CN106011117B - The building of N- carbamyl-D-pHPG hydrolysis enzyme mutant and its engineering bacteria - Google Patents
The building of N- carbamyl-D-pHPG hydrolysis enzyme mutant and its engineering bacteria Download PDFInfo
- Publication number
- CN106011117B CN106011117B CN201510457039.0A CN201510457039A CN106011117B CN 106011117 B CN106011117 B CN 106011117B CN 201510457039 A CN201510457039 A CN 201510457039A CN 106011117 B CN106011117 B CN 106011117B
- Authority
- CN
- China
- Prior art keywords
- phpg
- carbamyl
- hydrolase
- mutant
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
- C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The building of N- carbamyl-D-pHPG hydrolysis enzyme mutant and its engineering bacteria, the cysteine mutation that 5 mutant and the difference of N- carbamyl-D-pHPG hydrolase obtained by directed evolution technologies are respectively as follows: the 193rd in N- carbamyl-D-pHPG hydrolase amino acid sequence is asparagine；200th threonine sports alanine；226th asparagine mutation is tyrosine；243rd cysteine mutation is asparagine；250th cysteine mutation is tyrosine；And engineering bacteria building is carried out, it is applied in the production of D-pHPG and is compared with wild enzyme, there is very big promotion in terms of the tolerance and enzyme activity of tolerance, soda acid to oxygen.
Description
Technical field
The present invention relates to genetic engineering field more particularly to a kind of coding N- carbamyl-D-pHPG hydrolysis
The building of enzyme mutant and its engineering bacteria.
Background technique
D- amino acid and its derivative are the important raw materials of medicine and field of food, are widely used in semi-synthetic antibiosis
The intermediary of element, polypeptide hormone, pyrethroid, insecticide and sweetener etc., thus cause more and more interest, especially
Side chain raw material as semisynthetic antibiotics --- D- type amino acid is more concerned by people.D-pHPG (D-
It p-HPG is) that the important source material for preparing beta-lactam antibiotic (such as penicillin, cephalosporin) and synthesis multiple polypeptides class swash
The main side chain of element and pesticide, is widely used in pharmaceutical field.
For D-pHPG as unnatural amino acid, it cannot utilize natural microorganisms fermenting and producing, at present its
Preparation method mainly has chemical method and biological enzyme two major classes.Chemical preparation reaction condition is relatively violent, pollution is big, yield
It is low and costly, it is gradually mild by reaction condition, it is not necessarily to high temperature and pressure, at low cost, pollution-free, the substrate transformation rate and optics
The all higher biological enzyme of activity is replaced.The technical principle of enzyme process is: using D-hydantoinase (also referred to as D- hydantoin enzyme) will
DL- 4-Hydroxyphenyl hydantoin asymmetric hydrolysis is at N- carbamyl-D-pHPG, then in N- carbamyl-D- to hydroxyl
Under the action of base phenylglycine hydrolase (abbreviation DCase), by N- carbamyl-, D-pHPG is irreversible is hydrolyzed into
D-p-HPG (D-pHPG).
But it is found in industrial production, is separated from microbial cell, extracts N- carbamyl-D-pHPG hydrolysis
The technology that immobilised enzymes is made in enzyme has use, but the cost of enzyme is excessively high, and product yield is also relatively low, and since cell contains enzyme
Vigor is relatively low, can increase enzyme activity stability using regular growth immobilization technology, but immobilized cell enzyme activity is even lower and difficult
To use.Therefore, it during producing D-pHPG, is lacked since DCase catalytic efficiency is low, stability is poor
Point causes intermediary N- carbamyl-D-pHPG largely to accumulate, final product D-pHPG yield
It is low.
Although natural enzyme molecule has been evolved millions upon millions of years under field conditions (factors), because of ring existing for natural enzyme molecule
The difference in border and actual application environment, enzyme molecule still hide huge evolution potentiality.Such as with molecular orientation evolvement technology
Fallibility round pcr, DNA shuffling technology and site-directed mutagenesis technique etc. carry out molecular modification and artificial evolution to microbe-derived enzyme
The progress to attract people's attention has been taken in recent years, artificial orientation's evolution technology on this molecular level be by vitro recombination come
Target gene is transformed, and directed screening has the mutant of expected character, so that transformation has the enzyme of the modification of new function, greatly
The speed evolution process of protein.Wherein, mutation is as one of protein engineering important means, in the transformation of transaminase
It has been played an important role that, can not only illustrate some special mechanisms of transaminase, but also can change to a certain extent
The kinetic activity of good transaminase.Therefore, in bioengineering, the way of relevant issues is solved using mutation and is increasingly subject to weight
Depending on the present invention is directed to which the mutant of N- carbamyl-D-pHPG hydrolase is made, to improve enzyme activity and oxygen, acid
Alkali tolerance, and be applied in the production of D-pHPG, so that the enzyme with the modification of new function is created, with
Greatly accelerate the evolution process of protein.
Summary of the invention
It is an object of the present invention to provide N- carbamyl-D-pHPGs to hydrolyze enzyme mutant, wherein phase
Than in wild enzyme, the mutant enzyme of the N- carbamyl-D-pHPG hydrolysis enzyme mutant gene expression, to oxygen
The tolerance of gas is obviously improved tolerance and the enzyme activity aspect of soda acid.
Another object of the present invention is to provide a kind of N- carbamyl-D-pHPG hydrolysis enzyme mutants
DNA sequence dna.
Another object of the present invention is to provide a kind of N- carbamyl-D-pHPG hydrolysis enzyme mutant is prominent
Become the amino acid sequence of enzyme.
Another object of the present invention is to provide a kind of N- carbamyl-D-pHPG hydrolysis enzyme mutant bases
Because of coded sequence.
Another object of the present invention is to provide it is a kind of include mutant hydrolase gene recombinant plasmid construction method.
Another object of the present invention is to provide a kind of N- carbamyl-D-pHPG hydrolysis enzyme mutant weights
Group expression plasmid.
Another object of the present invention is to provide N- carbamyl-D-pHPG hydrolase mutation construction works
Journey bacterium.
Another object of the present invention is to provide a kind of N- carbamyl-D-pHPG hydrolysis enzyme mutants in D-
Application in the production of D-pHPG.
Another object of the present invention is to provide a kind of N- carbamyl-D-pHPG hydrolysis enzyme mutants in D-
Application in D-pHPG production.
Another object of the present invention is to provide a kind of N- carbamyl-D-pHPG hydrolysis enzyme mutant volumes
Application of the code gene in D-pHPG production.
Another object of the present invention is to provide a kind of recombinant expression plasmid and its in D-pHPG production
Application.
Another object of the present invention is to provide application of the genetic engineering bacterium in D-pHPG production.
In order to achieve the above objectives and other objects of the present invention and advantage, the present invention first use fallibility round pcr and DNA
The method that shuffling technology combines, with the N- carbamyl-D-pHPG hydrolase base screened from marine streptomyces
Because carrying out random mutation to it as templet gene.N- carbamyl-D-pHPG hydrolase sequence with
The enzyme sequence homology that the number of logging in of Genebank is AF320814 is 97%, thus can be assumed that be the same enzyme, be by
304 amino acid compositions, the sequence of coding DNA includes 915bp, DNA sequences encoding and amino acid sequence such as SEQ ID
Shown in NO.1 and SEQ ID NO.2.
Screening system of the invention is to cause indicator color change will as screening index using the pH raising of reaction system
Direct mutation detection.After carbamyl hydrolysis enzyme catalysis reaction, it is improved the pH of reaction system, and the phenol red finger that this method uses
Show that agent can become red from yellow when pH is greater than 6.3.
By the above method, it is higher prominent by patience, degrees that the present invention has screened 5 enzymatic activitys and oxygen
Variant, the present invention 5 mutant obtained are respectively as follows: with the difference of N- carbamyl-D-pHPG hydrolase
The 193rd cysteine mutation is in N- carbamyl-D-pHPG hydrolase amino acid sequence
Asparagine；
The 200th threonine sports third in N- carbamyl-D-pHPG hydrolase amino acid sequence
Propylhomoserin；
The 226th asparagine mutation is in N- carbamyl-D-pHPG hydrolase amino acid sequence
Tyrosine；
The 243rd cysteine mutation is in N- carbamyl-D-pHPG hydrolase amino acid sequence
Asparagine；
The 250th cysteine mutation is in N- carbamyl-D-pHPG hydrolase amino acid sequence
Tyrosine；
According to the present invention, the above-mentioned N- carbamyl of recombinant plasmid clone-D-pHPG hydrolyzes enzyme mutant
The coded sequence of body.
N- carbamyl according to the present invention-D-pHPG hydrolysis enzyme mutant DNA sequence dna is cloned into
Host cell, and the fermentation thalli of the host cell is used in the production of D-pHPG.
According to the present invention, the recombinant plasmid transformed is entered into host cell and obtains genetic engineering bacterium.
Compared to wild type N- carbamyl-D-pHPG hydrolase (wild enzyme), 5 mutant of the invention
Enzyme activity, inoxidizability and heat-resisting quantity be improved, show D-pHPG production in potential application
Value.Therefore, it is suitable for N- carbamyl provided by the invention-D-pHPG hydrolyzing enzyme mutant, N- carbamyl-D-
D-pHPG hydrolyzes the encoding gene of enzyme mutant, N- carbamyl-D-pHPG hydrolysis enzyme mutant
It is sweet that recombinant plasmid, N- carbamyl-D-pHPG hydrolysis enzyme mutant genetic engineering bacterium are applied to D- para hydroxybenzene
In the manufacturing of propylhomoserin.
Biomaterial preservation explanation
The classification naming of biomaterial: streptomycete 7-145
Latin name: Streptomyces sp.7-145
The depositary institution's full name and abbreviation of the preservation biological material specimens: Chinese microorganism strain preservation conservator
Meeting common micro-organisms center (CGMCC)
Depositary institution address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Chinese Academy of Sciences's microbe research
Institute
Preservation date: on 07 12nd, 2013
Deposit number: CGMCC NO.7914
Specific embodiment
It is described below for disclosing the present invention so that those skilled in the art can be realized the present invention.It is excellent in being described below
Embodiment is selected to be only used as illustrating, it may occur to persons skilled in the art that other obvious modifications.It defines in the following description
Basic principle of the invention can be applied to other embodiments, deformation scheme, improvement project, equivalent program and do not carry on the back
Other technologies scheme from the spirit and scope of the present invention.
In following embodiment, used gene-pET28a-DCase refers to from marine streptomyces Streptomyces
The recon that the DCase gene and pET28a filtered out in sp.7-145 (CGMCC NO.7914) is set up, N- carbamyl-D-
The amino acid sequence of D-pHPG hydrolase gene sequence and coding is respectively such as SEQ ID NO:1 and SEQ ID NO:2
It is shown.
Embodiment 1, N- carbamyl-D-pHPG hydrolase gene clone
1.1 PCR amplification
Design of primers
DCase-F1:CGGGATCC GCTCGTCAGATGATATTCGCAG
DCase-R1:CTTACGATACTTGCCGACGATCTTG
DCase-F2:CAAGATCGTCGGCAAGTATCGTAAG
DCase-R2:GAGATGGTGGAAGGACGTCAGGTGG
DCase-F3:CCACCTGACGTCCTTCCACCATCTC
DCase-R3:CCCAAGCTTGAGTTCCGCGATCAGACC
Using pET28a-DCase plasmid as template, PCR amplification is carried out using primer DCase-F1 and DCase-R3.Expand body
System: 2 × PCR mix, 10 μ l, dd H28 μ l of O, template DNA 1 μ l (about 50ng-200ng), each 0.5 μ l of upstream and downstream primer are (dense
Degree is 20 μM).
PCR reaction condition are as follows: 96 DEG C, 2min initial denaturation；96 DEG C, 1min denaturation, 50 DEG C, 30s annealing, 72 DEG C of extension 1min
(30 circulations)；Last 72 DEG C of extensions 5min is saved at 4 DEG C.
1.2 carbamyls containing N--D-pHPG hydrolase plasmid construction
After PCR amplification, electrophoresis first is carried out using 1% Ago-Gel, voltage is 120 volts, after rubber tapping, is returned with glue
The target DNA fragment for receiving kit (Beijing CoWin Bioscience Co., Ltd.) recycling 900bp or so, then uses BamHI
Double digestion is carried out with HindIII, DNA fragmentation obtained is connected to (precious bioengineering Co., Ltd) with carrier pET-28a, it
Link product is transformed into escherichia coli DH5a competent cell (Beijing Quanshijin Biotechnology Co., Ltd) afterwards, blocks that containing
It is screened on the LB plate of mycin antibiotic.
Recon carries out double digestion verifying with restriction enzyme BamHI and HindIII.Digestion products carry out voltage herein
For 120 volts of agarose gel electrophoresis, verifying clip size is respectively the segment of 900bp or so and the carrier of 5300bp or so.
1.3 expression N- carbamyl-D-pHPG hydrolase construction method of gene engineering strain
Recon plasmid is extracted with plasmid extraction kit (Beijing CoWin Bioscience Co., Ltd.), then by normal
Rule method is transformed into E.coli BL21 (Beijing Quanshijin Biotechnology Co., Ltd), i.e. acquisition N- carbamyl hydrolysis enzyme gene
Colibacillus engineering.
Embodiment 2, N- carbamyl-D-pHPG hydrolase expressing gene orthomutation
2.1 design of primers
DCase-F1:CGGGATCC GCTCGTCAGATGATATTCGCAG
DCase-R1:CTTACGATACTTGCCGACGATCTTG
DCase-F2:CAAGATCGTCGGCAAGTATCGTAAG
DCase-R2:GAGATGGTGGAAGGACGTCAGGTGG
DCase-F3:CCACCTGACGTCCTTCCACCATCTC
DCase-R3:CCCAAGCTTGAGTTCCGCGATCAGACC
Using pET28a-DCase recon as template, fallibility PCR amplification is carried out with primer DCase-F2 and DCase-R2, easily
Wrong PCR reaction system (50ul): templet gene 20ng, upper and lower primer each 300pmol, dATP0.2mm, dGTP0.2mm,
DCTP1mm, dTTP1mm, MgCl27mm, MnCl20.1mm, Taq enzyme 2.5U (Tiangeng biochemical technology Co., Ltd).
PCR condition are as follows: 96 DEG C, 5min initial denaturation；96 DEG C, 30s denaturation, 50 DEG C, 30s annealing, 72 DEG C extension 30s (30
Circulation)；Last 72 DEG C of extensions 5min is saved at 4 DEG C.
2.2 carbamyls containing N--D-pHPG hydrolysis enzyme mutant gene plasmid construction
After PCR amplification, electrophoresis first is carried out using 1% Ago-Gel, voltage is 120 volts, after rubber tapping, is returned with glue
The target DNA fragment for receiving kit (Beijing CoWin Bioscience Co., Ltd.) recycling 400bp or so, will be obtained
DNA fragmentation connects (precious bioengineering Co., Ltd) with carrier pMD18-T carrier, and link product is transformed into Escherichia coli later
DH5a competent cell (Beijing Quanshijin Biotechnology Co., Ltd) screens on LB plate with ampicillin.Later
Picking single colonie, determines mutation rate.
The building of 2.3 N- carbamyls-D-pHPG hydrolase mutation library
Using pET28a-DCase recon as template, respectively with primer DCase-F1, DCase-R1 and DCase-F3,
DCase-R3 carries out PCR amplification, PCR reaction system (50ul): templet gene 20ng, upper and lower each 300pmol of primer,
MgSO41mm, KOD-PlUS polymerase 1U (Toyobo company).
PCR condition are as follows: 95 DEG C, 5min initial denaturation；95 DEG C, 30s denaturation, 54 DEG C, 30s annealing, 68 DEG C extension 30s (30
Circulation)；Last 68 DEG C of extensions 5min is saved at 4 DEG C.
Using the PCR result of three sections of genes as hybrid template, PCR amplification, PCR are carried out with primer DCase-F1 and DCase-R3
Amplification system are as follows: templet gene 20ng, upper and lower each 300pmol of primer, MgSO4(Toyobo is public by 1mm, KOD-PlUS polymerase 1U
Department).
PCR condition are as follows: 95 DEG C, 5min initial denaturation；95 DEG C, 30s denaturation, 54 DEG C, 30s annealing, 68 DEG C extension 1min (30
Circulation)；Last 68 DEG C of extensions 5min is saved at 4 DEG C.
2.4 carbamyls containing N--D-pHPG hydrolysis enzyme mutant gene plasmid construction
After PCR amplification, electrophoresis first is carried out using 1% Ago-Gel, voltage is 120 volts, after rubber tapping, is returned with glue
The target DNA fragment for receiving kit (Beijing CoWin Bioscience Co., Ltd.) recycling 900bp or so, then uses BamHI
Double digestion is carried out with HindIII, DNA fragmentation obtained is connected to (precious bioengineering Co., Ltd) with carrier pET-28a, it
Link product is transformed into escherichia coli DH5a competent cell (Beijing Quanshijin Biotechnology Co., Ltd) afterwards, blocks that containing
It is screened on the LB plate of mycin antibiotic.
Recon carries out double digestion verifying with restriction enzyme BamHI and HindIII.Digestion products carry out voltage herein
For 120 volts of agarose gel electrophoresis, verifying clip size is respectively the segment of 900bp or so and the carrier of 5300bp or so.
The screening of embodiment 3, N- carbamyl-D-pHPG hydrolase mutation library
The building of 3.1 carbamyls containing N--D-pHPG hydrolase mutation library engineering bacteria
Recon plasmid is extracted with plasmid extraction kit (Beijing CoWin Bioscience Co., Ltd.), then by normal
Rule method is transformed into E.coli BL21 (Beijing Quanshijin Biotechnology Co., Ltd), and transformed cells are applied to the antibiotic of benzyl containing ammonia
LB plate (tryptone 1%, yeast extract 0.5%, sodium chloride 1%, agar 1.5%) on, 37 DEG C culture.
3.2 N- carbamyls-D-pHPG hydrolysis enzyme mutant screening and identification
Picking single colonie is incubated on 96 orifice plates containing 200ul that antibiotic (50ug/ml) containing card, when OD600 reaches 0.6
When, 1MIPTG, which is added, makes its final concentration of 0.2mM, 18 DEG C of overnight incubations.
Every hole is taken out on 150ul bacterium solution and 96 orifice plates, places -80 DEG C, is freezed 1.5h, is subsequently placed with thaw at RT 1h.
It takes the bacterium solution 20ul to have thawed to be transferred in 96 orifice plates, carries out anti-oxidant (hydrogen peroxide final concentration 2mM processing respectively
20min, 25 DEG C) and high temperature resistant (65 DEG C of processing 30min) processing.
200ul reaction solution (5g/L N- carbamyl-D-pHPG, 1mM are added in the bacterium solution handled well
EDTA's and 0.01% phenol red, PH5.0) it is sufficiently mixed, respectively with the N- carbamyl hydrolysis enzyme and ddH not handled2O is as positive
With negative control, 37 DEG C of incubation 30min occur color from faint yellow and become red as positive bacterium colony.
3.3 the selection result
By above-mentioned screening, the mutant that we obtain five recombinant protein inoxidizability altogether and thermal stability improves leads to
Sequencing is crossed, it is found that their mutational site is C193N, T200A, N226Y, C243N and C250Y respectively.Particular content is shown in Table 1:
The result of amino acid sequence and the gene order variation of 1 five DCase mutant of table
| Number | Amino acid position | Amino acid variation | Nucleotide position | Nucleotide variation |
| C193N | 193rd | Cysteine → asparagine | 577bp~579bp | TGC→AAT |
| T200A | 200th | Threonine → alanine | 598bp~600bp | ACC→GCT |
| N226Y | 226th | Asparagine → tyrosine | 676bp~678bp | AAC→TAT |
| C243N | 243rd | Cysteine → asparagine | 727bp~729bp | TGC→AAC |
| C250Y | 250th | Cysteine → tyrosine | 748bp~750bp | TGC→TAT |
Embodiment 4, the comparison for being mutated recombinase and unmutated enzyme inoxidizability and heat-resisting quantity
The enrichment of 4.1 destination proteins
The bacterium solution in case study on implementation 3.2 is transferred in LB liquid medium respectively and carries out seed culture, to seed maturation
It is forwarded in 200mlLB (blocking that antibiotic final concentration 50ug/ml) culture medium by 4% inoculum concentration, then monitors in real time afterwards
OD600, when OD600 to 0.6,1MIPTG, which is added, makes its final concentration of 0.2mM, 18 DEG C of inducing expression 14h.
The preparation of 4.2 thick enzymes
4.1 gained bacterium solutions are subjected to centrifugal treating, remove supernatant.It is resuspended with the phosphate buffer of 100mM, PH7.5, in
High-pressure homogeneous broken instrument (U.S. PHD) is crushed.Crude enzyme liquid and 4 DEG C will be obtained, 13000rpm/min is centrifuged 30min, takes
Clearly, be placed in 4 DEG C it is spare.
The anti-oxidant treatment and heat treatment of 4.3 crude enzyme liquids
It is taken in 4.2 in crude enzyme liquid 500ul obtained and 1.5ml centrifuge tube respectively, in quintuplicate, while doing three groups of realities in parallel
It tests.
Processing one: in centrifuge tube, sequentially adding hydrogen peroxide makes its final concentration of 1mM, 2mM, 3mM, 4mM, 5mM, processing
After 1h, 4 DEG C of placement is spare.Concrete outcome is shown in Table 2:
The enzyme activity situation of DCase and mutant enzyme after dioxygen water process of table 2 compares
Processing two: resulting enzyme solution is placed in 65 DEG C of metal bath (Beijing Kang Run Cheng Ye Biotechnology Co., Ltd) and is divided
0min, 30min, 60min, 90min, 120min are managed in other places, and 4 DEG C of placement is spare later.Concrete outcome is shown in Table 3:
The enzyme activity situation of DCase and mutant enzyme after 65 DEG C of high-temperature process of table 3 compares
The reaction of 4.4 enzymatic hydrolysis
Crude enzyme liquid 500ul processed in 4.3 is added to the sweet ammonia of N- carbamyl-D- para hydroxybenzene of the 100mM of 400ul
Acid, is hydrolyzed reaction, and 37 DEG C, 200rpm.After 30min, 10% hydrochloric acid that 500ul is added terminates reaction.
4.5, the measurement of enzyme activity
After reactant in 4.4 is diluted 3 times, 13000rpm/min is centrifuged 10min, and supernatant is taken to carry out high performance liquid chromatography
Detection.
HPLC measuring method is as follows: methanol (contain 0.01%TFA) and water (containing 0.01%TFA) are mobile phase, ratio 5:
95, flow velocity 1.0ml/min, Detection wavelength 267nm.Detect different material peak area and retention time and same substance not
Same peak area, while standard curve is drawn, the absolute figure of sample enzyme activity is then calculated according to the standard performance number of measurement.
Enzyme amount needed for 1U enzyme activity is defined as 1 minute generation 1umol D-pHPG.
Enzyme activity ÷ enzyme of the remaining enzyme activity calculation formula=enzyme after anti-oxidant or high-temperature process is after zero degree heat preservation
Enzyme activity × 100%.
Compared by above-mentioned data it can be found that compared to wild enzyme, N- carbamyl-D-pHPG hydrolase
Mutant to oxygen tolerance, to the tolerance and enzyme activity of soda acid in terms of have very big promotion.
Above-described embodiment shows that 5 mutant enzymes of N- carbamyl-D-pHPG hydrolase are in solubility expression
It is better than wild type with unit thallus enzyme activity aspect, is further showed that simultaneously, N- carbamyl-D-pHPG hydrolysis
The mutant of enzyme has very big application potential in the production of D-pHPG.Therefore, using qualitative evolution technology
It is a highly effective means that industrial enzymes, which are transformed,.
It should be understood by those skilled in the art that foregoing description and the embodiment of the present invention shown in the drawings are only used as illustrating
And it is not intended to limit the present invention.The purpose of the present invention has been fully and effectively achieved.Function and structural principle of the invention exists
It shows and illustrates in embodiment, under without departing from the principle, embodiments of the present invention can have any deformation or modification.
Claims (10)
1. a kind of mutant of N- carbamyl-D-pHPG hydrolase, which is characterized in that the ammonia of the mutant
Base acid sequence is made of following described in any item amino acid sequences:
The 193rd cysteine mutation is day in N- carbamyl-D-pHPG hydrolase amino acid sequence
Winter amide；
The 200th threonine sports the third ammonia in N- carbamyl-D-pHPG hydrolase amino acid sequence
Acid；
The 226th asparagine mutation is junket in N- carbamyl-D-pHPG hydrolase amino acid sequence
Propylhomoserin；
The 243rd cysteine mutation is day in N- carbamyl-D-pHPG hydrolase amino acid sequence
Winter amide；
The 250th cysteine mutation is junket in N- carbamyl-D-pHPG hydrolase amino acid sequence
Propylhomoserin；
Wherein the amino acid sequence of the N- carbamyl-D-pHPG hydrolase is as shown in SEQ ID NO.2
N- carbamyl-D-pHPG hydrolase sequences.
2. a kind of encode N- carbamyl described in claim 1-D-pHPG hydrolysis enzyme mutant DNA sequence
Column.
3. DNA sequence according to claim 2, which is characterized in that by following described in any item DNA sequence groups
At:
A, 577bp in N- carbamyl-D-pHPG hydrolase gene order shown in SEQ ID NO.1~
The TGC of 579bp sports AAT；
B, 598bp in N- carbamyl-D-pHPG hydrolase gene order shown in SEQ ID NO.1~
The ACC of 600bp sports GCT；
C, 676bp in N- carbamyl-D-pHPG hydrolase gene order shown in SEQ ID NO.1~
The AAC of 678bp sports TAT；
D, 727bp in N- carbamyl-D-pHPG hydrolase gene order shown in SEQ ID NO.1~
The TGC of 729bp sports AAC；
E, 748bp in N- carbamyl-D-pHPG hydrolase gene order shown in SEQ ID NO.1~
The TGC of 750bp sports TAT.
4. a kind of recombinant plasmid, which is characterized in that the recombinant plasmid clone has N- carbamyl-D- as described in claim 1
The coded sequence of the mutant of D-pHPG hydrolase.
5. a kind of genetic engineering bacterium, which is characterized in that the genetic engineering bacterium is to turn recombinant plasmid described in claim 4
It dissolves into host cell and obtains.
6. N- carbamyl according to claim 1-D-pHPG hydrolysis enzyme mutant is in D- para hydroxybenzene
Application in glycine production.
7. N- carbamyl according to claim 2-D-pHPG hydrolysis enzyme mutant encoding gene is in D-
Application in D-pHPG production.
8. application of the recombinant plasmid according to claim 4 in D-pHPG production.
9. application of the engineering bacteria according to claim 5 in D-pHPG production.
10. application according to claim 7, which is characterized in that DNA sequence as claimed in claim 2 to be cloned into
Host cell, and the fermentation thalli of the host cell is used for the production of D-pHPG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510457039.0A CN106011117B (en) | 2015-07-30 | 2015-07-30 | The building of N- carbamyl-D-pHPG hydrolysis enzyme mutant and its engineering bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510457039.0A CN106011117B (en) | 2015-07-30 | 2015-07-30 | The building of N- carbamyl-D-pHPG hydrolysis enzyme mutant and its engineering bacteria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106011117A CN106011117A (en) | 2016-10-12 |
| CN106011117B true CN106011117B (en) | 2019-06-18 |
Family
ID=57082576
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510457039.0A Active CN106011117B (en) | 2015-07-30 | 2015-07-30 | The building of N- carbamyl-D-pHPG hydrolysis enzyme mutant and its engineering bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106011117B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115772513A (en) * | 2020-05-08 | 2023-03-10 | 江南大学 | D-carbamyl hydrolase mutant, gene, expression vector and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1995336A (en) * | 2006-01-06 | 2007-07-11 | 中国科学院上海生命科学研究院 | D-carboxamide hydrolase mutant and its uses |
| CN101544969A (en) * | 2008-03-25 | 2009-09-30 | 中国科学院上海生命科学研究院 | Mutant of D-carbamyl hydrolysis enzyme and application thereof |
| CN102146365A (en) * | 2010-02-08 | 2011-08-10 | 中国科学院上海生命科学研究院 | D-carbamoyl hydrolase mutant |
| CN102747060A (en) * | 2011-04-22 | 2012-10-24 | 中国科学院上海生命科学研究院 | Mutant of D-carbamoylase and its preparation method and application |
-
2015
- 2015-07-30 CN CN201510457039.0A patent/CN106011117B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1995336A (en) * | 2006-01-06 | 2007-07-11 | 中国科学院上海生命科学研究院 | D-carboxamide hydrolase mutant and its uses |
| CN101544969A (en) * | 2008-03-25 | 2009-09-30 | 中国科学院上海生命科学研究院 | Mutant of D-carbamyl hydrolysis enzyme and application thereof |
| CN102146365A (en) * | 2010-02-08 | 2011-08-10 | 中国科学院上海生命科学研究院 | D-carbamoyl hydrolase mutant |
| CN102747060A (en) * | 2011-04-22 | 2012-10-24 | 中国科学院上海生命科学研究院 | Mutant of D-carbamoylase and its preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106011117A (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103789292B (en) | A kind of lysine decarboxylase, preparation method and application thereof | |
| RU2460789C2 (en) | New hydrogenase seq id no:5 purified from thermococcus onnurienus na1 with help of carbon monoxide, genes coding it, and methods for producing hydrogen with use of microorganism having said genes | |
| CN105543193B (en) | A kind of N- acyl-homoserine lactonase and its encoding gene and recombinant bacterium | |
| CN102154188B (en) | nfi-gene-knocked-out mutant strain of escherichia coli DH5 alpha as well as preparation method and application thereof | |
| CN107099545A (en) | A kind of alginate lyase gene and its application | |
| CN112941089B (en) | Alginate lyase mutant gene, alginate lyase mutant, engineering bacterium containing mutant, construction method and application | |
| CN109777793B (en) | GDSL lipase, genetically engineered bacterium and application thereof | |
| WO2022134236A1 (en) | Alkaline protease mutant, gene thereof, engineering bacteria thereof, preparation method therefor and use thereof | |
| CN107828806A (en) | A kind of β alpha-glucosidase genes of new resistance to glucose and its application | |
| CN107200772A (en) | A kind of signal peptide for optimizing keratinase Ker efficient secretory expressions and its application | |
| CN111690585B (en) | recombinant serratia marcescens with rcsB gene deletion and application thereof | |
| CN111269907A (en) | Alginate lyase mutant based on loop region transformation and application thereof | |
| CN103614398A (en) | Coding gene of cis-form epoxy succinic acid hydrolase, polypeptides coded thereby and related applications | |
| CN106755044A (en) | Highly effective hydrogen yield functional gene carrier pET32a fdhF and its structure and application | |
| CN105018443A (en) | Epoxide hydrolase mutant and preparation method thereof | |
| CN110643622A (en) | Alginate lyase gene and application thereof | |
| CN106011117B (en) | The building of N- carbamyl-D-pHPG hydrolysis enzyme mutant and its engineering bacteria | |
| CN104480127B (en) | Hyperthermophilic glucosides enzyme mutant and its application in prepared by Ginsenoside compound K | |
| Khan et al. | Calcium carbonate precipitation by rock dwelling bacteria in Murree Hills, Lower Himalaya Range Pakistan | |
| CN108018276A (en) | A kind of deep-sea bacterium keratinase and its encoding gene, zymoprotein production engineering bacterium and application | |
| US11555193B1 (en) | Gene ANSB knockout mutant of citrobacter werkmanii and application thereof | |
| CN106632625A (en) | Application of protein PGR5 to regulation and control of algae oxidation resistance | |
| CN109182319A (en) | A kind of threonine deaminase mutant and its preparation method and application | |
| CN105602914B (en) | It is a kind of from the alkyl peroxide reductase and thioredoxin reductase of kluyveromyces marxianus and its application | |
| CN114149934B (en) | Protein glutaminase production strain, screening and characteristic analysis method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |