CN105969781B - A kind of carotenogenesis approach violaxanthin decyclization oxidase gene and application - Google Patents
A kind of carotenogenesis approach violaxanthin decyclization oxidase gene and application Download PDFInfo
- Publication number
- CN105969781B CN105969781B CN201610585328.3A CN201610585328A CN105969781B CN 105969781 B CN105969781 B CN 105969781B CN 201610585328 A CN201610585328 A CN 201610585328A CN 105969781 B CN105969781 B CN 105969781B
- Authority
- CN
- China
- Prior art keywords
- marigold
- gene
- lutein
- violaxanthin
- tevde1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0055—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y110/00—Oxidoreductases acting on diphenols and related substances as donors (1.10)
- C12Y110/99—Oxidoreductases acting on diphenols and related substances as donors (1.10) with other acceptors (1.10.99)
- C12Y110/99003—Violaxanthin de-epoxidase (1.10.99.3)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Nutrition Science (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of marigold carotenogenesis approach violaxanthin decyclization oxidase gene Tagetes erecta violaxanthin de-epoxidase (TeVDE1), are characterized in its nucleotide sequence as shown in SEQ ID NO:1 in sequence table；Its amino acid sequence is as shown in SEQ ID NO:2 in sequence table.Clone obtains TeVDE1 gene in marigold petal tissue.Real-time quantitative analysis and lutein content measurement result show that TeVDE1 gene expression quantity in marigold bud is higher, and expression is related to lutein content.The SEQ ID NO:1 gene has effect in terms of lutein dynamic accumulation, and the present invention clones carotenogenesis approach violaxanthin decyclization oxidase gene from marigold with pigment can be used in improving the carotenoid pigments contents such as lutein.
Description
Technical field
The invention belongs to genetically engineered plant technical fields, and in particular to clone carotenoid from marigold with pigment and close
At approach violaxanthin decyclization oxidase gene TeVDE1, nucleotide sequence, the protein sequence of the gene, and existed using the gene
Improve the application in Carotenoid in Plants dynamic accumulation.
Background technique
It is introduced according to " northern gardening " (the 1st 44-46 pages of phase in 2007), marigold (Tagetes erecta L.) is composite family
1 year raw herbaceous plant of Tagetes originates in the ground such as America Mexico, because its spend flower-shape is big, bright and colourful, plant is adaptable,
It is with short production cycle, it is introduced a fine variety extensively all over the world at present.It can extract a variety of secondary metabolites in marigold flower.In petal
Uranidin be mainly lutein ester, lutein and other micro carotenoid.Marigold petal can be made into 4 kinds of forms
Commodity: flower dry powder, marigold oil resin, lutein rouge and lutein, marigold are increasingly becoming with broad mass market prospect
Flowers.It is introduced according to " Food Additives Used in China " (the 3rd 238-239 pages of phase in 2012), the pigment ten thousand planted for extracting pigment
Shou Ju increases year by year in China's cultivated area, and China is world Xanthophylls from Marigold main product at present, and marigold has become one kind
Plant resources with good economic value.
It is introduced according to " foreign medical science medical geography fascicle " (the 1st 51-52 pages of phase in 2011), lutein belongs to carotenoid
Class pigment is the primary pigments for causing marigold petal that yellowish orange is presented, accounts for the 90% of petal pigment.Lutein is in marigold etc.
Mainly exist in the form of rouge in plant.Human body cannot synthesize lutein but can use lutein ester, convert it in vivo
As free lutein.It is also difficult to use chemical method since lutein cannot be synthesized in human body, while because there are many isomers for it
Synthesis, needs to extract from natural plants.Although lutein is generally existing in various fruits and vegetables, content is atomic
Few, diet takes the photograph people's deficiency.Thus the marigold rich in this ingredient becomes the important plant resources for extracting natural carotenol.
