CN105950635A - Marigold phytoene desaturase gene and application - Google Patents

Marigold phytoene desaturase gene and application Download PDF

Info

Publication number
CN105950635A
CN105950635A CN201610555068.5A CN201610555068A CN105950635A CN 105950635 A CN105950635 A CN 105950635A CN 201610555068 A CN201610555068 A CN 201610555068A CN 105950635 A CN105950635 A CN 105950635A
Authority
CN
China
Prior art keywords
gene
marigold
tepds1
phytoene desaturase
desaturase gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610555068.5A
Other languages
Chinese (zh)
Inventor
牛向丽
刘莹
黄胜雄
田丽
刘永胜
刘国庆
周宇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hefei University of Technology
Original Assignee
Hefei University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hefei University of Technology filed Critical Hefei University of Technology
Priority to CN201610555068.5A priority Critical patent/CN105950635A/en
Publication of CN105950635A publication Critical patent/CN105950635A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a marigold phytoene desaturase gene and application. The nucleotide sequence of the marigold phytoene desaturase gene (TePDS1) is shown as SEQ ID NO:1 in the sequence table. The gene TePDS1 is obtained through cloning in pigment marigold flower petal tissue, xanthophyll content determination and real-time quantitative analysis results show that the expression quantity of the gene TePDS1 in marigold flowers is high, and the expression level of the gene TePDS1 is related to the content of xanthophyll. The marigold phytoene desaturase gene plays a role in synthesis and accumulation of carotenoid pigment like xanthophyll.

