CN106011171B - A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA - Google Patents
A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA Download PDFInfo
- Publication number
- CN106011171B CN106011171B CN201610333062.3A CN201610333062A CN106011171B CN 106011171 B CN106011171 B CN 106011171B CN 201610333062 A CN201610333062 A CN 201610333062A CN 106011171 B CN106011171 B CN 106011171B
- Authority
- CN
- China
- Prior art keywords
- arm
- egfp
- ccr5
- cag
- crispr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Abstract
The present invention principally falls into gene editing technical field, and in particular to a kind of gene seamless edit method.CRISPR/Cas9 the expression vector CCR5.CRISPR/Cas9 and eGFP.CRISPR/Cas9 of this method building targeting CCR5 and eGFP, and construct donor CCR5-Donor carrier；Then by transfecting twice, using CRISPR-Cas9 system and intracellular HR and SSA repair mechanism, is screened by the positive negative sense of the puromycin and Ganciclovir of cell, complete seamless edit.
Description
Technical field
The present invention principally falls into gene editing technical field, and in particular to a kind of to be based on SSA using CRISPR/Cas9 technology
The gene seamless edit method of reparation.
Background technique
Gene editing technology is the key that people open understanding gene function, and early stage research gene function mainly passes through same
Source recombination form carries out gene editing, and this mode depends on nature recombination unduly, and for mammal, efficiency is extremely low, only
Thousand a ten thousandths, it is impossible to meet the increasingly developed scientific research demands of the mankind.Subsequent people have found under study for action, if in genome
Double-strand break (Double Strand Breaks, DSBs) is introduced on DNA target site, it is corresponding homologous heavy in mammalian cell
Group efficiency is greatly improved than spontaneous homologous recombination, can reach 3~5 × 10-2.Three kinds of artificial nucleases of rising in recent years: zinc finger
Nuclease (Zinc finger nuclease s, ZFNs), TALE nuclease (Transcription activator-like
Effector nuclease, TALENs) and CRISPR/Cas9 nucleic acid zymotechnic can DNA target site generate DNA double
Chain fracture, so as to greatly improve the efficiency of genome editor.Because CRISPR/Cas9 is a kind of nuclease of RNA guiding
Technology is even more to have obtained more widely as long as changing intermediate 20bp completes the cutting to different target sites now
Using.
In addition to this, it if being inserted into selection markers component among homology arm, can also be greatly improved by drug screening
The efficiency of homologous recombination.However, selection markers component can be retained in genome.Selection markers component is present in genome may
The transcription of meeting suppressor or unwanted gene-splicing.Selection markers component can be deleted using Cre/loxP system, but
It is the loxp sequence for but leaving a 34bp.This short sequence is likely to affect the expression that mammal closes on gene.
PiggyBac Transposon System traceless in the least can delete selection markers component.But PiggyBac transposons be easy to it is whole
Close other sites of genome.
It is a kind of approach repaired after DNA damage that (SSA) is repaired in single-stranded annealing, which is at DNA double chain fracture location
The special homologous recombination repair of the one kind occurred between the identical homologous sequence in two sections of directions.Damage location and analogous parts area
Domain meeting unwinding is combined at single-stranded and mutual complementary pairing, this annealed combination can be further processed rapidly, i.e. excision is single
Chain tail simultaneously fills up breach, to delete the segment and a homologous sequence among homologous sequence.For a long time, people think
Non-homologous end joining (NHEJ) is most important repair mode after mammalian DNA fracture, but if at the both ends of fracture
There are repetitive sequences, and repetitive sequence is adjacent relatively close, and SSA can become most important repair mode.
Summary of the invention
In view of the above-mentioned problems, the invention discloses a kind of gene repaired using CRISPR/Cas9 technology based on SSA is seamless
Edit methods, the gene seamless edit method utilize CRISPR/Cas9 system and intracellular HR and SSA repair machine twice
System is screened by the positive negative sense of cell, to achieve the purpose that gene seamless edit.
The present invention is achieved by the following technical solutions:
A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA, the gene seamless edit
The eGFP.CRISPR/Cas9 expression that method constructs the CCR5.CRISPR/Cas9 and targeting eGFP of targeting CCR5 gene first carries
Body, and donor CCR5-Donor carrier is constructed, the donor CCR5-Donor carrier has pXL-BACII-L-arm-CAG-TK-
PGK-PuroR- T2A-eGFP-bGH pA-R-arm structure, wherein L-arm and R-arm is left and right homology arm, L-arm and R-
CAG-TK-PGK-Puro among armR- T2A-eGFP-bGH pA is selection markers component；By transfecting twice, utilize
CRISPR/Cas9 technology respectively target practice CCR5 gene and eGFP target site and utilize intracellular HR and SSA repair mechanism, lead to
The positive negative sense screening for crossing cell, completes seamless edit.