Lutein is bright in colour, and the lutein of high-content can be used not only as natural colorants pigment, also has nutritive value abundant and medicine
With value.Nineteen ninety-five Food and Drug Adminstration of the US (Food and Drug Administration) approval using lutein as
Food supplement, the multiple disease of prevention retina Huang, alleviates the senile blurring of image.Meanwhile lutein can also enhance immunity of organism
Power prevents the generation and development of cardiovascular disease and cancer.So lutein is in medicine, food, poultry cultivation, change
It is widely applied in cosmetic, can be used for coated tablet, the coloring of capsule, health drink coloring, feed addition, or make with lutein ester
For major ingredient, hard capsule, soft capsule, tablet, oral solution etc. is made.It is situated between according to " Xinjiang Farm Economy " (the 6th 52-55 pages of phase in 2012)
It continues, although the expensive title for having " soft gold " of lutein, both at home and abroad still increases the demand of lutein year by year.China is
Marigold with pigment main product, and due to more external starting evening, corresponding research and industrialization still in its infancy, except it is a small amount of from
With outer, 95% or more domestic marigold extractum exports to foreign countries, and overwhelming majority lutein product and seed needed for the country rely on
Import.
In terms of basic research, China's marigold Advances in Breeding is slow, and American-European kind can really be substituted by not yet selecting
On the one hand new varieties, main cause are genetic resources scarcities, understood seldom existing genetic resources.According to " northwest
Agriculture journal " (the 5th 174-178 pages of phase in 2012) introduction, show lutein content character with master the genetic analysis of marigold
Based on gene genetic effect, supplemented by multigentic effect.Lutein is the oxygen-containing polyterpene substance in carotenoid.In plant
Interior, synthesis precursor isopentenyl pyrophosphate generates phytoene through repeatedly condensation, then through dehydrogenation, cyclisation, hydroxylating, epoxy
Change etc. is changed into other carotenoid, and whole process is completed by a variety of enzymatics.Pass through arabidopsis, tomato isotype plant
Research has more understanding, discovery phytoene synthesis to these Carotenoid biosynthetic pathway genes
Enzyme (phytoene synthase, PSY), phytoene desaturase (phytoene desaturase, PDS), tomato
Red pigment cyclase (1ycopene cyclase, LYC), carrotene desaturase (carotene desaturase, ZDS), purple
Yellow matter Violaxanthin De (violaxanthin de-epoxidase, VDE) etc. is in the accumulation of the carotenogenesis such as lutein
It plays a significant role.But as the marigold of the important plant origin of lutein, some important genes of lutein route of synthesis
Not yet clone and separate.It will can be used for screening using these genes and cultivate high pigment content plant resources, and meet the neck such as food, medicine
Domain demand.
Summary of the invention
The purpose of the present invention is to provide a kind of carotenogenesis approach violaxanthins cloned from marigold with pigment
Violaxanthin De gene TeVDE1, nucleotide sequence, the protein sequence of the gene, and plant is being improved using the gene
Application in carrotene dynamic accumulation.
The present invention clones carotenogenesis approach violaxanthin decyclization oxidase gene from marigold with pigment, is named as
Tagetes erecta violaxanthin de-epoxidase (abbreviation TeVDE1)；In its nucleotide sequence such as sequence table
Shown in SEQ ID NO:1, the amino acid sequence of coded albumen is as shown in SEQ ID NO:2 in sequence table.
The present invention carries out the clone of carotenogenesis approach violaxanthin decyclization oxidase gene from marigold with pigment:
Data assembling is carried out to TeVDE1 gene according to the high-throughput transcript profile deep sequencing to marigold with pigment；Then it is set using primer
It counts software Primer Premier 5.0 and designs 2 pairs of nest-type PRC special primers, total serum IgE, reverse transcription are extracted from marigold petal
PCR (reverse transcription-PCR, RT-PCR) clone obtains TeVDE1 gene.
The use for the carotenogenesis approach violaxanthin decyclization oxidase gene that the present invention is cloned from marigold with pigment
On the way, by aztec marigold leaf, the real-time quantitative analysis and lutein content measurement result of different development stage flower tissue, show this hair
The bright SEQ ID NO:1 gene has effect in terms of carotenoid pigment dynamic accumulation, can be used in improving lutein
Equal carotenoid pigments content.