Description

Flos Tagetis Erectae phytoene desaturase gene and application
Technical field
The present invention relates to plant genetic engineering field, particularly relate to a kind of clone's class trailing plants recklessly from marigold with pigment Bu Su route of synthesis phytoene desaturase gene TePDS1 and application thereof.
Background technology
Flos Tagetis Erectae (Tagetes erecta L.) is 1 year raw herbaceous plant of Compositae Tagetes, originates in America The ground such as Mexico, because of its flower flower-shape is big, bright and colourful, plant strong adaptability, with short production cycle, the most Extensively introduce a fine variety all over the world, also become a kind of emerging plant resources with Important Economic value in China. Owing to increasing income 1～2 times than maize planting or Semen sojae atricolor under equal conditions, Flos Tagetis Erectae cultivated area increases year by year, existing China has become Xanthophylls from Marigold main product ground, the world.
Marigold petal presents yellowish orange mainly due to containing phylloxanthin, phylloxanthin in Flos Tagetis Erectae mainly with Presented in fat, can account for petal pigment content 90% (Wang Dianbei etc., the north gardening, 2007；Harikumar Deng, International Journal of Toxicology, 2008).Human body can not synthesize phylloxanthin but can To utilize the lutein ester of picked-up in food so that it is transform into free lutein in vivo.Due to phylloxanthin Can not synthesize at human body, and have multiple isomer, also the difficult employing external synthesis of chemical method, thus most preferably obtain Access method is to extract from natural plants.Determine that as far back as 1985 phylloxanthin is macula retinae pigment after deliberation Constituent after, phylloxanthin has been carried out further investigation by domestic and international research worker, has found that while that phylloxanthin exists Various fruits and vegetable generally exist, but its content extremely pettiness, thus rich in ten thousand longevity of this composition Chrysanthemum becomes the important plant resources extracting natural carotenol.Phylloxanthin is bright in colour, and the phylloxanthin of high-load is not Only can be used as natural colorants pigment, also there is abundant nutritive value and medical value, medicine, food, Poultry cultivation, cosmetics are extensively applied.For coated tablet, the coloring of capsule, health beverage coloring, Or highly purified lutein ester is made hard capsule, soft capsule, tablet, oral liquid etc., and (Zhou Xi etc. abroad cure Study medicine geographical fascicle, 2011).
Phylloxanthin quite has the title of " soft gold " because of its price with gold.As there being important nutrition, medicinal The natural pigment being worth, increases phylloxanthin demand, both at home and abroad the most year by year although China is marigold with pigment Main product ground, but owing to corresponding research and industrialization are still in the starting stage, in addition to the most personal, domestic extractum The overwhelming majority exports to foreign countries.And domestic required more than 90% relies on import, a large amount of foreign exchange import leaf need to be spent every year Flavin goods, meet the demands such as pharmaceuticals industry raw material, food additive and feed additive (Li Na etc., north Fang Yuanyi, 2010；Wang Xumei, Xinjiang Farm Economy, 2012；Zhai Jianying etc., China's Chinese medicine information is miscellaneous Will, 2014).China is in terms of basic research, and Li Pu etc. (northwest agricultural journal, 2012) is to Flos Tagetis Erectae W217 The lutein content of P1, P2, F1, B1, B2 and F2 totally 6 generations of × W203 combination carries out heredity point Analysis, show lutein content character based on major gene hereditary effect, multigentic effect is auxiliary.Phylloxanthin is Oxygen-containing Polyterpenes material in carotenoid.In plant, synthesis precursor isopentenyl pyrophosphate is through many Secondary condensation generates first carotenoid-phytoene, then through dehydrogenation, cyclisation, hydroxylating, epoxy Change etc. is changed into other carotenoid, and whole process is completed by multiple enzyme catalysis.By arabidopsis, Fructus Lycopersici esculenti These Carotenoid biosynthetic pathway genes have been had the most by the research of isotype plant Solve, find that phytoene synthetase (phytoene synthase, PSY), phytoene take off Saturated enzyme (phytoene desaturase, PDS), lycopene cyclase (lycopene cyclase, LYC), carotene desaturase (carotene desaturase, ZDS), Analysis of Violaxanthin De-Epoxidase (violaxanthin de-epoxidase, VDE) etc. send out in the carotenogenesis accumulation such as phylloxanthin Wave important function (Shengxiong Huang etc., Nature communication, 2013).But as The Flos Tagetis Erectae of the important plant origin of phylloxanthin, some important gene of its phylloxanthin route of synthesis are not yet cloned point From.