Further, construct donor CCR5-Donor carrier specifically includes the following steps:
(1) building of selection markers component: the selection markers modular construction is pBlue-CAG-TK-PGK-PuroR-
T2A-eGFP-bGH pA, both ends have the target site of eGFP；
(2) building of intermediate vector pXL-BACII-R-arm-L-arm: left and right homology arm L-arm and R-arm are inserted into
In pXL-BACII carrier, building obtains carrier pXL-BACII-R-arm-L-arm, wherein left and right homology arm L-arm and R-arm
Between contain NotI and XhoI restriction enzyme site；
(3) building of donor CCR5-Donor carrier: by CAG-TK-PGK-PuroR- T2A-eGFP-bGH pA sequence is inserted
Enter and is supplied between left and right the homology arm L-arm and R-arm of the pXL-BACII-R-arm-L-arm prepared to step (2)
Body CCR5-Donor carrier.
Further, the building of step (1) the selection markers component successively include: carrier Pll3.7-CAG building,
The building of carrier Pll3.7-CAG-TK, carrier PLL3.7-CAG-TK-PGK-PuroRThe building of-T2A-eGFP, carrier pBlue-
CAG-TK-PGK-PuroRThe building of-T2A-eGFP and carrier pBlue-CAG-TK-PGK-PuroR-T2A-eGFP-bGH pA
Building.
Further, the building of step (2) the intermediate vector pXL-BACII-R-arm-L-arm successively includes: centre
The building of carrier pXL-BACII-L-arm and the building of pXL-BACII-R-arm-L-arm.
Further, the building of step (3) the donor CCR5-Donor carrier specifically: distinguish enzyme with NotI and XhoI
Cut intermediate vector pXL-BACII-R-arm-L-arm and selection markers assembly carrier pBlue-CAG-TK-PGK-PuroR-
T2A-eGFP-bGH pA, obtains skeleton and Insert Fragment, and connection building obtains support C CR5-Donor.
Further, transfection is beaten using CCR5.CRISPR/Cas9 expression vector and donor CCR5.Donor carrier for the first time
Target CCR5 gene carries out homologous recombination simultaneously, second of intermediate screening mark of being practiced shooting using eGFP.CRISPR/Cas9 expression vector
Remember component.
Further, the CCR5 target site segment are as follows: CATACAGTCAGTATCAATTCTGG；The GFP target site
Are as follows: CGCGCCGAGGTGAAGTTCGAGGG.
Further, it is described twice transfection in, for the first time transfection be added CCR5.CRISPR/Cas9 expression vector and
The molecule mole ratio of donor CCR5.Donor carrier is 1:1.
Advantageous effects of the invention:
A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA provided by the invention, can be with
The screening of positive cell clone is carried out, seamless deletion selection markers component reaches the seamless edit of gene.
Detailed description of the invention
Fig. 1 is CRISPR/Cas9 expression vector plasmid map；
Fig. 2 is the plasmid map of CCR5-Donor；
Fig. 3 is that PCR detects homologous recombination electrophoresis；
Fig. 4 is the PCR product SalI digestion result of anti-GCV clone.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to the accompanying drawings and embodiments, right
The present invention is explained in further detail.It should be appreciated that specific embodiment described herein is used only for explaining the present invention, and
It is not used in the restriction present invention.
On the contrary, the present invention covers any substitution done on the essence and scope of the present invention being defined by the claims, repairs
Change, equivalent method and scheme.Further, in order to make the public have a better understanding the present invention, below to of the invention thin
It is detailed to describe some specific detail sections in section description.Part without these details for a person skilled in the art
The present invention can also be understood completely in description.
Embodiment 1
A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA, the gene seamless edit
The eGFP.CRISPR/Cas9 expression that method constructs the CCR5.CRISPR/Cas9 and targeting eGFP of targeting CCR5 gene first carries
Body, and donor CCR5-Donor carrier is constructed, the donor CCR5-Donor carrier has pXL-BACII-L-arm-CAG-TK-
PGK-PuroR- T2A-eGFP-bGH pA-R-arm structure, wherein L-arm and R-arm is left and right homology arm, L-arm and R-
CAG-TK-PGK-Puro among armR- T2A-eGFP-bGH pA sequence is selection markers modular construction；By transfecting twice,
Utilize CRISPR/Cas9 technology twice target practice CCR5 gene and eGFP target site and intracellular HR and SSA repair machine respectively
System is screened by the positive negative sense of cell, completes seamless edit.
Target the eGFP.CRISPR/Cas9 expression vector of the CCR5.CRISPR/Cas9 and targeting eGFP of CCR5 gene
Building:
It is configured to the prior art with CRISPR/Cas9 expression vector, constructs the CRISPR/Cas9 expression vector knot of acquisition
Structure is as shown in Figure 1.Using pll3.7-gRNA-Cas9 carrier as template, upstream primer is respectively CCR5-F and eGFP-F, and downstream is drawn
Object is all R, respectively the gRNA segment of PCR amplification CCR5 and eGFP gene.PCR amplification the primer is as shown in table 1.PCR is anti-
Answer system as described in Table 2, reaction condition are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 68 DEG C of annealing 30s, 72 DEG C extend
The annealing temperature of 20s, 18 circulations, each circulation drop 1 DEG C；95 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 20s, 25
Circulation；Last 72 DEG C of extensions 10min.
