CN106011171A - SSA (single-strand annealing) repair-based gene seamless editing method utilizing CRISPR/Cas9 technology - Google Patents
SSA (single-strand annealing) repair-based gene seamless editing method utilizing CRISPR/Cas9 technology Download PDFInfo
- Publication number
- CN106011171A CN106011171A CN201610333062.3A CN201610333062A CN106011171A CN 106011171 A CN106011171 A CN 106011171A CN 201610333062 A CN201610333062 A CN 201610333062A CN 106011171 A CN106011171 A CN 106011171A
- Authority
- CN
- China
- Prior art keywords
- arm
- ccr5
- carrier
- egfp
- donor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention mainly belongs to the technical field of gene editing and particularly relates to an SSA (single-strand annealing) repair-based gene seamless editing method utilizing a CRISPR/Cas9 technology. According to the gene seamless editing method, CRISPR/Cas9 expression vectors CCR5.CRISPR/Cas9 and eGFP.CRISPR/Cas9 targeting CCR5 and eGFP are constructed firstly, a donor CCR5-Donor vector is constructed, a CCR5-Donor plasmid vector adopts the pXL-BACII-L-arm-CAG-TK-PGK-Puro<R>-T2A-eGFP-bGH pA-R-arm structure, L-arm and R-arm are left and right homologous arms, and CAG-TK-PGK-Puro<R>-T2A-eGFP-bGH pA between L-arm and R-arm is a screening marking component; through two times of transfection, seamless editing is completed by using HR and SSA repair mechanisms in the CRISPR-Cas9 system and cells through positive and negative screening of puromycin and ganciclovir of the cells.
Description
Technical field
The present invention principally falls into gene editing technical field, is specifically related to one and utilizes CRISPR/Cas9 technology based on SSA
The gene seamless edit method repaired.
Background technology
Gene editing technology is the key that people open understanding gene function, and research gene function is mainly by same in early days
Source recombination form carries out gene editing, and this mode depends on nature restructuring unduly, for mammal, extremely inefficient, only
1/10000000th, it is impossible to enough meet the scientific research demand that the mankind are growing.People find under study for action subsequently, if at genome
Double-strand break (Double Strand Breaks, DSBs), corresponding homology weight in mammalian cell is introduced on DNA target site
Group efficiency is greatly improved than spontaneous homologous recombination, can reach 3～5 × 10-2.Three-type-person's work nuclease of rising in recent years: zinc refers to
Nuclease (Zinc finger nuclease s, ZFNs), TALE nuclease (Transcription activator-like
Effector nuclease, TALENs), and CRISPR/Cas9 nuclease technology can be at DNA target site generation DNA double
Chain interruption, such that it is able to be greatly improved the efficiency of genome editor.Because CRISPR/Cas9 is the nuclease that a kind of RNA guides
Technology, as long as the 20bp in the middle of changing just can complete the cutting to different target sites, has obtained more especially
Application.
In addition, if inserting selection markers assembly in the middle of homology arm, can also be greatly improved by drug screening
The efficiency of homologous recombination.But, selection markers assembly can be retained in genome.Selection markers assembly is present in genome may
Transcribing or unwanted gene-splicing of meeting suppressor gene.Cre/loxP system is utilized to be deleted by selection markers assembly, but
It it is the loxp sequence but staying next 34bp.This short sequence is likely to affect mammal and closes on the expression of gene.
PiggyBac Transposon System can delete by traceless selection markers assembly of milli.But PiggyBac transposon is easy to whole
Close other sites of genome.
(SSA) is repaired in strand annealing is a kind of approach repaired after DNA damage, and this approach is DNA double chain interruption position
A kind of special homologous recombination repair occurred between the homologous sequence that two sections of directions are identical.Damage location and analogous parts district
Strand can be unwind in territory and mutually complementary pairing combines, and this annealed combination can be further processed rapidly, i.e. excises list
Chain tail also fills up breach, thus deletes the fragment in the middle of homologous sequence and a homologous sequence.For a long time, people think
Non-homologous end joining (NHEJ) is topmost repair mode after mammalian DNA fracture, but if at the two ends of fracture
There is repetitive sequence, and repetitive sequence is adjacent relatively near, SSA can become topmost repair mode.
Summary of the invention
For the problems referred to above, the invention discloses a kind of gene utilizing CRISPR/Cas9 technology to repair based on SSA seamless
Edit methods, described gene seamless edit method utilizes CRISPR/Cas9 system and intracellular HR and SSA repair machine for twice
System, is screened by the positive negative sense of cell, reaches the purpose of gene seamless edit.
The present invention is achieved by the following technical solutions:
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA, described gene seamless edit
First method builds the eGFP.CRISPR/Cas9 of the CCR5.CRISPR/Cas9 and targeting eGFP of targeting CCR5 gene and expresses load
Body, and build donor CCR5-Donor carrier, described donor CCR5-Donor carrier has pXL-BACII-L-arm-CAG-TK-
PGK-PuroR-T2A-eGFP-bGH pA-R-arm structure, wherein, L-arm and R-arm is left and right homology arm, L-arm and R-
CAG-TK-PGK-Puro in the middle of armR-T2A-eGFP-bGH pA is selection markers assembly；By twice transfection, utilize
CRISPR/Cas9 technology target practice CCR5 gene respectively and eGFP target site and utilize intracellular HR and SSA repair mechanism are logical
Cross the positive negative sense screening of cell, complete seamless edit.
Further, build donor CCR5-Donor carrier and specifically include following steps:
(1) structure of selection markers assembly: described selection markers modular construction is pBlue-CAG-TK-PGK-PuroR-
T2A-eGFP-bGH pA, its two ends have the target site of eGFP；
(2) structure of intermediate carrier pXL-BACII-R-arm-L-arm: left and right homology arm L-arm and R-arm is inserted into
In pXL-BACII carrier, build and obtain carrier pXL-BACII-R-arm-L-arm, wherein, left and right homology arm L-arm and R-arm
Between containing NotI and XhoI restriction enzyme site；
(3) structure of donor CCR5-Donor carrier: by CAG-TK-PGK-PuroR-T2A-eGFP-bGH pA sequence is inserted
Enter to step (2) to obtain between left and right homology arm L-arm and R-arm of the pXL-BACII-R-arm-L-arm prepared and supply
Body CCR5-Donor carrier.
Further, the structure of step (1) described selection markers assembly includes successively: the structure of carrier Pll3.7-CAG,
The structure of carrier Pll3.7-CAG-TK, carrier PLL3.7-CAG-TK-PGK-PuroRThe structure of-T2A-eGFP, carrier pBlue-
CAG-TK-PGK-PuroRThe structure of-T2A-eGFP and carrier pBlue-CAG-TK-PGK-PuroR-T2A-eGFP-bGH pA
Structure.
Further, the structure of step (2) described intermediate carrier pXL-BACII-R-arm-L-arm includes successively: middle
Carrier pXL-BACII-L-arm builds and the structure of pXL-BACII-R-arm-L-arm.
Further, the structure of step (3) described donor CCR5-Donor carrier is particularly as follows: distinguish enzyme with NotI and XhoI
Cut intermediate carrier pXL-BACII-R-arm-L-arm and selection markers assembly carrier pBlue-CAG-TK-PGK-PuroR-
T2A-eGFP-bGH pA, it is thus achieved that skeleton and Insert Fragment, connects and builds, it is thus achieved that support C CR5-Donor.
Further, transfection utilizes CCR5.CRISPR/Cas9 expression vector and donor CCR5.Donor carrier to beat for the first time
Target CCR5 gene carries out homologous recombination simultaneously, and second time utilizes the screening mark in the middle of the target practice of eGFP.CRISPR/Cas9 expression vector
Note assembly.
Further, described CCR5 target site fragment is: CATACAGTCAGTATCAATTCTGG；Described GFP target site
For: CGCGCCGAGGTGAAGTTCGAGGG.
Further, in described twice transfection, CCR5.CRISPR/Cas9 expression vector that for the first time transfection adds and
The molecule mole ratio of donor CCR5.Donor carrier is 1:1.
The Advantageous Effects of the present invention:
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA that the present invention provides is permissible
Carry out the screening of positive cell clone, seamless deletion selection markers assembly, reach the seamless edit of gene.
Accompanying drawing explanation
Fig. 1 is CRISPR/Cas9 expression vector plasmid map；
Fig. 2 is the plasmid map of CCR5-Donor；
Fig. 3 is that PCR detects homologous recombination electrophoresis；
Fig. 4 is the PCR primer SalI enzyme action result of anti-GCV clone.
Detailed description of the invention
In order to make the purpose of the present invention, technical scheme and advantage clearer, below in conjunction with drawings and Examples, right
The present invention is explained in further detail.Should be appreciated that specific embodiment described herein is used only for explaining the present invention, and
It is not used in the restriction present invention.
On the contrary, the present invention contain any be defined by the claims the replacement done in the spirit and scope of the present invention, repair
Change, equivalent method and scheme.Further, in order to make the public that the present invention to be had a better understanding, thin to the present invention below
During joint describes, detailed describe some specific detail sections.There is no these detail sections for a person skilled in the art
Description can also understand the present invention completely.
Embodiment 1
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA, described gene seamless edit
First method builds the eGFP.CRISPR/Cas9 of the CCR5.CRISPR/Cas9 and targeting eGFP of targeting CCR5 gene and expresses load
Body, and build donor CCR5-Donor carrier, described donor CCR5-Donor carrier has pXL-BACII-L-arm-CAG-TK-
PGK-PuroR-T2A-eGFP-bGH pA-R-arm structure, wherein, L-arm and R-arm is left and right homology arm, L-arm and R-
CAG-TK-PGK-Puro in the middle of armR-T2A-eGFP-bGH pA sequence is selection markers modular construction；By twice transfection,
Utilize twice CRISPR/Cas9 technology target practice CCR5 gene respectively and eGFP target site and intracellular HR and SSA repair machine
System, is screened by the positive negative sense of cell, completes seamless edit.
The eGFP.CRISPR/Cas9 expression vector of the CCR5.CRISPR/Cas9 and targeting eGFP of targeting CCR5 gene
Build:
With the prior art that is configured to of CRISPR/Cas9 expression vector, build the CRISPR/Cas9 expression vector knot obtained
Structure is as shown in Figure 1.With pll3.7-gRNA-Cas9 carrier as template, forward primer is respectively CCR5-F and eGFP-F, and downstream is drawn
Thing is all R, respectively the gRNA fragment of PCR amplification CCR5 and eGFP gene.PCR amplification the primer is as shown in table 1.PCR is anti-
Answering system as described in Table 2, reaction condition is: 95 DEG C of denaturations 5min；95 DEG C of degeneration 30s, 68 DEG C of annealing 30s, 72 DEG C of extensions
20s, 18 circulations, the annealing temperature of each circulation drops 1 DEG C；95 DEG C of degeneration 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 20s, 25
Circulation；Last 72 DEG C extend 10min.
With BamH I and Xho I double digestion plasmid pll3.7-gRNA-Cas9 i.e. CRISPR/Cas9 expression vector as skeleton,
Simultaneously by the gRNA fragment of Bsa I and Xho I double digestion amplification, enzyme action system is shown in Table 3, table 4.Skeleton and gRNA fragment glue are reclaimed
After, the skeleton and the PCR fragment that are reclaimed by enzyme action connect 10h at 16 DEG C, linked system is shown in Table 5 (fragment and skeleton in linked system
Mole ratio be 3:1, both quality and be 50-150ng).
Then will connect product transformed competence colibacillus antibacterial DH5 α, be coated with the flat board of the LB solid medium containing ampicillin
On, after 37 DEG C of bacteriological incubators cultivate 12h, take monoclonal with the aseptic lancet choicest of 10 μ L, be seeded in containing ampicillin LB
In fluid medium, 37 DEG C of shaking tables are cultivated 12h, 10,000r/min centrifugal collection thalline, illustrates according to plasmid extraction kit
Book operating procedure extracts plasmid.Obtain the CCR5.CRISPR/Cas9 and the eGFP.CRISPR/ of targeting eGFP of targeting CCR5 gene
Cas9 expression vector.
Table 1 pcr amplification primer thing sequence
Note: dashed part is the DNA sequence with target complement sequence.
Table 2 PCR amplification system
Table 3 pll3.7-gRNA-Cas9 skeleton enzyme action system
The PCR primer enzyme action system of table 4 gRNA
Table 5 gRNA/Cas9 linked system
Build donor CCR5-Donor carrier and specifically include following steps:
(1) structure of selection markers assembly carrier: described selection markers modular construction is pBlue-CAG-TK-PGK-
PuroR-T2A-eGFP-bGH pA；Specifically include following steps:
The structure of carrier Pll3.7-CAG: with plasmid CAG pShuttle (Addgene) as template, amplimer is ATG-
F and ATG-R, ATG-F be gcggccgc TCGACATTGATTATTGACTAG (NotI), ATG-R be gaattc
AAATGATGAGACAGCACAATAACCAG (EcoRI), obtains CAG fragment through PCR.PCR reaction system is as shown in table 6, instead
The condition is answered to be: 95 DEG C of denaturations 5min；95 DEG C of degeneration 30s, 68 DEG C of annealing 30s, 72 DEG C extend 20s, 18 circulations, each circulation
Annealing temperature drop 1 DEG C；95 DEG C of degeneration 30s, 50 DEG C of annealing 30s, 72 DEG C extend 20s, 25 circulations；Last 72 DEG C of extensions
10min。
Table 6:CAG fragment PCR system
With NotI and EcoRI enzyme action Pll3.7 (Addgene) as skeleton, simultaneously with NotI and EcoRI enzyme action CAG sheet
Section, Pll3.7 skeleton enzyme action system and CAG fragment enzyme action system (being shown in Table 7, table 8), glue reclaims purpose fragment.By skeleton and enzyme
The CAG fragment cut back to close connects, and linked system is shown in Table 9.Through 16 DEG C overnight after convert bacillus coli DH 5 alpha competent cell, be coated with
LB/Amp flat board, picking monoclonal 37 DEG C of cultivation 8h in LB/Amp fluid medium, upgrading grain, it is thus achieved that carrier Pll3.7-
CAG。
Table 7:Pll3.7 skeleton enzyme action system
Table 8:CAG fragment enzyme action system
Table 9:Pll3.7-CAG linked system
The structure of carrier Pll3.7-CAG-TK: with plasmid pRL-TK (Addgene) as template, amplimer is TK-F:
GCGggtctc CAATTATGGCCTCGTACCCCG (NheI), TK-R:
CTAgctagcggatccaccggtGTTAGCCTCCCCCATCTCC (BsaI), PCR expand TK fragment.TK fragment NheI and
EcoRI enzyme action, skeleton Pll3.7-CAG is simultaneously with NheI and EcoRI enzyme action.Connect, carrier construction PLL3.7-CAG-TK.Its
In, PCR reaction system and response procedures, enzyme action system, linked system is all identical with the building process of carrier Pll3.7-CAG, no
Repeat again.
Carrier PLL3.7-CAG-TK-PGK-PuroRThe structure of-T2A-eGFP: with plasmid pCAG-T7-cas9+gRNA-
pgk-PuroR-T2A-eGFP (buy and obtain) is template, and amplimer is PPTG-F:CTAgctagcCCGGTAGGCGCCAAC
(NheI) PPTG-R:CCGgaattcCTTGTACAGCTCGTCCATGC (EcoRI), PCR amplification obtains PGK-PuroR-T2A-
EGFP fragment.PGK-PuroR-T2A-eGFP fragment NheI and EcoRI enzyme action, simultaneously NheI and EcoRI enzyme action skeleton
Pll3.7-CAG-TK, carrier construction Pll3.7-CAG-TK-PGK-PuroR-T2A-eGFP.Wherein, PCR reaction system and reaction
Program, enzyme action system, linked system is all identical with the building process of carrier Pll3.7-CAG, repeats no more.
Carrier pBlue-CAG-TK-PGK-PuroRThe structure of-T2A-eGFP: with NotI and EcoRI enzyme action respectively
Pll3.7-CAG-TK-PGK-PuroR-T2A-eGFP and pBlueScript II SK (+) obtain fragment and skeleton, connect, structure
Build carrier pBlue-CAG-TK-PGK-PuroR-T2A-eGFP.Wherein, PCR reaction system and response procedures, enzyme action system, even
Junctor system is all identical with the building process of carrier Pll3.7-CAG, repeats no more.
Carrier pBlue-CAG-TK-PGK-PuroRThe structure of-T2A-eGFP-bGH pA: with PX330 (Addgene) as mould
Plate, with bGH pA-F:aat GAATTC CGACTGTGCCTTCTAGTTGC (EcoRI) and bGH pA-R:aatCTCGAG
CCAGCATGCCTGCTATTCTC (XhoI) is primer, amplified fragments bGH pA.With EcoRI and XhoI endonuclease bamhi bGH pA,
Simultaneously with EcoRI and XhoI enzyme action pBlue-CAG-TK-PGK-PuroR-T2A-eGFP obtains skeleton, connects, carrier construction
pBlue-CAG-TK-PGK-PuroR-T2A-eGFP-bGH pA.Wherein, PCR reaction system and response procedures, enzyme action system, even
Junctor system is all identical with the building process of carrier Pll3.7-CAG, repeats no more.
(2) structure of intermediate carrier pXL-BACII-R-arm-L-arm: left and right homology arm L-arm and R-arm is inserted into
In pXL-BACII carrier, build and obtain carrier pXL-BACII-R-arm-L-arm, wherein, left and right homology arm L-arm and R-arm
Between containing NotI and XhoI restriction enzyme site；Specifically include following steps:
The structure of intermediate carrier pXL-BACII-L-arm: with the genome of HEK293T as template, uses primer CCR5-L-F:
AatggatccCATGGTGCTATAGAGCACAA and CCR5-L-R:
aatGCGGCCGCCCGCGCCGAGGTGAAGTTCGAGGGGAAAATGAGAGCTGCAGGTG, amplification length is the L-of 879bp
Arm fragment.Enzyme action pXL-BACII and L-arm fragment is distinguished respectively as skeleton and fragment, connection, structure with BamHI and NotI
Carrier PXL-BACII-L-arm.
The structure of pXL-BACII-R-arm-L-arm: with the genome of HEK293T as template, use primer SSA-F:aat
CTCGAGCGCGCCGAGGTGAAGTTCGAGGGTCTTACTGTCCCCTTCTGGG and SSA-R:
GtcgacTGTATGGAAAATGAGAGCTG expands repetitive sequence Repeat.Use primer CCR5-R-F simultaneously:
TCATTTTCCATACAgtcgacTTAAAGATAGTCATCTTGGGGCTG and CCR5-R-R:
AatAAGCTTCTCAAGAATCAGCAATTCTCTG, PCR expand R-arm-P.
With Repeat and R-arm-P of above-mentioned amplification as template, expand R-arm with primer SSA-F and CCR5-R-R.With
HindIII and XhoI enzyme action pXL-BACII-L-arm respectively and R-arm fragment, respectively as skeleton and fragment, connect and build load
Body pXL-BACII-R-arm-L-arm.
(3) structure of donor CCR5-Donor carrier: by CAG-TK-PGK-PuroR-T2A-eGFP-bGH pA sequence is inserted
Enter to step (2) to obtain between left and right homology arm L-arm and R-arm of the pXL-BACII-R-arm-L-arm prepared and supply
Body CCR5-Donor carrier.
The structure of described donor CCR5-Donor carrier is particularly as follows: distinguish enzyme action intermediate carrier pXL-with NotI and XhoI
BACII-R-arm-L-arm and selection markers assembly carrier pBlue-CAG-TK-PGK-PuroR-T2A-eGFP-bGH pA,
Obtain skeleton and Insert Fragment, connect and build, it is thus achieved that support C CR5-Donor (as shown in Figure 2).
Illustrate as a example by the seamless edit of the CCR5 gene of HEK293T cell below, seamless edit concrete steps:
1. transfection for the first time
HEK 293T cell line is placed in containing DMEM, 10% hyclone, in the culture medium of 100 μ g/mL mycillins, 37
DEG C, the CO2 incubator of 5% is cultivated.
The transfection of HEK 293T cell line: as a example by 24 orifice plates, in inoculation HEK 293T cell to 24 orifice plates, treats that cell is close
When degree is close to 70%, change fresh culture.Culture medium in sucking-off 24 orifice plate, every hole adds the fresh culture of 37 DEG C of preheatings
500 μ L, start transfection after 2-4 hour.Take two 1.5mL sterilizing EP pipe, one add about 1.6 μ g (CCR5.sgRNA/Cas9 with
CCR5-Donor molecule mole ratio is 1:1) plasmid, be subsequently adding Opti-MEM to cumulative volume 30 μ L；In another EP pipe
Add 2 μ L So-Fast transfection reagent and Opti-MEM to 30 μ L.Mixture in two EP pipes of mixing, then will contain and turn gently
The Opti-MEM of transfection reagent is slowly added in the EP pipe containing plasmid, and limit edged shakes gently so that it is fully mix.Add mixing
After, mixture is placed in room temperature 20min, then by one transfection mixed system drop in 24 holes, rock gently several under,
Culture plate is put back to incubator, after 12 hours, changes fresh culture.
The screening of the most anti-puromycin positive cell
After transfection 48h, adding the puromycin (Puromycin) of 3ug/mL in culture medium, continue 7 days, every day changes training
Supporting base, cell grows monoclonal, and 20 monoclonals selecting green light are enlarged cultivating.
The PCR detection of the most anti-puromycin positive cell
After the monoclonal amplification culture that will select, half carries genome and carries out PCR detection.Pcr amplification primer thing is P1/P2,
P3/P4 and P1/P3 (as shown in table 10).On primer P1 and P3 genome outside the homology arm of left and right respectively, P2 is at screening mark
In promoter CAG of note assembly TK gene, P4 is on the poly A tract of selection markers assembly eGFP gene.So P1/P2 can expand
The left homology arm of the fragment explanation CCR5 gene and Dnoor that go out 1.0Kb there occurs homologous recombination, and P3/P4 can amplify about 1.5Kb
Fragment, illustrate that the right homology arm of CCR5 gene and Donor there occurs homologous recombination, otherwise, then there is no homologous recombination；If
P1/P3 TouchDown program, annealing time is set to 2min, amplifies the fragment of 1.9Kb, then illustrate homology weight
Group.PCR detection homologous recombination electrophoresis result is as it is shown on figure 3,20 monoclonal PCR can amplify corresponding band, explanation
The left and right homology arm of 20 clones has all been properly inserted the feature site of CCR5 gene, but is all monoallelic sudden change
Sequencing result further demonstrates that CCR5.Donor carrier fixed point homologous recombination is to CCR5 gene.
Table 10:PCR detection primer
4. second time transfection
Select the clone 2 and 10 of homologous recombination, be incubated in 24 orifice plates.When cell density is 70%, transfect.Turn
Dye plasmid is the eGFP.sgRNA/Cas9 of 1ug.Cell is cultivated and transfection process transfects identical with first time, repeats no more here.
The screening of the most anti-GCV positive cell
After transfection 48h, culture medium adds the ganciclovir (ganciclovir, GCV) of 3ug/mL, continue 10 days, every day
Changing culture medium, cell grows monoclonal, and 48 monoclonals selecting not green light are enlarged cultivating.
The PCR primer enzyme action detection of the most anti-GCV positive cell
After the monoclonal amplification culture that will select, carry genome and carry out the enzyme action detection of PCR primer.Pcr amplification primer thing is
P1/P3.Pcr amplification product SalI enzyme action detects.In 48 clones selected, the PCR primer of 1 clone can be by SalI enzyme action
Open.As shown in Figure 4, and sequencing result further demonstrates that the 32bp seamless edit of CCR5 gene is SalI enzyme action position to its enzyme action result
Point.
After introduced double-strand break (Double strand break, DSB) in genomic DNA by nuclease technology,
Cell is mainly repaired by non-homologous end joining (Non-homologous end joining, NHEJ).For encoding gene
The frameshift mutation using NHEJ mechanism reparation to have the probability of 2/3 to realize target gene " knocks out ", but the result tool that NHEJ repairs
There is uncontrollability, the accurate edits of target gene can not be realized；Homology dependency is used to repair (Homology-directed
Repair, HDR) mechanism, the accurate edits of target gene it is capable of by means of the homologous recombination effect of donor dna, but still
Also exist that HDR recombination efficiency is low, positive cell clone screening difficulty (for the donor dna situation without selection markers).In order to
Improve the efficiency of accurate edits, in conventional art, between donor about Donor homology arm, insert selection markers assembly, pass through
The screening of medicine is enriched with the cell of gene editing, but has but been stayed on genome by selection markers assembly.In order to remove this
Individual selection markers assembly, people generally utilize Cre/loxP system to carry out homologous recombination, again will after obtaining the cell of editor
Selection markers assembly is removed by cell by proceeding to Cre/loxP recombinase, but this system leaves 34bp's on genome
LoxP sequence.Selection markers assembly can be removed and genome carries out accurate edits by PB transposon, but PB transposon is but
It is easy to " jump " other positions to genome.CRISPR/Cas9 two step is utilized to knock out the base carried out based on HR and SSA mechanism
Because seamless edit method can carry out the screening of positive cell clone, seamless deletion selection markers assembly, reach the seamless of gene
Editor.
Claims (8)
1. one kind utilizes the gene seamless edit method that CRISPR/Cas9 technology is repaired based on SSA, it is characterised in that described base
Because first seamless edit method builds the CCR5.CRISPR/Cas9 and the eGFP.CRISPR/ of targeting eGFP of targeting CCR5 gene
Cas9 expression vector, and build donor CCR5-Donor carrier, described donor CCR5-Donor carrier has pXL-BACII-L-
arm-CAG-TK-PGK-PuroR-T2A-eGFP-bGH pA-R-arm structure, wherein, L-arm and R-arm is left and right homology
Arm, the CAG-TK-PGK-Puro in the middle of L-arm and R-armR-T2A-eGFP-bGH pA is selection markers assembly；By twice
Transfection, utilizes CRISPR/Cas9 technology target practice CCR5 gene respectively and eGFP target site and utilizes intracellular HR and SSA to repair
The system of answering a pager's call, is screened by the positive negative sense of cell, completes seamless edit.
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA,
It is characterized in that, build donor CCR5-Donor carrier and specifically include following steps:
(1) structure of selection markers assembly: described selection markers modular construction is pBlue-CAG-TK-PGK-PuroR-T2A-
EGFP-bGH pA, its two ends have the target site of eGFP；
(2) structure of intermediate carrier pXL-BACII-R-arm-L-arm: left and right homology arm L-arm and R-arm is inserted into pXL-
In BACII carrier, build and obtain carrier pXL-BACII-R-arm-L-arm, wherein, between homology arm L-arm and R-arm of left and right
Containing NotI and XhoI restriction enzyme site；
(3) structure of donor CCR5-Donor carrier: by CAG-TK-PGK-PuroR-T2A-eGFP-bGH pA sequence is inserted into step
Donor CCR5-is obtained between left and right homology arm L-arm and R-arm of the pXL-BACII-R-arm-L-arm that (2) prepare suddenly
Donor carrier.
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA,
It is characterized in that, the structure of step (1) described selection markers assembly includes successively: the structure of carrier Pll3.7-CAG, carrier
The structure of Pll3.7-CAG-TK, the structure of carrier PLL3.7-CAG-TK-PGK-Puro-T2A-eGFP, carrier pBlue-CAG-
TK-PGK-PuroRThe structure of-T2A-eGFP and carrier pBlue-CAG-TK-PGK-PuroRThe structure of-T2A-eGFP-bGH pA
Build.
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA,
It is characterized in that, the structure of step (2) described intermediate carrier pXL-BACII-R-arm-L-arm includes successively: intermediate carrier
PXL-BACII-L-arm builds and the structure of pXL-BACII-R-arm-L-arm.
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA,
It is characterized in that, the structure of step (3) described donor CCR5-Donor carrier is particularly as follows: distinguish in the middle of enzyme action with NotI and XhoI
Carrier pXL-BACII-R-arm-L-arm and selection markers assembly carrier pBlue-CAG-TK-PGK-PuroR-T2A-eGFP-
BGH pA, it is thus achieved that skeleton and Insert Fragment, connects and builds, it is thus achieved that support C CR5-Donor.
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA,
It is characterized in that, transfection for the first time utilizes CCR5.CRISPR/Cas9 expression vector and donor CCR5.Donor carrier target practice CCR5
Gene carries out homologous recombination simultaneously, and second time utilizes the selection markers group in the middle of the target practice of eGFP.CRISPR/Cas9 expression vector
Part.
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA,
It is characterized in that, described CCR5 target site fragment is: CATACAGTCAGTATCAATTCTGG；Described eGFP target site is:
CGCGCCGAGGTGAAGTTCGAGGG。
A kind of gene seamless edit method utilizing CRISPR/Cas9 technology to repair based on SSA,
It is characterized in that, in described twice transfection, the CCR5.CRISPR/Cas9 expression vector of transfection addition for the first time and donor
The molecule mole ratio of CCR5.Donor carrier is 1:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610333062.3A CN106011171B (en) | 2016-05-18 | 2016-05-18 | A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610333062.3A CN106011171B (en) | 2016-05-18 | 2016-05-18 | A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106011171A true CN106011171A (en) | 2016-10-12 |
| CN106011171B CN106011171B (en) | 2019-10-11 |
Family
ID=57098846
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610333062.3A Expired - Fee Related CN106011171B (en) | 2016-05-18 | 2016-05-18 | A kind of gene seamless edit method repaired using CRISPR/Cas9 technology based on SSA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106011171B (en) |
Cited By (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636199A (en) * | 2016-12-02 | 2017-05-10 | 中国人民解放军军事医学科学院野战输血研究所 | Method for easily screening and obtaining target gene knock-out cell line by using CRISPR/Cas9 technology, and product of method |
| CN106755049A (en) * | 2016-11-14 | 2017-05-31 | 西北农林科技大学 | Visual cells remediation efficiency reporting system and its method for building up based on artificial nuclease |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| CN107541525A (en) * | 2017-08-26 | 2018-01-05 | 内蒙古大学 | A kind of method knocked in based on CRISPR/Cas9 technologies mediation goat T Beta-4 gene fixed points |
| CN108034674A (en) * | 2017-10-10 | 2018-05-15 | 中国人民解放军第四军医大学 | A kind of quick recombinant vector and its method for establishing Knockout cells strain |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| CN108690844A (en) * | 2018-05-25 | 2018-10-23 | 西南大学 | CRISPR/Cas9-gRNA target practices sequence pair, plasmid and the HD cell models of HTT |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| CN109880851A (en) * | 2019-03-28 | 2019-06-14 | 西北农林科技大学 | For being enriched with the screening report carrier and screening technique of the homologous recombination repair cell of CRISPR/Cas9 mediation |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| WO2019205939A1 (en) * | 2018-04-23 | 2019-10-31 | 中国科学院上海生命科学研究院 | Repeat-mediated plant site-specific recombination method |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| CN116083488A (en) * | 2023-01-03 | 2023-05-09 | 北京镁伽机器人科技有限公司 | Gene editing method, cell obtained by gene editing method, gene editing system and application thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
-
2016
- 2016-05-18 CN CN201610333062.3A patent/CN106011171B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| CHONGHUA REN,ET AL: "Dual-reporter surrogate systems for efficient enrichment of genetically modified cells", 《CELL. MOL. LIFE SCI》 * |
| KUN XU，ET AL: "Efficient genome engineering in eukaryotes using Cas9 from Streptococcus thermophilus", 《CELL. MOL. LIFE SCI》 * |