Summary of the invention
The technical problem to be solved in the present invention is to provide one and can be used for carotenoids natural plant pigment The gene Flos Tagetis Erectae phytoene desaturase gene Tagetes erecta phytoene of synthesis desa turase 1(TePDS1)。
It is de-full that the another one technical problem that the invention solves the problems that is to provide a kind of Flos Tagetis Erectae phytoene Encoding proteins with enzyme gene.
The also technical problem that the invention solves the problems that is to provide a kind of Flos Tagetis Erectae phytoene and takes off full With the application in the carotenoid pigment synthesis such as phylloxanthin of the enzyme gene.
For Flos Tagetis Erectae phytoene desaturase gene Tagetes erecta phytoene Desa turase 1 (TePDS1), the technical solution used in the present invention is, its nucleotide sequence such as sequence table Shown in middle SEQ ID NO:1.
For the encoding proteins of Flos Tagetis Erectae phytoene desaturase gene, the technical side that the present invention uses Case is, the aminoacid sequence of encoding proteins is as shown in SEQ ID NO:2 in sequence table.
It addition, Flos Tagetis Erectae phytoene desaturase gene is at the carotenoid including phylloxanthin Application in synthesis.
The cloning process of the Flos Tagetis Erectae phytoene desaturase gene of the present invention is as follows:
According to inventor, the high flux transcript profile degree of depth of marigold with pigment is checked order to TePDS1 gene number According to assembling.Then primer-design software Primer Premier 5.0 is utilized to design 2 special to nest-type PRC Primer, extracts total serum IgE from marigold petal, and reverse transcriptional PCR (RT-PCR) is cloned into TePDS1 gene.
The present invention is by Folium Tagetis Erectae, the real-time quantitative analysis of different development stage flower tissue and lutein content Measurement result, shows that SEQ ID NO:1 gene of the present invention has in terms of carotenoid pigment synthesis There is effect.
The invention has the beneficial effects as follows:
A kind of new genetic resources is provided for improving the carotenoid pigment content such as phylloxanthin in plant.
Accompanying drawing explanation
The present invention is further detailed explanation with detailed description of the invention below in conjunction with the accompanying drawings.
Fig. 1 is in the leaf of marigold with pigment cultivar chrysanthemum king of the embodiment of the present invention, alabastrum, mature flower TePDS1 gene quantification expression analysis, lutein content measurement result.
Detailed description of the invention
In following embodiment, all unreceipted specific experiment conditions, it is and knows according to those skilled in the art Normal condition, the molecular cloning of such as Sambrook Russell: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to institute of manufacturer The condition of suggestion.
Embodiment 1: Flos Tagetis Erectae different tissues transcript profile checks order
1, reagent
Plant RNA extraction test kit V1.2 (DNase I) is purchased from Chengdu hundred Fitow Science and Technology Ltd., RNA Library Prep Kit is purchased from Beijing Biomarker Technologies Co., Ltd., remaining reagent be import subpackage or Domestic analytical pure product.
2, vegetable material
Marigold with pigment (Tagetes erecta L.) cultivar chrysanthemum king is bred by Xin Hui gardening company of Chifeng and carries Supply.
3, method
3.1 RNA extract
RNA extraction is carried out according to operating procedure described in plant RNA extraction test kit V1.2.
1) use liquid nitrogen grinding method to crush 100mg plant tissue, move in 1.5mL centrifuge tube, add 1ml Solution A；
2) centrifuge tube adds 300 μ L solution B and 200 μ L chloroforms, vibration 30s mixing；
3) room temperature 13000rpm is centrifuged 15min, RNA and is positioned at supernatant, and downside organic facies contains chlorophyll etc. Impurity；
4) being moved in another 1.5mL centrifuge tube by supernatant 700 μ L, lower floor's organic facies and intermediate layer also have albumen Matter and other impurity, it is to avoid touch absorption；
5) in supernatant, 0.5mL solution C and 0.2mL chloroform are added, vibration 30s mixing of turning upside down；
6) room temperature 13000rpm is centrifuged 6min；
7) supernatant is transferred in another 1.5mL centrifuge tube, it is to avoid touch organic facies；
8) in supernatant, add 0.5 times of bulk solution D, place 2min, vibration 30s mixing of turning upside down；
9) adding in centrifugal adsorbing column by mixture (the most most 900 μ L), room temperature 12000rpm is centrifuged 1min, abandons and penetrates liquid, cleans once；
10) adding 700 μ L rinsing liquids, 12000rpm is centrifuged 1min, discards and penetrates liquid；
11) 12000rpm is centrifuged 2min；
12) the Recombinant DNase I of 5-6 μ L is joined 45-44 μ L DNase I Buffer Middle piping and druming mixing is configured to DNase I working solution, then DNase I working solution is joined centrifugal adsorbing column In, room temperature is placed 15-20 minute；
13) adding 500 μ L rinsing liquids, room temperature 12000rpm is centrifuged 1min, discards and penetrates liquid；
14) add 500 μ L rinsing liquids, come again；
15) 12000rpm is centrifuged 2min；
16) centrifugal adsorbing column is moved in RNase-free collecting pipe, add 50-100 μ L RNase-free H2O, room temperature places 3-5min；
17) 12000rpm is centrifuged 2min, and in centrifuge tube, solution is RNA sample；
18) the pure of Nanodrop, Qubit2.0, Aglient2100 method detection RNA sample it is respectively adopted Degree, concentration and integrity.
Each by extracting the blade of marigold with pigment cultivar three individual plants of chrysanthemum king, alabastrum, mature flower RNA 1 part, carry out follow-up transcript profile sequencing.
3.2 transcript profile order-checkings assemble and annotation
Transcript profile order-checking utilizes RNA Library Prep Kit test kit, steps visitor's biotechnology by Beijing hundred Company limited's Illumina HiSeq high-flux sequence platform, sequentially includes the following steps:
1) with the enrichment with magnetic bead eukaryote RNA with Oligo (dt), mRNA is interrupted at random；
2) with mRNA as masterplate, with hexabasic base random primer synthesize Article 1 cDNA chain, be subsequently adding dNTPs, RNase H and DNA polymerase I synthesizes Article 2 cDNA chain, utilizes AMPure XP beads purification cDNA；
3) double-strand cDNA of purification carries out end reparation again, adds A tail and connect sequence measuring joints, then uses AMPure XP beads carries out clip size selection, obtains cDNA library by PCR enrichment；
4) concentration and Insert Fragment size to library detect；
5) utilizing Illumina HiSeq high-flux sequence platform to check order cDNA library, order-checking is read A length of PE125；
6) order-checking fragment (reads) is amputated sequence measuring joints, primer sequence, filter low quality value data After, it is thus achieved that high-quality sequencing data；
7) the Trinity composite software read that checked order by high-quality is utilized to extend into longer fragment (contig), and utilize the overlap between these fragments, obtain set of segments (component), The rear method utilizing De Bruijn obtains transcript sequence (unigene)；
8) use BLAST software by unigene sequence and NR, Swiss-Prot, GO, COG, KOG, KEGG data base's comparison, uses the aminoacid sequence of KOBAS2.0 prediction unigene, uses HMMER soft Part and Pfam data base's comparison, it is thus achieved that the annotation information of unigene.
4. result
By above-mentioned steps, Flos Tagetis Erectae organization material carries out the high flux transcript profile degree of depth to check order, to check order into Row assembles and Gene correlation, it is thus achieved that Flos Tagetis Erectae phytoene desaturase gene Tagetes The speculated sequence of erecta phytoene desa turase 1 (TePDS1) gene.
Embodiment 2: the clone of Flos Tagetis Erectae TePDS1 gene
1, reagent
Plant RNA extraction test kit V1.2 (DNase I) is purchased from Chengdu hundred Fitow Science and Technology Ltd.；Reversion Record enzyme TransScript Reverse Transcriptase is purchased from Beijing full formula limited public affairs of gold biotechnology Department；High-fidelity DNA polymerase PrimeStar is purchased from TaKaRa company；Cloning vehicle pEASY-Blunt Simple Cloning Vector is purchased from Beijing Quanshijin Biotechnology Co., Ltd；Primer is by English Weihe River victory base (Shanghai) trade Co., Ltd synthesizes；Remaining reagent is import subpackage or domestic analytical pure product.