Use BamH I and I double digestion plasmid pll3.7-gRNA-Cas9 of Xho i.e. CRISPR/Cas9 expression vector as skeleton,
The gRNA segment expanded simultaneously with Bsa I and I double digestion of Xho, digestion system are shown in Table 3, table 4.Skeleton and gRNA segment glue are recycled
Afterwards, by the skeleton of digestion recycling and PCR fragment in 16 DEG C of connection 10h, linked system is shown in Table 5 (segment and skeleton in linked system
Mole ratio be 3:1, the quality of the two and be 50-150ng).
Then by connection product transformed competence colibacillus bacterium DH5 α, the plate of LB solid medium with ampicillin is applied
On, after 37 DEG C of bacteriological incubator culture 12h, monoclonal is taken with the sterile lancet choicest of 10 μ L, is seeded in LB containing ampicillin
In fluid nutrient medium, 12h is cultivated in 37 DEG C of shaking tables, 10,000r/min thalline were collected by centrifugation, illustrates according to plasmid extraction kit
Book operating procedure extracts plasmid.Obtain the eGFP.CRISPR/ of the CCR5.CRISPR/Cas9 and targeting eGFP of targeting CCR5 gene
Cas9 expression vector.
1 PCR amplification primer sequence of table
Note: dashed part is the DNA sequence dna complementary with target sequence.
2 PCR amplification system of table
3 pll3.7-gRNA-Cas9 skeleton digestion system of table
The PCR product digestion system of 4 gRNA of table
5 gRNA/Cas9 linked system of table
Construct donor CCR5-Donor carrier specifically includes the following steps:
(1) building of selection markers assembly carrier: the selection markers modular construction is pBlue-CAG-TK-PGK-
PuroR-T2A-eGFP-bGH pA；Specifically includes the following steps:
The building of carrier Pll3.7-CAG: with plasmid CAG pShuttle (Addgene) for template, amplimer ATG-
F and ATG-R, ATG-F are gcggccgc TCGACATTGATTATTGACTAG (NotI), ATG-R gaattc
AAATGATGAGACAGCACAATAACCAG (EcoRI) obtains CAG segment by PCR.PCR reaction system is as shown in table 6, instead
Answer condition are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 68 DEG C of annealing 30s, 72 DEG C of extension 20s, 18 recycle, each circulation
Annealing temperature drop 1 DEG C；95 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 20s, 25 recycle；Last 72 DEG C of extensions
10min。
Table 6:CAG segment PCR system
Use NotI and EcoRI digestion Pll3.7 (Addgene) as skeleton, while with NotI and EcoRI digestion CAG piece
Section, Pll3.7 skeleton digestion system and CAG segment digestion system (being shown in Table 7, table 8), glue recycle target fragment.By skeleton and enzyme
The CAG segment connection cut back to close, linked system are shown in Table 9.Bacillus coli DH 5 alpha competent cell is converted after 16 DEG C are stayed overnight, is applied
LB/Amp plate, picking monoclonal and 37 DEG C of culture 8h in LB/Amp fluid nutrient medium, upgrading grain obtain carrier Pll3.7-
CAG。
Table 7:Pll3.7 skeleton digestion system
Table 8:CAG segment digestion system
Table 9:Pll3.7-CAG linked system
The building of carrier Pll3.7-CAG-TK: with plasmid pRL-TK (Addgene) for template, amplimer TK-F:
GCGggtctc CAATTATGGCCTCGTACCCCG (NheI), TK-R:CTAgctagcggatccaccggtGTTAGCCTCCCC
CATCTCC (BsaI), PCR amplification TK segment.NheI the and EcoRI digestion of TK segment, skeleton Pll3.7-CAG use NheI simultaneously
With EcoRI digestion.Connection, carrier construction PLL3.7-CAG-TK.Wherein, PCR reaction system and response procedures, digestion system, even
Junctor system is all identical as the building process of carrier Pll3.7-CAG, repeats no more.
Carrier PLL3.7-CAG-TK-PGK-PuroRThe building of-T2A-eGFP: with plasmid pCAG-T7-cas9+gRNA-
pgk-PuroR- T2A-eGFP (purchase obtains) is template, amplimer PPTG-F:CTAgctagcCCGGTAGGCGCCAAC
(NheI) PPTG-R:CCGgaattcCTTGTACAGCTCGTCCATGC (EcoRI), PCR amplification obtain PGK-PuroR-T2A-
EGFP segment.PGK-PuroRNheI the and EcoRI digestion of-T2A-eGFP segment, while NheI and EcoRI digestion skeleton
Pll3.7-CAG-TK, carrier construction Pll3.7-CAG-TK-PGK-PuroR-T2A-eGFP.Wherein, PCR reaction system and reaction
Program, digestion system, linked system is all identical as the building process of carrier Pll3.7-CAG, repeats no more.
Carrier pBlue-CAG-TK-PGK-PuroRThe building of-T2A-eGFP: digestion is distinguished with NotI and EcoRI
Pll3.7-CAG-TK-PGK-PuroR- T2A-eGFP and pBlueScript II SK (+) obtain segment and skeleton, connection, structure
Build carrier pBlue-CAG-TK-PGK-PuroR-T2A-eGFP.Wherein, PCR reaction system and response procedures, digestion system, even
Junctor system is all identical as the building process of carrier Pll3.7-CAG, repeats no more.
Carrier pBlue-CAG-TK-PGK-PuroRThe building of-T2A-eGFP-bGH pA: with PX330 (Addgene) for mould
Plate, with bGH pA-F:aat GAATTC CGACTGTGCCTTCTAGTTGC (EcoRI) and bGH pA-R:aatCTCGAG
CCAGCATGCCTGCTATTCTC (XhoI) is primer, amplified fragments bGH pA.With EcoRI and XhoI endonuclease bamhi bGH pA,
EcoRI and XhoI digestion pBlue-CAG-TK-PGK-Puro is used simultaneouslyR- T2A-eGFP obtains skeleton, connection, carrier construction
pBlue-CAG-TK-PGK-PuroR-T2A-eGFP-bGH pA.Wherein, PCR reaction system and response procedures, digestion system, even
Junctor system is all identical as the building process of carrier Pll3.7-CAG, repeats no more.
(2) building of intermediate vector pXL-BACII-R-arm-L-arm: left and right homology arm L-arm and R-arm are inserted into
In pXL-BACII carrier, building obtains carrier pXL-BACII-R-arm-L-arm, wherein left and right homology arm L-arm and R-arm
Between contain NotI and XhoI restriction enzyme site；Specifically includes the following steps:
The building of intermediate vector pXL-BACII-L-arm: using the genome of HEK293T as template, with primer CCR5-L-F:
AatggatccCATGGTGCTATAGAGCACAA and CCR5-L-R:aatGCGGCCGCCCGCGCCGAGGTGAAGTTCGAGGGG
AAAATGAGAGCTGCAGGTG, amplification length are the L-arm segment of 879bp.Digestion pXL-BACII is distinguished with BamHI and NotI
With L-arm segment respectively as skeleton and segment, connection, carrier construction PXL-BACII-L-arm.
The building of pXL-BACII-R-arm-L-arm: using the genome of HEK293T as template, with primer SSA-F:aat
CTCGAGCGCGCCGAGGTGAAGTTCGAGGGTCTTACTGTCCCCTTCTGGG and SSA-R:
GtcgacTGTATGGAAAATGAGAGCTG expands repetitive sequence Repeat.Primer CCR5-R-F:TCATTTTCCATA is used simultaneously
CAgtcgacTTAAAGATAGTCATCTTGGGGCTG and CCR5-R-R:aatAAGCTTCTCAAGAATCAGCAATTCTCTG,
PCR amplification R-arm-P.
Using the Repeat of above-mentioned amplification and R-arm-P as template, R-arm is expanded with primer SSA-F and CCR5-R-R.With
HindIII and XhoI difference digestion pXL-BACII-L-arm and R-arm segment is carried respectively as skeleton and segment, connection building
Body pXL-BACII-R-arm-L-arm.
(3) building of donor CCR5-Donor carrier: by CAG-TK-PGK-PuroR- T2A-eGFP-bGH pA sequence is inserted
Enter and is supplied between left and right the homology arm L-arm and R-arm of the pXL-BACII-R-arm-L-arm prepared to step (2)
Body CCR5-Donor carrier.
The building of the donor CCR5-Donor carrier specifically: distinguish digestion intermediate vector pXL- with NotI and XhoI
BACII-R-arm-L-arm and selection markers assembly carrier pBlue-CAG-TK-PGK-PuroR- T2A-eGFP-bGH pA,
Skeleton and Insert Fragment are obtained, connection building obtains support C CR5-Donor (as shown in Figure 2).
It is illustrated by taking the seamless edit of the CCR5 gene of HEK293T cell as an example below, seamless edit specific steps:
1. transfecting for the first time
HEK 293T cell line is placed in containing DMEM, 10% fetal calf serum, in the culture medium of 100 μ g/mL mycillins, 37
DEG C, 5% CO2 incubator culture.
The transfection of HEK 293T cell line: by taking 24 orifice plates as an example, being inoculated with HEK 293T cell into 24 orifice plates, close to cell
When degree is close to 70%, fresh culture is changed.The culture medium in 24 orifice plates is sucked out, the fresh culture of 37 DEG C of preheatings is added in every hole
Start to transfect after 500 μ L, 2-4 hours.Take two 1.5mL sterilizing EP pipe, about 1.6 μ g of additions (CCR5.sgRNA/Cas9 and
CCR5-Donor molecule mole ratio is the plasmid of 1:1), and Opti-MEM to 30 μ L of total volume is then added；In another EP pipe
2 μ L So-Fast transfection reagents and Opti-MEM is added to 30 μ L.The mixture in two EP pipes is mixed gently, then will contain and turn
The Opti-MEM of transfection reagent is slowly added in the EP pipe containing plasmid, and side edged gently shakes, and mixes well it.Add mixing
Afterwards, mixture is placed in room temperature 20min, then a transfection mixed system is added dropwise in 24 holes, shake gently it is several under,
Culture plate is put back into incubator, changes fresh culture after 12 hours.
2. the screening of anti-puromycin positive cell
After transfecting 48h, the puromycin (Puromycin) of 3ug/mL is added in culture medium, continues 7 days, daily replacement training
Base is supported, cell grows monoclonal, and 20 monoclonals for selecting green light expand culture.
3. the PCR of anti-puromycin positive cell is detected
After the monoclonal selected is expanded culture, half mentions genome and carries out PCR detection.PCR amplification primer is P1/P2,
P3/P4 and P1/P3 (as shown in table 10).Respectively on the genome on the outside of the homology arm of left and right, P2 is marked in screening by primer P1 and P3
On the promoter CAG for remembering component TK gene, P4 is on the poly A tract of selection markers component eGFP gene.So P1/P2 can be expanded
The segment of 1.0Kb illustrates that homologous recombination has occurred in the left homology arm of CCR5 gene and Dnoor out, and P3/P4 can amplify about 1.5Kb
Segment, illustrate that homologous recombination has occurred in the right homology arm of CCR5 gene and Donor, conversely, then without homologous recombination；If
P1/P3 TouchDown program, annealing time are set as 2min, amplify the segment of 1.9Kb, then there is no homologous heavy for explanation
Group.PCR detects homologous recombination electrophoresis result as shown in figure 3, the PCR of 20 monoclonals can amplify corresponding band, explanation
The characteristics of left and right homology arm of 20 clones has all been properly inserted CCR5 gene site, but be all the mutation of monoallelic
Sequencing result further demonstrates that CCR5.Donor carrier pinpoints homologous recombination to CCR5 gene.
Primer is used in table 10:PCR detection
4. second of transfection
The clone 2 and 10 for selecting homologous recombination, is incubated in 24 orifice plates.When cell density is 70%, transfected.Turn
Contaminate the eGFP.sgRNA/Cas9 that plasmid is 1ug.Cell culture and transfection process transfect identical with first time, and which is not described herein again.
5. the screening of anti-GCV positive cell
After transfecting 48h, the Ganciclovir (ganciclovir, GCV) of 3ug/mL is added in culture medium, continues 10 days, daily
Culture medium is replaced, cell grows monoclonal, and 48 monoclonals for selecting not green light expand culture.
6. the PCR product digestion of anti-GCV positive cell detects
After the monoclonal selected is expanded culture, the digestion detection that genome carries out PCR product is proposed.PCR amplification primer is
P1/P3.Pcr amplification product is detected with SalI digestion.In 48 clones selected, the PCR product of 1 clone can be by SalI digestion
It opens.Its digestion result is as shown in figure 4, simultaneously sequencing result further demonstrates that the 32bp seamless edit of CCR5 gene is SalI digestion position
Point.
After introducing double-strand break (Double strand break, DSB) in genomic DNA by nucleic acid zymotechnic,
Cell mainly passes through non-homologous end joining (Non-homologous end joining, NHEJ) reparation.For encoding gene
There is the frameshift mutation " knockout " of 2/3 probability realization target gene using NHEJ mechanism reparation, but the result that NHEJ is repaired has
There is uncontrollability, can not achieve the accurate edits of target gene；Using homologous dependence reparation (Homology-directed
Repair, HDR) mechanism, it can be realized the accurate edits of target gene by means of the homologous recombination effect of donor dna, but still
Low, positive cell clone screening difficulty (the case where being free of selection markers for donor dna) that there is HDR recombination efficiencies.In order to
The efficiency for improving accurate edits in traditional technology, selection markers component is inserted between donor Donor or so homology arm, is passed through
The screening of drug has stayed in selection markers component on genome to be enriched with the cell of gene editing.In order to remove this
A selection markers component, people usually carry out homologous recombination using Cre/loxP system, again will after the cell edited
Cell is removed selection markers component by being transferred to Cre/loxP recombinase, but the system leaves 34bp's in the genome
LoxP sequence.Selection markers component can be removed and genome is carried out accurate edits by PB transposons, but PB transposons is but
It is easy to the other positions " jumped " to genome.The base carried out based on HR and SSA mechanism is knocked out using two step of CRISPR/Cas9
Because seamless edit method can carry out the screening of positive cell clone, seamless deletion selection markers component reaches the seamless of gene
Editor.
Claims (5)
1. a kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA, which is characterized in that the base
Because seamless edit method constructs the eGFP.CRISPR/ of the CCR5.CRISPR/Cas9 and targeting eGFP of targeting CCR5 gene first
Cas9 expression vector,
The building of the eGFP.CRISPR/Cas9 expression vector of the CCR5.CRISPR/Cas9 and targeting eGFP of the CCR5 gene
Method are as follows: using pll3.7-gRNA-Cas9 carrier as template, upstream primer is respectively CCR5-F and eGFP-F, and downstream primer is all same
For R, the primer sequence of the CCR5-F are as follows: GACGGTCTCGGATCCCATACAGTCAGTATCAATTCGTTTTAGAGCTGTA
GGATCCAAC, the primer sequence of the eGFP-F are as follows: GACGGTCTCGGATCCCGCGCCGAGGTGAAGTTCGATTTTAGAG
CTGTAGGATCCAA；The sequence of the R are as follows: CAGCTCGAGAAAAAAAACACCGAATCGGTGCCA；PCR amplification CCR5 respectively
With the gRNA segment of eGFP gene；I double digestion CRISPR/Cas9 expression vector of BamH I and Xho is then used, as skeleton, simultaneously
The gRNA segment obtained with Bsa I and the amplification of I double digestion of Xho, after skeleton and the recycling of gRNA segment glue, by the bone of digestion recycling
Frame and PCR fragment are attached, and segment and the mole ratio of skeleton are 3:1 in linked system, are then converted connection product and are felt
By state bacterium DH5 α, on the plate for applying LB solid medium with ampicillin, picking monoclonal after culture continues to cultivate,
Plasmid is then extracted, that is, obtains CCR5.CRISPR/Cas9 the and eGFP.CRISPR/Cas9 expression vector；
And donor CCR5-Donor carrier is constructed, the donor CCR5-Donor carrier has pXL-BACII-Larm-CAG-TK-
PGK-PuroR- T2A-eGFP-bGH pA-R-arm structure, wherein L-arm and R-arm is left and right homology arm, L-arm and R-
CAG-TK-PGK-Puro among armR- T2A-eGFP-bGH pA is selection markers component；
The construction method of the donor CCR5-Donor carrier are as follows: distinguish digestion carrier pXL-BACII-R- with NotI and XhoI
Arm-L-arm and carrier pBlue-CAG-TK-PGK-PuroR- T2A-eGFP-bGH pA obtains skeleton and Insert Fragment, connection
Building, that is, obtain the support C CR5-Donor；
The construction method of the pXL-BACII-R-arm-L-arm are as follows:
Using the genome of HEK293T as template, with primer SSA-F:AATCTCGAGCGCGCCGAGGTGAAGTTCGAGGGTCTT
ACTGTCCCCTTCTGGG and SSA-R:GTCGACTGTATGGAAAATGAGAGCTG expands repetitive sequence；Primer is used simultaneously
CCR5-R-F:TCATTTTCCATACAGTCGACTTAAAGATAGTCATCTTGGGGCTG and CCR5-R-R:
AATAAGCTTCTCAAGAATCAGCAATTCTCTG, PCR amplification R-arm-P；
Using the repetitive sequence of above-mentioned amplification and R-arm-P as template, R-arm is expanded with primer SSA-F and CCR5-R-R, is used
HindIII and XhoI distinguishes digestion pXL-BACII-L-arm and R-arm segment, and respectively as skeleton and segment, connection is obtained
The carrier pXL-BACII-R-arm-L-arm；
By transfecting twice, using CRISPR/Cas9 technology respectively target practice CCR5 gene and eGFP target site and utilize cell
Interior HR and SSA repair mechanism is screened by the positive negative sense of cell, completes seamless edit；
First time rotaring transfecting mode in the transfection twice are as follows: utilize CCR5.CRISPR/Cas9 expression vector and donor
CCR5.Donor carrier target practice CCR5 gene, while carrying out homologous recombination；Second of rotaring transfecting mode are as follows: utilize eGFP.CRISPR/
The intermediate selection markers component of Cas9 expression vector target practice.
2. a kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA according to claim 1,
It is characterized in that, the building of the selection markers component successively includes: the building of carrier Pll3.7-CAG, carrier Pll3.7-
The building of CAG-TK, carrier PLL3.7-CAG-TK-PGK-PuroRThe building of-T2A-eGFP, carrier pBlue-CAGTK-PGK-
PuroRThe building of-T2A-eGFP and carrier pBlue-CAG-TK-PGK-PuroRThe building of-T2A-eGFP-bGH pA；
The construction method of the carrier Pll3.7-CAG are as follows: using plasmid CAG pShuttle as template, amplimer be ATG-F with
ATG-R, ATG-F GCGGCCGCTCGACATTGATTATTGACTAG, ATG-R GAATTCAAATGATGAGACAGCACAAT
AACCAG obtains CAG segment by PCR；Use NotI and EcoRI digestion Pll3.7 as skeleton, while with NotI and EcoRI enzyme
CAG segment, Pll3.7 skeleton digestion system and CAG segment digestion system are cut, glue recycles target fragment；Skeleton and digestion are recycled
CAG segment connection, convert bacillus coli DH 5 alpha competent cell, after culture upgrading grain to get；
The construction method of the carrier Pll3.7-CAG-TK are as follows: using plasmid pRL-TK as template, amplimer TK-F:
GCGGGTCTCCAATTATGGCCTCGTACCCCG, TK-R:CTAGCTAGCGGATCCACCGGTGTTAGCCTCCCCCATCTCC,
PCR amplification TK segment；NheI the and EcoRI digestion of TK segment, skeleton Pll3.7-CAG use NheI and EcoRI digestion simultaneously, connect
Connect to get；
The carrier PLL3.7-CAG-TK-PGK-PuroRThe construction method of-T2A-eGFP are as follows: with plasmid pCAG-T7-cas9+
gRNApgk-PuroR- T2A-eGFP is template, amplimer PPTG-F:CTAgctagcCCGGTAGGCGCCAAC；PPTG-
R:CCGgaattcCTTGTACAGCTCGTCCATGC, PCR amplification obtain PGK-PuroR- T2A-eGFP segment, PGK-PuroR-
NheI the and EcoRI digestion of T2A-eGFP segment, at the same NheI and EcoRI digestion skeleton Pll3.7-CAG-TK to get；
The pBlue-CAG-TK-PGK-PuroRThe construction method of-T2A-eGFP are as follows: distinguish digestion with NotI and EcoRI
Pll3.7-CAG-TK-PGK-PuroR- T2A-eGFP and pBlueScript II SK (+) obtain segment and skeleton, connect, i.e.,
?；
The pBlue-CAG-TK-PGK-PuroRThe construction method of-T2A-eGFP-bGH pA are as follows: using PX330 as template, with bGH
PA-F:AATGAATTCCGACTGTGCCTTCTAGTTGC and bGH pA-R:aatCTCGAGCCAGCATGCCTGCTATTCTC is
Primer, amplified fragments bGH pA, with EcoRI and XhoI endonuclease bamhi bGH pA, while with EcoRI and XhoI digestion pBlue-
CAG-TK-PGK-PuroR- T2A-eGFP obtain skeleton, connection to get.
3. a kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA according to claim 1,
It is characterized in that, the building of the intermediate vector pXL-BACII-R-arm-L-arm successively includes: intermediate vector pXL-BACII-
The building of L-arm and the building of pXL-BACII-R-arm-L-arm；
The construction method of the pXL-BACII-L-arm are as follows: using the genome of HEK293T as template, with primer CCR5-L-F:
AATGGATCCCATGGTGCTATAGAGCACAA and CCR5-L-RAATGCGGCCGCCCGCGCCGAGGTGAAGTTCGAGGGGA
AAATGAGAGCTGCA GGTG expands L-arm segment；With BamHI and NotI difference digestion pXL-BACII and L-arm segment point
Not Zuo Wei skeleton and segment, connection to get.
4. a kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA according to claim 1,
It is characterized in that, the CCR5 target site segment are as follows: CATACAGTCAGTATCAATTCTGG；The eGFP target site are as follows:
CGCGCCGAGGTGAAGTTCGAGGG。
5. a kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA according to claim 1,
It is characterized in that, in the transfection twice, transfection is added for the first time CCR5.CRISPR/Cas9 expression vector and donor
The molecule mole ratio of CCR5.Donor carrier is 1:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610333062.3A CN106011171B (en) | 2016-05-18 | 2016-05-18 | A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610333062.3A CN106011171B (en) | 2016-05-18 | 2016-05-18 | A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106011171A CN106011171A (en) | 2016-10-12 |
| CN106011171B true CN106011171B (en) | 2019-10-11 |
Family
ID=57098846
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610333062.3A Expired - Fee Related CN106011171B (en) | 2016-05-18 | 2016-05-18 | A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106011171B (en) |
Families Citing this family (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6261500B2 (en) | 2011-07-22 | 2018-01-17 | プレジデント アンド フェローズ オブ ハーバード カレッジ | Evaluation and improvement of nuclease cleavage specificity |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| WO2016022363A2 (en) | 2014-07-30 | 2016-02-11 | President And Fellows Of Harvard College | Cas9 proteins including ligand-dependent inteins |
| US20190225955A1 (en) | 2015-10-23 | 2019-07-25 | President And Fellows Of Harvard College | Evolved cas9 proteins for gene editing |
| KR102547316B1 (en) | 2016-08-03 | 2023-06-23 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Adenosine nucleobase editing agents and uses thereof |
| AU2017308889B2 (en) | 2016-08-09 | 2023-11-09 | President And Fellows Of Harvard College | Programmable Cas9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR20240007715A (en) | 2016-10-14 | 2024-01-16 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Aav delivery of nucleobase editors |
| CN106755049B (en) * | 2016-11-14 | 2020-04-21 | 西北农林科技大学 | Visual cell repair efficiency report system based on artificial nuclease and establishment method thereof |
| CN106636199A (en) * | 2016-12-02 | 2017-05-10 | 中国人民解放军军事医学科学院野战输血研究所 | Method for easily screening and obtaining target gene knock-out cell line by using CRISPR/Cas9 technology, and product of method |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| EP3592777A1 (en) | 2017-03-10 | 2020-01-15 | President and Fellows of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| WO2019023680A1 (en) | 2017-07-28 | 2019-01-31 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (pace) |
| CN107541525B (en) * | 2017-08-26 | 2021-12-10 | 内蒙古大学 | Method for mediating goat Tbeta 4 gene fixed-point knock-in based on CRISPR/Cas9 technology |
| WO2019139645A2 (en) | 2017-08-30 | 2019-07-18 | President And Fellows Of Harvard College | High efficiency base editors comprising gam |
| CN108034674B (en) * | 2017-10-10 | 2021-03-16 | 中国人民解放军第四军医大学 | Recombinant vector and method for quickly establishing gene knockout cell strain |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN110396523B (en) * | 2018-04-23 | 2023-06-09 | 中国科学院分子植物科学卓越创新中心 | Plant site-directed recombination method mediated by repeated segments |
| CN108690844B (en) * | 2018-05-25 | 2021-10-15 | 西南大学 | CRISPR/Cas9-gRNA targeting sequence pair of HTT, plasmid and HD cell model |
| CA3130488A1 (en) | 2019-03-19 | 2020-09-24 | David R. Liu | Methods and compositions for editing nucleotide sequences |
| CN109880851B (en) * | 2019-03-28 | 2020-12-01 | 西北农林科技大学 | Screening report vector and screening method for enriching CRISPR/Cas 9-mediated homologous recombination repair cells |
| GB2614813A (en) | 2020-05-08 | 2023-07-19 | Harvard College | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
-
2016
- 2016-05-18 CN CN201610333062.3A patent/CN106011171B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| CRISPR/Cas9技术在鸡、猪基因组编辑研究中的应用及一种新型基因无缝编辑技术的开发研究;白义春;《中国博士学士论文全文数据库》;20160815;A006-167 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106011171A (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106011171B (en) | A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA | |
| CN106191116B (en) | Foreign gene based on CRISPR/Cas9 knocks in integration system and its method for building up and application | |
| Gilles et al. | Efficient CRISPR-mediated gene targeting and transgene replacement in the beetle Tribolium castaneum | |
| CN107880132B (en) | Fusion protein and method for carrying out homologous recombination by using same | |
| AU2016384364B2 (en) | Recombinogenic nucleic acid strands in situ | |
| CN108441520A (en) | The gene conditionity knockout technique built using CRISPR/Cas9 systems | |
| US7105348B2 (en) | Methods of modifying eukaryotic cells | |
| CN109136248A (en) | Multiple target point editor carrier and its construction method and application | |
| CN109306361A (en) | A kind of gene editing system of new A/T to G/C base fixed point conversion | |
| Brumos et al. | An improved recombineering toolset for plants | |
| Armstrong et al. | Characterization of bacterial artificial chromosome transgenic mice expressing mCherry fluorescent protein substituted for the murine smooth muscle α‐actin gene | |
| Clark et al. | A most formidable arsenal: genetic technologies for building a better mouse | |
| CN109880851A (en) | For being enriched with the screening report carrier and screening technique of the homologous recombination repair cell of CRISPR/Cas9 mediation | |
| Rosen et al. | Beyond knockouts: the International Knockout Mouse Consortium delivers modular and evolving tools for investigating mammalian genes | |
| CN106086031A (en) | Pig flesh chalone gene editing site and application thereof | |
| Bapst et al. | Cre-mediated, loxP independent sequential recombination of a tripartite transcriptional stop cassette allows for partial read-through transcription | |
| JP2005519633A5 (en) | ||
| CN106399370B (en) | It is a kind of to establish the flounder embryo cell strain method for stablizing transgenosis | |
| CN111876422A (en) | Screening report system capable of being used for enriching CRISPR/Cas9-mediated accurate NHEJ repair cells | |
| CN103232977A (en) | Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system | |
| CN103352050B (en) | Method for improving cell transfection efficiency through utilization of bacterial artificial chromosome homologous recombination | |
| CN110408621A (en) | The methods and applications of macaque ROSA26 gene and its gene modification | |
| CN107779462A (en) | Double homologous recombination pedigree tracer techniques | |
| CN105462986B (en) | Pig specificity close friend site Pifs302 and its application | |
| WO2011001247A2 (en) | Methods and kits for high efficiency engineering of conditional mouse alleles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20191011 |