Beneficial effect of the present invention from marigold with pigment clone's carotenogenesis approach violaxanthin decyclization oxidase gene
Fruit is: providing a kind of new genetic resources to improve the carotenoid pigments contents such as lutein in plant, can be used for height
Screening, cultivation and the improvement of pigment nutritional quality vegetable material.
Detailed description of the invention
Fig. 1 is the leaf, bud, the mature quantitative expression and leaf for spending middle TeVDE1 gene of marigold with pigment cultivar chrysanthemum king
Flavine assay result.
Specific embodiment
By embodiment, invention is further described in detail with reference to the accompanying drawing.
It is all that specific experiment condition is not specified in following embodiments, it is according to routine well known to those skilled in the art
Condition, such as the molecular cloning of Sambrook Russell: laboratory manual (New York:Cold Spring Harbor
Laboratory Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.
Embodiment 1: marigold high throughput transcript profile sequencing
Since marigold genome not yet measures, to obtain marigold functional gene transcript sequence, ten thousand longevity of pigment is utilized
Chrysanthemum cultivar chrysanthemum king's tissue sample is carried out high by extracting the blade, bud, mature each 1 part of RNA of flower of three single plants respectively
Flux transcript profile sequencing and assembling annotate.
1, reagent
Plant RNA extraction reagent Trizol is purchased from Invitrogen company, and DNA enzymatic I (Dnase I) is purchased from Takara public affairs
Department, the library RNA reagent preparation box (RNA Library Prep Kit) are purchased from Beijing Biomarker Technologies Co., Ltd., remaining
Reagent is import packing or domestic analysis net product.
2, vegetable material
Marigold with pigment (Tagetes erecta L.) cultivar chrysanthemum king is bred by Xin Hui gardening company, Chifeng and is provided.
3, method
3.1RNA extracting
1) it is crushed 100mg plant tissue using liquid nitrogen grinding method, moved in 1.5mL centrifuge tube, 1ml Trizol is added, it is acute
Violent shock is swung, and is placed at room temperature for 5min；
2) 200 μ L chloroforms are added in centrifuge tube, oscillation 30s is mixed, and is placed at room temperature for 5min；
3) 4 DEG C, 12000rpm is centrifuged 15min, and RNA is located at supernatant, and downside organic phase contains the impurity such as chlorophyll；
4) 700 μ L of supernatant is moved in 1.5mL centrifuge tube, lower layer's organic phase and middle layer have protein miscellaneous with other
Matter avoids touching absorption；
5) isometric isopropanol is added in supernatant, mixes, is placed at room temperature for 10min；
6) 4 DEG C, 12000rpm is centrifuged 15min, abandons supernatant, and RNA is sunken to tube bottom；
7) 70% ethyl alcohol of 1mL is added, mildly vibrates centrifuge tube, suspend precipitating；
8) 4 DEG C, 12000rpm is centrifuged 5min, abandons supernatant；
9) drying at room temperature 5-10min；
10) 50 μ L are added without RNA enzyme water (RNase-free H2O), RNA is dissolved；
11) 50 μ g of RNA is taken according to RNA solution concentration, be added 5 μ L 10X buffers (400mM Tris-HCL, pH 7.5,
80mM MgCl2, 50mM), 5 μ L Dnase I, 2 μ L RNase inhibitors, 37 DEG C of reaction 30min；
12) 2.5 μ L 0.5M EDTA are added, 80 DEG C, 2min inactivates Dnase；
13) ethyl alcohol of 10 μ L 3M sodium acetates and 250 μ L pre-cooling, -80 DEG C of placement 20min are added；
14) 4 DEG C, 12000rpm is centrifuged 10min, abandons supernatant；
15) 70% ethyl alcohol of 1mL is added and cleans RNA；
16) 4 DEG C, 12000rpm is centrifuged 5min, abandons supernatant；
17) drying at room temperature 5-10min；
18) 50 μ L are added without RNA enzyme water, dissolve RNA；
19) purity, the concentration of RNA sample are detected.
3.2 transcript profiles sequencing assembling and annotation
Transcript profile sequencing utilizes RNA Library Prep Kit, passes through Beijing Biomarker Technologies Co., Ltd.
Illumina HiSeq high-flux sequence platform, sequentially includes the following steps:
1) with the enrichment with magnetic bead eucaryote RNA with Oligo (dt), mRNA is interrupted at random；
2) using mRNA as template, first cDNA chain is synthesized with hexabasic base random primer, dNTPs, RNA enzyme H is then added
Article 2 cDNA chain is synthesized with DNA polymerase i, purifies cDNA using microballon (beads)；
3) the double-strand cDNA purified carries out end reparation again, and connects sequence measuring joints, then carries out clip size with microballon
Selection, is enriched with to obtain cDNA library by PCR；
4) concentration to library and Insert Fragment size detect；
5) cDNA library is sequenced using Illumina HiSeq high-flux sequence platform, sequencing reading length PE125；
6) sequencing fragment (reads) is amputated into sequence measuring joints, primer sequence, after filtering low quality value data, obtained high-quality
The sequencing data of amount；
7) high quality sequencing read is extended into longer segment (contig) using Trinity composite software, and utilized
Overlapping between these segments obtains set of segments (component), is finally transcribed using the method for De Bruijn
This sequence (unigene)；
8) use BLAST software by transcript sequence (unigene) and NR (NCBI non-redundant database), Swiss-Prot
(European Bioinformatics research institute maintenance database), GO (Gene Ontology), COG (Clusters of
Orthologous Groups)、KOG(euKaryotic Orthologous Groups)、KEGG(KyotoEncyclopedia
Of Genes and Genomes) database comparison；
9) using TransDecoder software carry out unigene coding region sequence and its orresponding amino acid sequence it is pre-
It surveys, is compared using HMMER software and Pfam (Protein family) database, obtain the annotation information of unigene.
4. result
It marigold organization material is subjected to RNA extraction, builds library, high-throughput transcript profile deep sequencing by above-mentioned, it is then right
Sequencing sequence carries out assembling and Gene correlation, obtains marigold Analysis of Violaxanthin De-Epoxidase Tagetes
The speculated sequence of erectaviolaxanthin de-epoxidase (TeVDE1) gene.
Embodiment 2: the clone of marigold TeVDE1 gene
According to embodiment 1 to the data assembling of marigold violaxanthin decyclization oxidase gene TeVDE1, design of primers is utilized
Software Primer Premier 5.0 designs PCR special primer, and total serum IgE, reverse transcription PCR are extracted from marigold petal
(reverse transcription-PCR, RT-PCR) clone obtains TeVDE1 gene.
1, reagent
Plant RNA extraction reagent Trizol is purchased from Invitrogen company, and DNA enzymatic I (Dnase I) is purchased from Takara public affairs
Department；Reverse transcriptase (TransScript Reverse Transcriptase) is purchased from Beijing Quanshijin Biotechnology Co., Ltd；
High-fidelity DNA polymerase PrimeStar is purchased from TaKaRa company；Cloning vector pEASY-Blunt SimpleCloning
Vector is purchased from Beijing Quanshijin Biotechnology Co., Ltd；Primer is synthesized by Invitrogen (Shanghai) Trading Co., Ltd.,
Remaining reagent is import packing or domestic analysis net product.
2, coli strain and vegetable material
Escherichia coli (Escherichia coli) bacterial strain DH5 α is purchased from Beijing Quanshijin Biotechnology Co., Ltd；Pigment
Marigold (Tagetes erecta L.) cultivar chrysanthemum king seed is bred by Xin Hui gardening company, Chifeng and is provided.
3, culture medium and solution
LB culture medium: tryptone 10g/L, yeast powder 5g/L, NaCl 10g/L.With NaOH tune pH to 7.0, high pressure is gone out
Bacterium.
SOB culture medium: tryptone 20g/L, yeast powder 5g/L, NaCl 0.58g/L, KCl 0.19g/L, 100 × Mg2+
10mL.With NaOH tune pH to 7.0, high pressure sterilization.
SOC culture medium: method adds the 1mol/L glucose of 2mL filtration sterilization with the preparation of above-mentioned SOB culture medium.
100×Mg2+Solution: 20.33g MgCl2.6H2O and 24.65g MgSO4.7H2O constant volume is in 100mL H2O, high pressure
Sterilizing.
4, method
4.1 marigold maturations flower tissue RNA is extracted
Operating procedure carries out as described in 3.1 in embodiment 1.
4.2RT-PCR
4.2.1RT
1) 1 μ g total serum IgE and 1 μ L polyT are taken18(10 μM) primer mixing, with RNase-free ddH2O is supplied to 12.75 μ
L is mixed gently；
2) 65 DEG C of heat preservation 5min, are immediately transferred into ice bath, place 2min；
3) 5 × reaction buffer, 4 μ L, 10mM dNTP, 2 μ L, RNA inhibitor, 0.25 μ L (40U/ μ L) is added,
1 μ L of TransScript Reverse Transcriptase reverse transcriptase (100U/ μ L), 42 DEG C of 1h synthesize the first chain cDNA；
4) 95 DEG C of heating 5min inactivate reverse transcriptase, terminate reaction.
4.2.2PCR
According to the TeVDE1 gene speculated sequence of acquisition described in embodiment 1, set using 5.0 software of Primer Premier
It is as follows to count primer sequence:
TeVDE1F1:5’ACTTGGTGTCTTCCACTCATTTC 3’
TeVDE1R1:5’ATGTTCGATTCGAGTTTGTTAA 3’
TeVDE1F2:5’ATGACCACCTTCGTGAATCTC 3’
TeVDE1R2:5’CACATAAATCAGGCATCACTTG 3’
The cDNA for taking the obtained marigold maturation flower of 4.2.1, carries out the clone of TeVDE1 gene.200 μ L EP pipes are placed in
On ice, reagent is added:
It is expanded by following procedure: 98 DEG C of 2min (initial denaturation)；98 DEG C of 10s (denaturation), 55 DEG C of 20s (renaturation), 72 DEG C
90s (extension), the denaturation renaturation-extension 30 circulations；72 DEG C of 5min (overall elongation).
Using above-mentioned PCR product as template, the second wheel PCR, renaturation temperature 56 are carried out with primer TeVDE1F2 and TeVDE1R2
DEG C, other conditions are same as above.
By aforesaid operations, TeVDE1 gene PCR amplified production is obtained.
4.3 High fidelity PCR products are connect with cloning vector pEASY-Blunt
It will be by the TeVDE1 gene PCR amplified production of above-mentioned 4.2 acquisitions and cloning vector pEASY-Blunt
Simple Cloning Vector presses mole molecular number ratio 1:4 connection (25 DEG C, 15min), and linked system is as follows:
pEASY-Blunt Simple Cloning Vector(50μg/μL) 4μL
PCR product (~150 μ g/ μ L) 1 μ L
The conversion of 4.4 Escherichia coli
1) it is removed from liquid nitrogen the defrosting of Escherichia coli (Escherichia coli) bacterial strain DH5 α competent cell ice bath；
2) 4.3 connection products are mixed gently with competent escherichia coli cell, ice bath 30min；
3) 42 DEG C of thermal shock 90s, immediately ice bath 1-2min；
4) 0.8mL SOC is added, mixes, 37 DEG C of mild shaken cultivation 1h；
5) room temperature 13000rpm is centrifuged 1min, outwells a part of supernatant, stays the supernatant of about 200 μ L, will be upper with suction nozzle
Clear liquid and cell mix, and are coated on the LB plate containing ampicillin (100 μ g/mL), 37 DEG C of overnight incubations.
4.5 rapid cleavage methods identify recombinant clone
1) picking monoclonal is inoculated in 500 μ L and contains in the LB culture solution of ampicillin (100 μ g/mL), 37 DEG C of oscillations
It cultivates to A600It is 0.6~0.8；
2) take 200 μ L bacterium solutions into 0.5mL EP pipe, 13000rpm is centrifuged 1min, removes supernatant, stays about 20 μ L supernatants；
3) (0.2M NaOH 50mL, SDS 0.5g, sucrose 27.2g add distilled water extremely to 20 μ 2 × rapid cleavage of L liquid of addition
200mL), acutely oscillation；
4) 13000rpm is centrifuged 15min；
5) the 5 direct electrophoresis of μ L supernatant are taken.Compared with the control, electrophoresis band lag may be recombinant vector.
4.6 bacterium colony PCR identify recombinant plasmid
4.5 recombinant vectors identified through rapid cleavage method are subjected to bacterium colony PCR identification again, to determine that Insert Fragment is
Target fragment, reaction system are as follows:
Reaction condition: 94 DEG C of 3min (initial denaturation)；94 DEG C of 30s (denaturation), 56 DEG C of 20s (renaturation), 72 DEG C of 90s (extension),
Denaturation renaturation-the extension 26 circulations；72 DEG C of 5min (overall elongation).
To the recombinant vector of bacterium colony PCR identification, it is named as pEASY-TeVDE1, is sequenced.Sequencing result shows to obtain
It is connected to the TeVDE1 full length gene sequence of pEASY-Blunt Simple cloning vector, SEQ in gene order such as sequence table
Shown in ID NO:1, encoding amino acid sequence is as shown in SEQ ID NO:2 in sequence table.
Embodiment 3:HPLC method measures marigold petal lutein content
Using efficient liquid phase (HPLC) method, to the content of marigold with pigment cultivar chrysanthemum king's different tissues Lutein
It is measured.
1, reagent
Lutein standard items are purchased from Shanghai Aladdin biochemical technology limited liability company, remaining reagent be import packing or
Domestic analysis net product.
2, method
Marigold blade, bud and mature petal samples, liquid nitrogen grinding are taken, weigh 0.15g, and 1mL ethyl alcohol is added and (contains
0.1%2,6- di-tert-butyl-4-methy phenol), 400mL 50%KOH aqueous solution, vortex 15s, in 60 DEG C is added in vortex 15s
Water-bath 60min, every 15min are vortexed primary.It is extracted 3 times with 3.3mL n-hexane, combined extract takes 50 μ L filtrate loadings.Chromatography
Condition: high performance liquid chromatograph (WATERS company, the U.S.)；Chromatographic column SymmetryC18 (250mm × 4.6mm, 5 μm)；Flowing
Phase: acetonitrile: methylene chloride: methanol is 70:20:10 (v:v:v)；Flow velocity 1mL/min；Detection wavelength 475nm；30 DEG C of column temperature.
3, result
According to lutein standard items standard curve and HPLC measurement result, marigold cultivar chrysanthemum king blade, flower are measured
Flower bud and mature petal lutein content average value are respectively 1.30,12.99,8.85mg/g fresh weight.
Embodiment 4: marigold TeVDE1 gene organization expression analysis
According to the marigold Analysis of Violaxanthin De-Epoxidase TeVDE1 full length gene sequence that the clone of embodiment 2 obtains, using drawing
Object design software Primer Premier 5.0 designs quantification PCR primer, respectively from marigold blade, bud and maturation Hua Zhongti
Total serum IgE is taken, reverse transcription obtains cDNA, carries out the quantitative analysis of TeVDE1 gene expression dose.
1, reagent
Plant RNA extraction reagent Trizol is purchased from Invitrogen company, and DNA enzymatic I (Dnase I) is purchased from Takara public affairs
Department；Reverse transcriptase (TransScript Reverse Transcriptase) is purchased from Beijing Quanshijin Biotechnology Co., Ltd
Company；It is limited that real-time quantitative PCR reagent TransStart Green qPCR SuperMix is purchased from Beijing Quan Shijin biotechnology
Company；Primer is synthesized by Invitrogen (Shanghai) Trading Co., Ltd., remaining reagent is import packing or the pure production of domestic analysis
Product.
2, method
Tagetes erecta blade, bud and mature style product are taken, extract RNA after liquid nitrogen grinding, carry out reverse transcription, operation step
Suddenly as described in embodiment 1 4.2 in 3.1, embodiment 2.
With marigold Translation Initiation Factor 6 (TIF6) for internal reference crt gene, carry out
The quantitative PCR analysis of TeVDE1 gene expression dose.TeVDE1 gene primer are as follows: TeVDE1F3 and TeVDE1R3；TIF6 gene
Primer are as follows: TIF6F and TIF6R.Primer sequence is as follows:
TeVDE1F3:5’GCTATTAGTCCTCTCAAATCAGCATCC 3’
TeVDE1R3:5’TATCCGTGAACACCAGCATCTCA 3’
TIF6F:5’TAAGACCTGGTGGTGGAAATAGA 3’
TIF6R:5’CAGCACCATGAGGACGAAGA 3’
Real-time quantitative PCR reaction system is as follows:
Reaction condition: 95 DEG C of 30s；95 DEG C of 5s, 60 DEG C of 15s, 72 DEG C of 10s, 40 circulations.Wherein cDNA is in embodiment 2
4.2.1 acquisition cDNA template described in method is used for quantitative PCR after diluting 30 times.After amplification, 65 DEG C of 5s, each circulation increases by 0.5
DEG C, 60 circulations carry out solubility curve analysis.Each sample is in triplicate.PCR reaction is run on Bio-Rad CFX 96.
3, result
Fig. 1 is the leaf, bud, the mature quantitative expression and leaf for spending middle TeVDE1 gene of marigold with pigment cultivar chrysanthemum king
Flavine assay result.Real-time PCR Analysis the results show that TeVDE1 gene in the immature bud group of marigold with pigment
It is higher to knit middle expression quantity, and TeVDE1 gene expression dose is positively correlated with respective organization Lutein content.The SEQ ID
NO:1 gene has effect in terms of the carotenoid pigments dynamic accumulation such as lutein, and the present invention is cloned from marigold with pigment
Carotenogenesis approach violaxanthin decyclization oxidase gene can be used in improving the carotenoid pigments contents such as lutein.
Claims (3)
1. a kind of marigold carotenogenesis approach violaxanthin decyclization oxidase gene Tagetes erecta
Violaxanthin de-epoxidase, abbreviation TeVDE1, it is characterised in that: SEQ ID in its nucleotide sequence such as sequence table
Shown in NO:1.
2. marigold carotenogenesis approach violaxanthin decyclization oxidase gene as described in claim 1, is characterized in that it
Amino acid sequence is as shown in SEQ ID NO:2 in sequence table.
3. the purposes of marigold carotenogenesis approach violaxanthin decyclization oxidase gene, feature described in claim 1
It is: application of the marigold violaxanthin decyclization oxidase gene in marigold Lutein dynamic accumulation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610585328.3A CN105969781B (en) | 2016-07-22 | 2016-07-22 | A kind of carotenogenesis approach violaxanthin decyclization oxidase gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610585328.3A CN105969781B (en) | 2016-07-22 | 2016-07-22 | A kind of carotenogenesis approach violaxanthin decyclization oxidase gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105969781A CN105969781A (en) | 2016-09-28 |
| CN105969781B true CN105969781B (en) | 2019-06-18 |
Family
ID=56953472
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610585328.3A Active CN105969781B (en) | 2016-07-22 | 2016-07-22 | A kind of carotenogenesis approach violaxanthin decyclization oxidase gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105969781B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220300B (en) * | 2018-01-04 | 2021-04-13 | 合肥工业大学 | Marigold transcription factor gene and application thereof |
| CN111171120B (en) * | 2018-11-12 | 2021-06-22 | 中国农业大学 | CsVDL gene from cucumber and application thereof in regulation and control of plant stress tolerance |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103695444A (en) * | 2014-01-14 | 2014-04-02 | 山东省农业科学院生物技术研究中心 | Arachis hypogaca violaxanthin de-epoxidase (AhVDE) gene and coding protein and application thereof |
| CN103710362A (en) * | 2013-11-20 | 2014-04-09 | 天津大学 | Lycium Chinese miller violaxanthin de-epoxidase (LmVDE) gene and application thereof in improvement of plant stress resistant capability |
-
2016
- 2016-07-22 CN CN201610585328.3A patent/CN105969781B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103710362A (en) * | 2013-11-20 | 2014-04-09 | 天津大学 | Lycium Chinese miller violaxanthin de-epoxidase (LmVDE) gene and application thereof in improvement of plant stress resistant capability |
| CN103695444A (en) * | 2014-01-14 | 2014-04-02 | 山东省农业科学院生物技术研究中心 | Arachis hypogaca violaxanthin de-epoxidase (AhVDE) gene and coding protein and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| 万寿菊叶黄素开发利用研究进展;汪殿蓓 等;《北方园艺》;20071231(第1期);44-46 |
| 植物叶黄素循环及其光保护作用的研究进展;李瑾瑾 等;《安徽农业科学》;20160210;第44卷(第5期);1-3,17 |
| 色素万寿菊中叶黄素合成相关基因的表达分析;王国兰 等;《分子植物育种》;20121231;第10卷(第1期);67-72 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105969781A (en) | 2016-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2022177001A (en) | Improved heterotrophic production methods for microbial biomass and bioproducts | |
| CN105441461B (en) | A kind of application of Radix Notoginseng transcription factor gene PnWRKY1 | |
| CN104726485B (en) | Turn the method that AtMYC2 genes improve tanshinone and danshinolic acid content in Hairy Root Cultures of Salvia miltiorrhiza | |
| Huang et al. | Isolation and characterization of a carotenoid oxygenase gene from Chlorella zofingiensis (Chlorophyta) | |
| CN105087604B (en) | A kind of application of sll0147 gene in synthesis cytoalgae carotenoid | |
| Yan et al. | Apigenin accumulation and expression analysis of apigenin biosynthesis relative genes in celery | |
| CN101962650B (en) | Method for increasing tanshinone content of salvia miltiorrhiza hairy roots by transferring SmGGPPS gene | |
| CN105316357A (en) | Method for producing astaxanthin by using transgenic microalgae | |
| CN105969781B (en) | A kind of carotenogenesis approach violaxanthin decyclization oxidase gene and application | |
| CN105441462B (en) | A kind of Radix Notoginseng transcription factor gene PnERF1 and its application | |
| CN107365778A (en) | Regulate and control transcription factor gene and its application of lutein synthesis | |
| CN109517812A (en) | Azalea chalcone synthase RsCHS albumen and its encoding gene | |
| CN104404063B (en) | One cultivate peanut vitamin E synthesis key gene and application | |
| Qi et al. | Lycopene β-cyclase plays a critical role in carotenoid biosynthesis during persimmon fruit development and postharvest ripening | |
| Lu et al. | SA-responsive transcription factor GbMYB36 promotes flavonol accumulation in Ginkgo biloba | |
| CN101942467B (en) | Method for enhancing content of tanshinone in salvia miltiorrhiza hairy root by double-key enzyme genetic transformation | |
| Davis et al. | Elevated gene expression in chalcone synthase enzyme suggests an increased production of flavonoids in skin and synchronized red cell cultures of North American native grape berries | |
| CN105950635A (en) | Marigold phytoene desaturase gene and application | |
| CN101948887A (en) | Preparation method and application of recombinant phycocyanobilin | |
| WO2023202122A1 (en) | Curcuma wenyujin y. h. chen & c. ling-derived curcumin synthetase, gene, vector, engineered bacterium, and use thereof | |
| CN110272905A (en) | It is a kind of improve plant flavonoids content gene and application | |
| KR20220063159A (en) | Astaxanthin overproducing strain of papia rhodojima | |
| CN108220300A (en) | A kind of marigold transcription factor gene and application | |
| CN116790637A (en) | Akebia trifoliata anthocyanin synthesis regulatory gene AtrANS and encoding protein and application thereof | |
| Gómez-Gómez et al. | Engineering the production of crocins and picrocrocin in heterologous plant systems |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |