecular marker related to growth traits of broiler chickens and application thereof | |
| CN106244557A (en) | Rite-directed mutagenesis ApoE gene and the method for LDLR gene | |
| CN110791501B (en) | Long-chain non-coding RNA and application of interference RNA thereof in treatment of atherosclerosis | |
| CN108642054A (en) | Reduce immunogenicity sgRNA, low immunogenicity dressing and preparation method thereof | |
| CN110331228B (en) | Internal reference gene of glehnia littoralis and screening method and application thereof | |
| Li et al. | An ordered EST catalogue and gene expression profiles of cassava (Manihot esculenta) at key growth stages | |
| CN105177132A (en) | RT-PCR method for quantitatively detecting miRNA | |
| CN110403954A (en) | Application of the inhibitor of LncRNA XLOC_110286 in the drug that preparation promotes angiogenesis | |
| CN113308553B (en) | circRNA related to development of sheep skeletal muscle and application thereof | |
| CN106282230A (en) | The method of rite-directed mutagenesis LDLR gene | |
| CN106048002A (en) | Method for detecting GDNF (glial cell line-derived neurotrophic factor) gene promoter in glial cells | |
| CN106190959A (en) | A kind of CBH culture medium inducing chicken PECTORAL LIMB SKELETON to break up and differentiation method thereof | |
| CN109897825A (en) | It is a kind of to be simple and efficient the cell system for generating hepatitis type B virus recombination cccDNA | |
| CN110144406A (en) | A kind of method and its application of screening section treasured broiler chicken DNA bar code | |
| CN110527684A (en) | Application of the nanosizing RNAi preparation in PVY prevention and treatment | |
| CN104862316A (en) | MiRNA-2400 with biological function of significantly promoting bovine preadipocyte proliferation | |
| CN104087682B (en) | The method utilizing genechip detection astragaloside induction RMMVECs gene expression profile | |
| CN114854882A (en) | Sheep hair follicle development marker miR-23b and application thereof | |
| CN108383899B (en) | WRKY transcription factor for regulating and controlling fruit top hardening of golden pear | |
| CN106755474A (en) | The detection method of one herd boar KDM5B gene insertion/deletions and its application | |
| CN113151158A (en) | Tissue stem cell separation and function evaluation system | |
| CN110699315A (en) | Method for extracting fixed tissue protoplast nucleic acid | |
| CN113801948B (en) | SNP locus for genetically improving chicken growth traits and application thereof | |
| CN110042164A (en) | Lung cancer diagnosis and treatment lncRNA marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161026 |