2, coli strain and vegetable material
Escherichia coli (Escherichia coli) bacterial strain DH5d is purchased from Beijing full formula limited public affairs of gold biotechnology Department；Marigold with pigment (Tagetes erecta L.) cultivar chrysanthemum king's seed is by Xin Hui gardening company of Chifeng Offer is provided.
3, culture medium and solution
LB culture medium: tryptone 10g/L, yeast powder 5g/L, NaCl 10g/L.PH is adjusted with NaOH To 7.0, autoclaving.
SOB culture medium: tryptone 20g/L, yeast powder 5g/L, NaCl 0.5g/L, KCl 0.19g/L, 100×Mg2+10mL.PH to 7.0, autoclaving is adjusted with NaOH.
SOC culture medium: method, with the preparation of above-mentioned SOB culture medium, adds 2mL filtration sterilization 1mol/L glucose.
100×Mg2+Solution: 20.33g MgCl2.6H2O and 24.65g MgS04.7H2O constant volume is in 100mL H2O, Autoclaving.
4, method
4.1 Flos Tagetis Erectae mature flower tissue RNA extract
As described in Example 1, carry out according to operating procedure described in plant RNA extraction test kit V1.2.
4.2 RT-PCR
4.2.1 RT
1) 1 μ g total serum IgE and 1 μ L polyT are taken18(10 μMs) primer mixes, and uses RNase-free ddH2O supplies 12.75 μ L, mixes gently；
2) 65 DEG C of insulation 5min, are immediately transferred in ice bath, place 2min；
3) 5 × reaction buffer 4 μ L, 10mM dNTP 2 μ L, RNA inhibitor 0.25 μ L (40U/ are added μ L), TransScript Reverse Transcriptase reverse transcription 1 μ L (100U/ μ L), 42 DEG C 1h, synthesizes the first chain cDNA；
4) 95 DEG C of heating 5min, inactivate reverse transcription, terminate reaction.
4.2.2 PCR
According to the TePDS1 gene speculated sequence obtained described in embodiment 1, utilize Primer Premier 5.0 Software design primer sequence is as follows:
TePDS1F1:5 ' ATAACAACAACCACCTCCGA 3 '
TePDS1R1:5 ' GCCACTACACTTCTGCCCAT 3 '
TePDS1F2:5 ' ATGTCTCTGTTATCAGCCACCA 3 '
TePDS1R2:5 ' TTAGACCAGACTTGCTTCAGCA 3 '
Take the cDNA of above-mentioned 4.2.1 obtained Flos Tagetis Erectae mature flower, carry out the clone of TePDS1 gene.By 200 μ L EP pipe is positioned on ice, addition reagent:
Expand by following procedure: 98 DEG C of 2min (denaturation)；98 DEG C of 10s (degeneration), 55 DEG C of 20s (renaturation), 72 DEG C of 100s (extension), described denaturation renaturation-extension 30 circulation；72 DEG C of 5min are (total Extend).
With above-mentioned PCR primer as template, carry out second with primer TePDS1F2 and TePDS1R2 and take turns PCR, Renaturation temperature 57 DEG C, other condition is ibid.
Pass through aforesaid operations, it is thus achieved that TePDS1 gene PCR amplified production.
4.3 High fidelity PCR product is connected with cloning vehicle pEASY-Blunt
By by the TePDS1 gene PCR amplified production obtained described in above-mentioned 4.2 and cloning vehicle PEASY-Blunt Simple Cloning Vector connects (25 DEG C, 15min) by mole molecular number than 1: 4, Linked system is as follows:
pEASY-Blunt Simple Cloning Vector(50μg/μL) 4μL
PCR primer (～150 μ g/ μ L) 1 μ L
4.4 escherichia coli convert
1) from liquid nitrogen, escherichia coli (Escherichia coli) bacterial strain DH5 α competent cell ice is taken out Bath is thawed；
2) mix connecting product described in 4.3 gently with competent escherichia coli cell, ice bath 30min；
3) 42 DEG C of thermal shock 90s, immediately ice bath 1-2min；
4) 0.8mL SOC is added, mixing, 37 DEG C of gentle shaken cultivation 1h；
5) room temperature 13000rpm is centrifuged 1min, outwells a part of supernatant, stays the supernatant of about 200 μ L, With suction nozzle, supernatant is mixed with cell, coat the LB containing ampicillin (100 μ g/mL) and put down Plate, 37 DEG C of overnight incubation.
4.5 rapid cleavage method identifies recombinant clone
1) picking monoclonal is inoculated in the LB culture fluid that 500 μ L contain ampicillin (100 μ g/mL) In, 37 DEG C of shaken cultivation to A600It is 0.6～0.8；
2) taking 200 μ L bacterium solution in 0.5mL EP pipe, 13000rpm is centrifuged 1min, removes supernatant, stays about 20 μ L of supernatant；
3) add 20 μ L 2 × rapid cleavage liquid (0.2M NaOH 50mL, SDS 0.5g, sucrose 27.2g, Add distilled water to 200mL), acutely vibrate；
4) 13000rpm is centrifuged 15min；
5) take 5 μ L of supernatant and carry out agarose gel electrophoresis.Compared with the control, delayed i.e. may of electrophoresis band It it is recombinant vector.
4.6 bacterium colony PCR identify recombiant plasmid
The recombinant vector identified through rapid cleavage method described in 4.5 is carried out bacterium colony PCR qualification again, slotting to determine Entering fragment is target fragment, and reaction system is as follows:
Reaction condition: 94 DEG C of 3min (denaturation)；94 DEG C of 30s (degeneration), 57 DEG C of 20s (renaturation), 72 DEG C of 100s (extension), described denaturation renaturation-extension 26 circulation；72 DEG C of 5min (overall elongation).
The recombinant vector that bacterium colony PCR is identified, named pEASY-TePDS1, checks order.Order-checking knot Fruit shows, it is thus achieved that be connected to the TePDS1 full length gene coding of pEASY-Blunt Simple cloning vehicle Sequence.
Embodiment 3:HPLC method measures marigold petal lutein content
1, reagent
Phylloxanthin standard substance are purchased from Shanghai Aladdin biochemical technology limited company, 2,6-di-t-butyl-4- Methylphenol is purchased from Chemical Reagent Co., Ltd., Sinopharm Group, and remaining reagent is import subpackage or domestic analysis Net product.
2, method
Taking Flos Tagetis Erectae blade, alabastrum and ripe petal samples, liquid nitrogen grinding, weigh 0.15g, adds 1mL Ethanol (containing 0.1%2,6-di-tert-butyl-4-methy phenol), vortex 15s, add 400mL 50%KOH Aqueous solution, vortex 15s, in 60 DEG C of water-bath 60min, every 15min vortex is once.Use 3.3mL normal hexane Extract 3 times, united extraction liquid, take 50 μ L filtrate loadings.Chromatographic condition: high performance liquid chromatograph is (beautiful WATERS company of state)；Chromatographic column SymmetryC18 (250mm × 4.6mm, 5 μm)；Flowing phase: second Nitrile: dichloromethane: methanol is 70: 20: 10 (v: v: v)；Flow velocity 1mL/min；Detection wavelength 475nm； Column temperature 30 DEG C.
3, result
According to phylloxanthin standard substance standard curve and HPLC measurement result, record Flos Tagetis Erectae blade, alabastrum and Mature flower lobe lutein content is respectively 1.30,12.99,8.85mg/g fresh weight.
Embodiment 4: Flos Tagetis Erectae TePDS1 gene organization expression analysis
1, reagent
Plant RNA extraction test kit V1.2 (DNase I) is purchased from Chengdu hundred Fitow Science and Technology Ltd.；Reversion Record enzyme TransScript Reverse Transcriptase is purchased from Beijing Quanshijin Biotechnology Co., Ltd Company；Real-time quantitative PCR reagent TransStart Green qPCR SuperMix is purchased from Beijing full formula gold Bioisystech Co., Ltd；Primer is synthesized by English Weihe River victory base (Shanghai) trade Co., Ltd；Remaining reagent is equal For import subpackage or domestic analytical pure product.
2, method
Take Tagetes erecta blade, alabastrum and mature flower sample, extract RNA after liquid nitrogen grinding, invert Record, operating procedure is in embodiment 1 3.1, as described in embodiment 2 4.2.
It is internal reference crt gene with Flos Tagetis Erectae Translation Initiation Factor6 (TIF6), Carry out the quantitative PCR analysis of TePDS1 gene expression dose.TePDS1 gene primer is: TePDS1F3 And TePDS1R3；TIF6 gene primer is: TIF6F and TIF6R.Primer sequence is as follows:
TePDS1F3:5 ' GCTCATACTATTACGGCTCGTCATC 3 '
TePDS1R3:5 ' GTGAAGGTGGAAGACAAGTAAGCAG 3 '
TIF6F:5 ' TAAGACCTGGTGGTGGAAATAGA 3 '
TIF6R:5 ' CAGCACCATGAGGACGAAGA 3 '
Real-time quantitative PCR reaction system is as follows:
Reaction condition: 95 DEG C of 30s；95 DEG C of 5s, 60 DEG C of 15s, 72 DEG C of 10s, 40 circulations.Wherein CDNA is to obtain described in 4.2.1 method in embodiment 2 after cDNA template dilutes 30 times for quantitative PCR. After amplification, 65 DEG C of 5s, each circulation increases by 0.5 DEG C, and 60 circulations carry out solubility curve analysis.Often Individual sample is in triplicate.PCR reaction runs on Bio-Rad CFX 96.
3, result
Real-time PCR Analysis result shows, TePDS1 is at the flower tissue of marigold with pigment, the most not In mature flower, expression is higher, and TePDS1 gene expression dose and respective organization Lutein content are in just Relevant, see Fig. 1.
Invention described above embodiment, is not intended that limiting the scope of the present invention.Any Amendment, equivalent and the improvement etc. made within the spirit and principles in the present invention, should be included in the present invention Claims within.

Claims (3)

1. Flos Tagetis Erectae phytoene desaturase gene, it is characterised in that: its nucleotide sequence such as sequence In table shown in SEQ ID NO:1.
2. the encoding proteins of Flos Tagetis Erectae phytoene desaturase gene as claimed in claim 1, it is special Levy and be: the aminoacid sequence of described encoding proteins is as shown in SEQ ID NO:2 in sequence table.
3. Flos Tagetis Erectae phytoene desaturase gene is including that phylloxanthin exists as claimed in claim 1 The interior application in carotenogenesis.
CN201610555068.5A 2016-07-14 2016-07-14 Marigold phytoene desaturase gene and application Pending CN105950635A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610555068.5A CN105950635A (en) 2016-07-14 2016-07-14 Marigold phytoene desaturase gene and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610555068.5A CN105950635A (en) 2016-07-14 2016-07-14 Marigold phytoene desaturase gene and application

Publications (1)

Publication Number Publication Date
CN105950635A true CN105950635A (en) 2016-09-21

Family

ID=56900839

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610555068.5A Pending CN105950635A (en) 2016-07-14 2016-07-14 Marigold phytoene desaturase gene and application

Country Status (1)

Country Link
CN (1) CN105950635A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108220300A (en) * 2018-01-04 2018-06-29 合肥工业大学 A kind of marigold transcription factor gene and application
CN110734915A (en) * 2019-11-21 2020-01-31 合肥工业大学 plant gene and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1757735A (en) * 2005-06-27 2006-04-12 福建农林大学 CDNA sequence of coding sweet potato phytoene dehydrogenase
CN102260692A (en) * 2011-07-08 2011-11-30 山东大学 Phytoene dehydrogenase gene and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1757735A (en) * 2005-06-27 2006-04-12 福建农林大学 CDNA sequence of coding sweet potato phytoene dehydrogenase
CN102260692A (en) * 2011-07-08 2011-11-30 山东大学 Phytoene dehydrogenase gene and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHARLES P. MOEHS, ET AL.: "Analysis of carotenoid biosynthetic gene expression during marigold petal development", 《PLANT MOLECULAR BIOLOGY》 *
MOEHS, C.P., ET AL.: "Genbank accession number:AF251014.1", 《GENBANK》 *
席海秀 等: "植物八氢番茄红素脱氢酶(PDS)基因保守结构域模式与系统进化分析", 《植物生理学报》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108220300A (en) * 2018-01-04 2018-06-29 合肥工业大学 A kind of marigold transcription factor gene and application
CN108220300B (en) * 2018-01-04 2021-04-13 合肥工业大学 Marigold transcription factor gene and application thereof
CN110734915A (en) * 2019-11-21 2020-01-31 合肥工业大学 plant gene and application
CN110734915B (en) * 2019-11-21 2022-03-22 合肥工业大学 Plant gene and application

Similar Documents

Publication Publication Date Title
Moraga et al. Glucosylation of the saffron apocarotenoid crocetin by a glucosyltransferase isolated from Crocus sativus stigmas
Jayaraj et al. Metabolic engineering of novel ketocarotenoid production in carrot plants
Wang et al. Expression of chalcone synthase and chalcone isomerase genes and accumulation of corresponding flavonoids during fruit maturation of Guoqing No. 4 satsuma mandarin (Citrus unshiu Marcow)
JP2022177001A (en) Improved heterotrophic production methods for microbial biomass and bioproducts
CN105441461B (en) A kind of application of Radix Notoginseng transcription factor gene PnWRKY1
Yan et al. Apigenin accumulation and expression analysis of apigenin biosynthesis relative genes in celery
CN105316357B (en) Utilize the method for Transgenic Microalgae production astaxanthin
CN105087604B (en) A kind of application of sll0147 gene in synthesis cytoalgae carotenoid
Ye et al. Defining the biosynthesis of ketocarotenoids in Chromochloris zofingiensis
CN106480063A (en) A kind of tea tree myb transcription factor CsAN1 and its application in regulation and control anthocyanidin metabolism
CN113430215A (en) Acetyl CoA synthetase gene RKACS1 and application thereof
CN106480004B (en) A kind of sesquiterpene synthase, gene, carrier, engineering bacteria and its application in Eupatorium adenophorum source
Zhao et al. Cloning of phytoene desaturase and expression analysis of carotenogenic genes in persimmon (Diospyros kaki L.) fruits
CN105950635A (en) Marigold phytoene desaturase gene and application
Liu et al. Quercetin-derivatives painting the yellow petals of American lotus (Nelumbo lutea) and enzymatic basis for their accumulation
CN107365778A (en) Regulate and control transcription factor gene and its application of lutein synthesis
US9365836B2 (en) Glycosyltransferase gene and use thereof
Zhao et al. Inducement and cultivation of novel red Cyclocarya paliurus callus and its unique morphological and metabolic characteristics
Santiago‐Díaz et al. Bioactive metabolites of microalgae from Canary Islands for functional food and feed uses
CN105969781B (en) A kind of carotenogenesis approach violaxanthin decyclization oxidase gene and application
Ding et al. The accumulation of lutein and β-carotene and transcript profiling of genes related to carotenoids biosynthesis in yellow celery
CN101948887A (en) Preparation method and application of recombinant phycocyanobilin
Gómez-Gómez et al. Engineering the production of crocins and picrocrocin in heterologous plant systems
Ahn et al. Production of ketocarotenoids in transgenic carrot plants with an enhanced level of β-carotene
CN103238849A (en) Production method and application of sericin microcapsules

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20160921

WD01 Invention patent application deemed withdrawn after publication