| 白义春: "CRISPR/Cas9技术在鸡、猪基因组编辑研究中的应用及一种新型基因无缝编辑技术的开发研究", 《中国博士学士论文全文数据库》 * |
Cited By (56)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| CN106755049B (en) * | 2016-11-14 | 2020-04-21 | 西北农林科技大学 | Visual cell repair efficiency report system based on artificial nuclease and establishment method thereof |
| CN106755049A (en) * | 2016-11-14 | 2017-05-31 | 西北农林科技大学 | Visual cells remediation efficiency reporting system and its method for building up based on artificial nuclease |
| CN106636199A (en) * | 2016-12-02 | 2017-05-10 | 中国人民解放军军事医学科学院野战输血研究所 | Method for easily screening and obtaining target gene knock-out cell line by using CRISPR/Cas9 technology, and product of method |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| CN107541525A (en) * | 2017-08-26 | 2018-01-05 | 内蒙古大学 | A kind of method knocked in based on CRISPR/Cas9 technologies mediation goat T Beta-4 gene fixed points |
| CN107541525B (en) * | 2017-08-26 | 2021-12-10 | 内蒙古大学 | Method for mediating goat Tbeta 4 gene fixed-point knock-in based on CRISPR/Cas9 technology |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| CN108034674A (en) * | 2017-10-10 | 2018-05-15 | 中国人民解放军第四军医大学 | A kind of quick recombinant vector and its method for establishing Knockout cells strain |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| WO2019205939A1 (en) * | 2018-04-23 | 2019-10-31 | 中国科学院上海生命科学研究院 | Repeat-mediated plant site-specific recombination method |
| CN108690844A (en) * | 2018-05-25 | 2018-10-23 | 西南大学 | CRISPR/Cas9-gRNA target practices sequence pair, plasmid and the HD cell models of HTT |
| CN108690844B (en) * | 2018-05-25 | 2021-10-15 | 西南大学 | CRISPR/Cas9-gRNA targeting sequence pair of HTT, plasmid and HD cell model |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN109880851A (en) * | 2019-03-28 | 2019-06-14 | 西北农林科技大学 | For being enriched with the screening report carrier and screening technique of the homologous recombination repair cell of CRISPR/Cas9 mediation |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN116083488A (en) * | 2023-01-03 | 2023-05-09 | 北京镁伽机器人科技有限公司 | Gene editing method, cell obtained by gene editing method, gene editing system and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106011171B (en) | 2019-10-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106011171A (en) | SSA (single-strand annealing) repair-based gene seamless editing method utilizing CRISPR/Cas9 technology | |
| CN106191116B (en) | Foreign gene based on CRISPR/Cas9 knocks in integration system and its method for building up and application | |
| US10870841B1 (en) | Nucleic acid-guided nucleases | |
| CN104404036B (en) | Conditional gene knockout method based on CRISPR/Cas9 technologies | |
| CN104745626B (en) | A kind of fast construction method of conditional gene knockout animal model and application | |
| WO2017143894A1 (en) | Immunodeficient mouse, preparation method therefor, and application thereof | |
| CN109153999A (en) | The neucleic acid chain that in-situ restructuring generates | |
| CN108441520A (en) | The gene conditionity knockout technique built using CRISPR/Cas9 systems | |
| CN108410911A (en) | The cell line of LMNA gene knockouts based on CRISPR/Cas9 technologies structure | |
| US7074611B2 (en) | Method for the stable inversion of DNA sequence by site-specific recombination and DNA vectors and transgenic cells thereof | |
| CN101297031A (en) | PiggyBac used as genetic operation and analysis tool of vertebrate | |
| Clark et al. | A most formidable arsenal: genetic technologies for building a better mouse | |
| CN109136248A (en) | Multiple target point editor carrier and its construction method and application | |
| CN107523588A (en) | A kind of tetracycline slow virus inducible expression carrier and its method for building up and application | |
| CN106086031A (en) | Pig flesh chalone gene editing site and application thereof | |
| US20030135872A1 (en) | Gene targeting methods and vectors | |
| CN103232977B (en) | Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system | |
| Hosur et al. | Programmable RNA-guided large DNA transgenesis by CRISPR/Cas9 and site-specific integrase Bxb1 | |
| JP2005519633A5 (en) | ||
| CN105462969B (en) | Pig specificity close friend site Pifs102 and its application | |
| CN101265483A (en) | Mammary gland specificity expression vector and construction method thereof | |
| KR20020057943A (en) | Trap Vector and Gene Trapping Method by Using the Same | |
| US20030022218A1 (en) | Gene targeting methods and vectors | |
| CN110408621A (en) | The methods and applications of macaque ROSA26 gene and its gene modification | |
| CN105462986B (en) | Pig specificity close friend site Pifs302 and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20191011 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |