CN116790637A

CN116790637A - Akebia trifoliata anthocyanin synthesis regulatory gene AtrANS and encoding protein and application thereof

Info

Publication number: CN116790637A
Application number: CN202310765301.2A
Authority: CN
Inventors: 栾明宝; 陈建华; 王越; 肖进军; 陈晓蓉; 牛娟; 孙志民
Original assignee: Hunan Jixiangtian Biological Technology Co ltd; Institute of Bast Fiber Crops of CAAS
Current assignee: Hunan Jixiangtian Biological Technology Co ltd; Institute of Bast Fiber Crops of CAAS
Priority date: 2023-06-27
Filing date: 2023-06-27
Publication date: 2023-09-22

Abstract

The invention belongs to the technical field of akebia trifoliate planting and discloses an anthocyanin synthesis regulatory gene AtrANS of akebia trifoliate, and a coding protein and application thereof. The invention discovers the anthocyanin synthesis regulatory gene AtrANS of akebia trifoliate for the first time, and discloses the nucleotide sequence and the sequence of the coding protein thereof, and can promote the accumulation of anthocyanin by expressing an ANS gene in the akebia trifoliate transiently, and can reduce the accumulation of anthocyanin by silencing the gene. The invention also discloses an overexpression vector and a silencing vector containing the AtrANS gene, and provides application of the gene AtrANS in improving anthocyanin content in the pericarp of akebia trifoliata and in cultivating plant varieties with high anthocyanin content.

Description

Akebia trifoliata anthocyanin synthesis regulatory gene AtrANS and encoding protein and application thereof

Technical Field

The invention belongs to the technical field of akebia trifoliate planting, and particularly relates to an anthocyanin synthesis regulatory gene AtrANS of akebia trifoliate, and a coding protein and application thereof.

Background

Akebia trifoliata (Akebia trifoliate) (thunder) Koidz.) belongs to Akebia of Akebiaceae, is used as a wild vine fruit tree, is widely distributed in more than 20 provinces and cities in China, is used for medicine, food, oil and appreciation, is rich in nutrition, wide in seed adaptation area, large in yield increase potential and high in economic benefit. The pericarp of akebia trifoliate is various in color, green in immature state, and the color is changed greatly in mature state, and the pericarp is changed into white, pink, purple and other colors. The Akebia trifoliata has important edible and ornamental values, the Akebia trifoliata is taken as a novel fruit, the appearance quality such as the color of the fruit peel, the shape and the size of the fruit and the like of the Akebia trifoliata directly influences the commodity value of the Akebia trifoliata, the color of the fruit peel is taken as an important agronomic property of the Akebia trifoliata, good color, flavor and quality can be shown only after the fruit is ripe to a certain extent, the appearance color of the fruit is the most visual expression of whether each property of the fruit meets the purchase requirements of people and is ripe, and the significance is great. As an ornamental plant, fruit viewing is also an important content, color is one of the most important ornamental traits of ornamental plants, and pigment metabolism has been a research hotspot in ornamental plants.

Anthocyanin is an important flavonoid compound, comes from the phenylpropionic acid/flavonoid biosynthesis pathway, is a glycosylated polyphenol compound, belongs to a large class of plant secondary metabolites, and has a series of colors from blue to red to purple in flowers, seeds, fruits and nutrient tissues. In akebia trifoliate, the fruit quality of the akebia trifoliate is affected by the main pigment substance determining the color of the pericarp, and the colored fruits are hardly accepted by consumers in the market. The anthocyanin is taken as a plant pigment with natural biological activity, has strong oxidation resistance, is vital to plant adaptation and severe environmental condition resistance due to synthesis and accumulation in a nutrition organ, and can enhance the resistance of plants to different biotic and abiotic stresses. Furthermore, foods rich in anthocyanins are becoming increasingly popular for their attractive color and benefit to human health. Such as preventing cardiovascular diseases, reducing diabetes, controlling obesity, etc.

ANS (anthocyanin synthase) is the 2 nd key enzyme in the middle and later stages of anthocyanin synthesis, is a dioxygenase dependent on FeII/2-oxoglutarate, can catalyze the dehydroxylation of C-4, forms a double bond on the C ring, converts colorless anthocyanin into colored anthocyanin, and is of great importance to the color formation of plants. Some reports reveal that ANS is involved in regulating anthocyanin biosynthesis, and that point mutations occur in the ANS gene in onion scales, which alter the color of guarana and american red onion scales; the recombinant PpANS protein in peach can catalyze the formation of anthocyanin from colorless anthocyanin; the pink property of onion is related to mutation of ANS gene, and the expression quantity is obviously reduced in pink onion; whereas ANS overexpression increases the accumulation of flavonoids and anthocyanins in rice (Oryza sativa L) plants, the seed coats appear purplish red. These results demonstrate that the ANS gene can be involved in plant anthocyanin biosynthesis. At present, the effect of an ANS gene in the synthesis of the anthocyanin of akebia trifoliate is not reported yet.

Currently, the research on the biosynthesis regulation of the anthocyanin of the akebia trifoliate is limited, so that candidate genes for the biosynthesis regulation of the anthocyanin of the akebia trifoliate are excavated, and theoretical and technical support can be provided for quality improvement and molecular breeding of the akebia trifoliate or other genus of the akebia trifoliate.

Disclosure of Invention

The invention aims to solve the technical problems and overcome the defects and shortcomings in the background technology, and provides an Akebia trifoliata anthocyanin synthesis regulatory gene AtrANS, and a coding protein and application thereof.

In order to solve the technical problems, the technical scheme provided by the invention is as follows:

the nucleotide sequence of the Akebia trifoliata anthocyanin synthesis regulatory gene AtrANS is shown as SEQ ID NO: 1.

A primer pair for cloning the gene AtrANS according to claim 1, wherein the base sequence is as follows:

an upstream primer: 5'-AATTGCACCAAGACGAAA-3' (SEQ ID NO: 3);

a downstream primer: 5'-AATGTCATCAAGAGTGGTAC-3' (SEQ ID NO: 4).

An over-expression vector comprising the vector PBI121-GFP, comprising the gene AtrANS according to claim 1 in said vector PBI 121.

A primer pair for constructing the overexpression vector according to claim 3, which has the following base sequence:

an upstream primer: 5'-GAGAACACGGGGGACTCTAGAATGGCAACACAAGTAGAGTAAAGTT ACA-3' (SEQ ID NO: 5);

a downstream primer: 5'-GCTCACCATGGATCCTCTAGATTATTTGGAGAGGAGAGTTTCTTGG-3' (SEQ ID NO: 6).

A virus-induced gene silencing vector comprising vector TRV2, comprising the gene atrabs of claim 1 in the vector TRV 2.

A primer pair for constructing the gene silencing vector of claim 5, having the following base sequence:

an upstream primer: 5'-AAGGTTACCGAATTCTCTAGAACTAAAGGCTGTTGGTGAAGCTTT-3' (SEQ ID NO: 7);

a downstream primer: 5'-TCCCCATGGAGGCCTTCTAGAATCTCTATGGTGTCCCCAATGTG-3' (SEQ ID NO: 8).

The coding protein of the gene AtrANS has an amino acid sequence shown in SEQ ID NO: 2.

Based on a general inventive concept, the invention also provides application of the gene AtrANS in improving anthocyanin content in akebia trifoliate peel.

Based on a general inventive concept, the invention also provides application of the gene AtrANS in cultivating new varieties of high anthocyanin plants.

Preferably, the plant is akebia trifoliata.

Compared with the prior art, the invention has the beneficial effects that:

1. the invention discovers the anthocyanin synthesis regulatory gene AtrANS of akebia trifoliate for the first time, and discloses the nucleotide sequence and the sequence of the coding protein thereof, and can promote the accumulation of anthocyanin by expressing an ANS gene in the akebia trifoliate transiently, and can reduce the accumulation of anthocyanin by silencing the gene.

2. The invention also discloses an overexpression vector and a silencing vector containing the AtrANS gene, and provides application of the gene AtrANS in improving anthocyanin content in the pericarp of akebia trifoliata and in cultivating plant varieties with high anthocyanin content.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is an analysis of the functional domain of the amino acid sequence of the AtrANS in an embodiment of the invention;

FIG. 2 is an analysis of the expression of the AtrANS gene in different phenotypes of Akebia trifoliata (note: white peel (LW), pink peel (GP), purple peel (ZP); S1, green ripening stage; S2, color shifting stage; S3, coloring stage);

FIG. 3 is a graph showing that overexpression of AtrANS in the pericarp of Akebia trifoliata promotes anthocyanin accumulation in the examples of the present invention; (A) The transient over-expression of the AtrANS gene is carried out on pericarps of akebia trifoliate, and the pericarps which are not injected are used as negative controls; (B) One week after injection, the real-time expression level of the atrabs around the injection site; (C) anthocyanin content in the pericarp around the injection site; data are mean of 3 independent biological replicates, statistically analyzed against corresponding controls using Student's t test (< 0.05, <0.01, < P);

FIG. 4 is a functional analysis of the AtrANS gene based on TRV virus-induced gene silencing in an embodiment of the invention; (a) silencing of the atrANS gene during the transchronicity of Akebia trifoliata; (C) One week after injection, the relative expression of atrabs around the injection site; (B) pericarp anthocyanin content around injection site; data are mean of 3 independent biological replicates, statistically analyzed with the Student's t test against the corresponding control (P <0.05, < P < 0.01).

Detailed Description

The present invention will be described more fully hereinafter with reference to the accompanying drawings, in which preferred embodiments are shown, for the purpose of illustrating the invention, but the scope of the invention is not limited to the specific embodiments shown.

Unless defined otherwise, all technical and scientific terms used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the scope of the present invention.

Unless otherwise specifically indicated, the various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or may be prepared by existing methods.

Examples:

the invention identifies the structural gene differentially expressed in the synthesis process of the pericarp anthocyanin of the akebia trifoliate and identifies a key ANS gene. The invention selects purple peel ZP (germplasm name is hybridization 30) as a template to separate and identify ANS genes in akebia trifoliate. The functional domain, the amino acid sequence, the three-dimensional structure of the protein, the isoelectric point and the like of the target gene in the akebia trifoliata obtained by cloning are analyzed through bioinformatics software, the biological function of the gene is predicted by combining related researches, and the gene is named as AtrANS based on the function prediction of the gene. Then, the function of the gene is verified by constructing an over-expression vector and constructing a TRV virus-mediated gene silencing expression vector to transiently transform the pericarp of akebia trifoliate. Analysis of phenotype and anthocyanin-like content of the treated fruits shows that the AtrANS gene plays a role in the biosynthesis of the anthocyanin of akebia trifoliate, and the experimental result provides a theoretical basis for the research on the regulation mechanism of the biosynthesis of the anthocyanin of akebia.

1. Test materials: akebia trifoliata fruits are collected from Akebia trifoliata resource nursery of the China institute of agricultural sciences of Yuan river, hunan province, and Akebia trifoliata fresh fruits are used for the instantaneous expression of the fruits.

2. The test method comprises the following steps:

2.1 extraction and reverse transcription of total RNA from pericarp of Akebia trifoliata

Total RNA for cloning the gene of interest was isolated from fresh pericarp samples of purple pericarp ZP using the SteadyPure plant RNA extraction kit (Ai Kerui Biotech Co., ltd., china Changsha) according to the kit instructions. The purity of the RNA samples was judged by agarose gel electrophoresis.

Using Thermo Scientific RevertAid First Strand cDNA Synthesis Kit reverse transcription kit, 10. Mu.L of total RNA extracted was used as template for reverse transcription, and the system and procedure are shown in Table 1.

TABLE 1 reverse transcription reaction system

2.2 cloning of the key gene AtrANS for anthocyanin synthesis from the pericarp of Akebia trifoliata

Based on sequence information of an atlans gene (Atr 08G 041820) in akebia trifoliate genome, wherein CDS length is 1279bp, primer design is carried out by using PrimerPremier5 software, and the primer is synthesized by Beijing qing biological science and technology Co., ltd, and the nucleotide sequence is as follows:

f end primer: AATTGCACCAAGACGAAA (SEQ ID NO: 3);

r terminal primer: AATGTCATCAAGAGTGGTAC (SEQ ID NO: 4);

the amplification of the target gene using ZP fruit cDNA as a template and KOD FX DNA Polymerase (TOYOBO, japan), PCR reaction system and PCR reaction procedure are shown in table 2.

TABLE 2PCR reaction System and program

First, the target gene PCR product was separated by 1.0% (W/V) agarose gel electrophoresis, and the presence or absence of a single bright target band was observed in a gel imaging system. Subsequently, the target band was recovered and purified using a gel recovery kit (Omega D2400-01, omega, U.S.A.). The purity of the product was determined by agarose gel electrophoresis.

2.3 cloning ligation and transformation of the Gene of interest AtrANS

The recovered gene product of interest was ligated into cloning vectors by blunt end ligation using the pEASY-Blunt Cloning Vector cloning vector kit (full gold Biotechnology Co., ltd., beijing) into Table 3. The ligation product was transformed into DH5a competence (Beijing, biotechnology Co., ltd.) by heat shock method, and after resuscitating, it was spread uniformly on LB medium containing kanamycin, and cultured in an incubator at 37℃overnight in an inverted manner to form single colonies. The monoclonal was picked up and scattered in 10. Mu.L of sterilized ultra pure water, and PCR was performed on the monoclonal with Taq DNA polymerase (full gold Biotechnology Co., beijing) using the universal primer on pEASY vector, and the reaction system and the procedure are shown in Table 4. Positive clone bacterial liquid is subjected to amplification culture in LB culture medium containing kanamycin, and then is entrusted to sequencing by Beijing qingke biotechnology Co. The sequencing result was aligned with the target gene CDS sequence by NCBI BlastN and DNAMAN Version 9.

TABLE 3 cloning vector ligation System and procedure

TABLE 4PCR reaction System and program

2.4 construction of the Gene expression vector of interest

Binary expression vector PBI121-GFP was used to construct expression vectors containing the ORF sequence of the AtrANS gene (Atr 08G 041820). The PBI121-GFP sequence is used as a carrier sequence, and the target gene sequence is used as a connecting sequence. Selecting Quick Cut ^TM XbaI is used as a restriction site, and a PCR primer with an enzyme cutting site is designed, wherein the nucleotide sequence is as follows:

f end primer: GAGAACACGGGGGACTCTAGAATGGCAACACAAGTAGAGTAAAGTTAC A (SEQ ID NO: 5);

r terminal primer: GCTCACCATGGATCCTCTAGATTATTTGGAGAGGAGAGTTTCTTGG (SEQ ID NO: 6);

PCR amplification (PCR amplification system as shown in Table 2) was performed using a cloning plasmid containing the ORF sequence of the AtrANS gene as a template, and the AtrANS gene fragment was obtained by agarose gel electrophoresis, gel recovery and purification. By QuickCut ^TM The PBI121-GFP plasmid DNA was digested with XbaI restriction enzyme, the reaction system is shown in Table 5, and the digested product was recovered and purified by electrophoresis to obtain a linearized vector fragment, and the purity and concentration were determined by agarose gel electrophoresis.

Using ClonExpress ^R II One Step Cloning Kit (Nanjinouzan Biotechnology Co., ltd., china) was subjected to seamless cloning ligation, and the AtrANS gene fragment was ligated with a linearized PBI121-GFP vector, the ligation system being shown in Table 6. The ligation product was transformed into DH5a competent cells (Peking Optimaceae)Science and technology Co., ltd., china) was uniformly spread on LB solid medium containing kanamycin, and cultured overnight at 37 ℃. The single clone growing on the plate is subjected to PCR detection by using an F end primer on the PBI121-GFP vector and an R end primer of the AtrANS gene, and then sequencing is carried out by the Beijing qing family biotechnology Co. The correctly sequenced monoclonal bacterial solution was selected for plasmid extraction, transformed with Agrobacterium GV3101 competent (Beijing engine biotechnology Co., ltd., china), then plated onto solid LB medium containing kanamycin and rifampicin, and cultured at 28℃for 2 days. After single colony growth, single clones were harvested for PCR validation, positive clones were grown up in liquid LB medium and stored in-80℃refrigerator with 1:1 of 50% glycerol for subsequent infection.

Table 5 cleavage reaction System and reaction procedure

Table 6 connection system

2.5 construction of silencing vector induced by the Gene VIGS Virus

Carrying out homologous comparison on CDS sequences of the AtrANS genes cloned from ZP Akebia trifoliata peel samples in an Akebia trifoliata genome sequence and an NCBI database, and selecting a 543bp fragment with high homology to design specific primers of the AtrANS genes, wherein the sequences of the primers are as follows:

f end primer: AAGGTTACCGAATTCTCTAGAACTAAAGGCTGTTGGTGAAGCTTT (SEQ ID NO: 7);

r terminal primer: TCCCCATGGAGGCCTTCTAGAATCTCTATGGTGTCCCCAATGTG (SEQ ID NO: 8);

the highly homologous atrabs gene fragment was ligated with linearized TRV2 vector to construct a vector, the vector construction procedure being as described previously in section 2.4.

2.6 analysis of transient overexpression of the pericarp of Akebia trifoliata

Configuration of transient expression aggressive liquor: the stored PBI121-GFP overexpressing Agrobacterium containing the AtrANS gene was activated in LB solid medium by streaking and cultured in the dark in a constant temperature incubator at 28 ℃. The monoclonal was then selected and inoculated into 1mL of liquid LB medium (containing kanamycin and rifampicin) and incubated overnight at 200r/min in a constant temperature shaker at 28℃until cloudy. Next, we transferred 100. Mu.L of the above broth to 50mL of liquid LB medium (containing kanamycin and rifampicin) and incubated overnight at 200r/min in a constant temperature shaker at 28 ℃. Finally, the bacterial solution was centrifuged at 5000rpm for 15 minutes, the medium was discarded and the pellet resuspended in MMA buffer (10 mM MgCl) ₂ 10mM MES, 200. Mu.M acetosyringone, pH=5.6) and OD ₆₀₀ The value was adjusted to about 0.8 and 0.1% tween was added.

Infection of fresh akebia fruit peel: fruits with similar maturity and no mechanical damage and diseases and insect pests are selected as injection materials, fruits injected with a PBI121-GFP over-expression vector agrobacterium solution containing target gene fragments are used as experimental groups, the PBI121-GFP agrobacterium solution without target genes is injected and fruits without any treatment are used as negative controls, the resuspended bacteria solution is injected into pericarps by a compression method by using a 5mL sterile injector, the experiment is carried out in the S1 period, different parts of the fruits are injected, at least 2mL bacteria solution is injected into each part, and at least 20 fruits are injected into each group. After one week the fruits were retrieved from the tree, color phenotype digital photographs were taken, and the colored pericarp tissue was excised near the injection site, flash frozen in liquid nitrogen and stored in an ultra-low temperature refrigerator at-80 ℃.

2.7 analysis of Lespedeza trifoliata pericarp Virus mediated Gene silencing

Preparing a dip dyeing liquid: the method is the same as the 2.6 section, the constructed TRV2 silencing vector containing the AtrANS gene, the empty-load TRV2 silencing vector and the TRV1 agrobacterium solution are taken for activation and resuspended in MMA buffer, the TRV2 silencing vector containing the AtrANS gene and the empty-load TRV2 vector heavy suspension are respectively mixed with the TRV1 heavy suspension according to the volume ratio of 1:1, and 0.1 percent of Tween is added for preparing the intrusion solution.

Infection of fresh akebia fruit peel: and (3) standing the prepared dyeing solution at room temperature for 2 hours for use. With TRV2-AtrANS+TRV1 as experimental group and TRV2+TRV1 and non-injected as negative control, fresh Akebia trifoliata peel is infected in the S2 color transfer period, and the infection method is the same as that in section 2.6.

2.8 RT-qPCR determination of the expression level of the target Gene in the pericarp of Akebia trifoliata

Total RNA was extracted from pink pericarp (GP), purple pericarp (ZP), white pericarp (LW) using the SteadyPure Plant RNA Extraction Kit kit (Ai Kerui, changsha, china) according to the reference instructions. cDNA was synthesized using Evo M-MLV RT Premix for qPCR kit (Ai Kerui). The Primer is designed by Primer 5 and synthesized by the Optimago (Beijing). The primer sequence is 5'-AAGCGATTACATTGAGGT-3' (shown as SEQ ID NO: 9); 5'-GTAGAGGGCACTTAGGGT-3' (SEQ ID NO: 10). qRT-PCR reactions used 2X Sybr Green qPCR Mix mixtures (Aidlab, beijing, china), systems and procedures are shown in Table 7. 3 biological replicates were performed on a Bio-rad cfx96 Touch fluorescent quantitative PCR apparatus (Bio-rad, USA), each replicate performed 3 technical replicates for each reaction. A melting curve was generated at the end of each run for each sample. Raw data were analyzed using Excel 2016 and gene expression levels were determined using the 2- ΔΔCT method.

TABLE 7RT-qPCR reaction System and procedure

2.9 anthocyanin content in the pericarp of Akebia trifoliata

The specific extraction steps of anthocyanin in the colored pericarp of akebia trifoliate comprise: the sample is fully ground in liquid nitrogen, 1g of the sample is weighed, 10mL of 1% hydrochloric acid ethanol solution is added, shaking is carried out, dark is carried out for 12h at 4 ℃,5000g is centrifuged for 10min, the supernatant is taken, 10mL of 1% hydrochloric acid ethanol solution is used for extraction once, the supernatants of the two times are combined, the supernatant is transferred to a 25mL volumetric flask, the volume is fixed by 25mL, the supernatant is taken, the absorbance of the supernatant at 530nm, 620nm and 650nm is measured, and the measurement is repeated for 3 times for each sample.

ΔA＝OD530-0.9*OD620-0.1*OD650，

TA＝(ΔA/εL)*MW*DF*V/Wt*100，

Wherein TA is total anthocyanin content (mg/100 g), epsilon is molar absorbance (26900), L is optical path (1 cm) MW is standard molecular weight (449.2), DF is dilution factor, V is final volume (mL), MW is sample weight (g).

3. Results and analysis

3.1 analysis of the sequence of the AtrANS Gene in Akebia trifoliate

Anthocyanin synthase (ANS) is a 2-oxoglutarate (2 OG) and Fe (II) -dependent oxygenase that catalyzes the penultimate step in anthocyanin biosynthesis and converts colorless anthocyanin into colored anthocyanin, whose enzymatic activity affects anthocyanin synthesis. In order to understand the function of the AtrANS (Atr 08G 041820) in akebia trifoliate, the CDS fragment of the AtrANS is isolated from cDNA of ZP, and the nucleotide sequence of the CDS fragment is shown as SEQ ID NO: 1. The fragment consists of 1279bp open reading frame, contains 2 exons and 2 introns, is predicted to encode 426 residue polypeptide, and has a molecular formula of C ₂₁₇₁ H ₃₄₄₂ N ₅₆₆ O ₆₅₇ S ₁₂ Molecular weight 48369.33 and bioinformatics analysis thereof are shown in Table 8. Analysis of the domains of the atlans protein using NCBI-CDD showed that the atlans protein contained a PLN03178 (anthocyanin synthase) multidomain protein comprising the morphine-synthesized N-terminal non-heme dioxygenase subfamily (diox_n) and 2-oxoglutarate-Fe ²⁺ -two conserved domains of the dioxygenase subfamily (2 OG-feii Oxy) (fig. 1), the amino acid sequence of the atrabs protein is shown in SEQ ID NO: 2.

TABLE 8 bioinformatics analysis of AtrANS

The atrabs gene nucleotides:

ATGGCAACACAAGTAGAGTAAAGTTACACCAAGGGTAGAGAGCTTAGCAAGCAATGGGATCCAAGCTATCCCTAAGGAGTACGACTGGAAAGAAGATCGCGAAAGCATCAACGATGTGTTCGAGGAGGAGAAGACATATAACGAAGCTCCACAGATACCCGTTATTGATTTAAATGGTGTCGATTCGGAGAAATGTAGGGAGGAGTCGAAGAAGGTTGATATTTCACCAAGGGTAGAGAGCTTGGCAAGTAGTGGGATCCAAGCTATTCCTAAGGAGTACATACGCTCGAAAGAAGAACGCGAAAGCATCAATGATGTGTTCGAGGAGGAAAAGAAGTATAACGAGGGTCCACAGATACCAACTATCGATTTAAAGGGTATCGAATCGGAGGAGGAGATGGTGAGGGAGAAATGTAGGGAGGAGTTGAAGGCGGCTTCAATGGAGTGGGGTGTAATGCATATAGTGAACCATGGTATACCTGATGATCTAATTCGTCGACTAAAGGCTGTTGGTGAAGCTTTCTTTGAACTCCCTATCGAGGAGAAGGAGAAGTATGCCAATGATCTGGCCTCGGGCAAAATCGCTGGGTATGGGAGCAAGCTTGCCAACAACGCCAACGGGCAACTCGAGTGGGAGGACTACTTCTTCCATCTCATATTTCCAGAAGAAAAGCGCGACATGTCAATTTGGCCTAAGATACCAAGCGATTACATTGAGGTGACGAGCGAGTATGCAAGGCAAATAAGAGTACTAGTGACCAAGATATTGTCAGTACTATCGCTTGGTTTGGGATTGGAAGAAGGAAGGCTAGAAACGGAAGTTGGTGGCATGGAGGAGTTATTATTGCAATTAAAGATTAACTACTACCCTAAGTGCCCTCTACCAGAATTAGCACTTGGGGTTGAAGCCCACACCGACATTAGCGCGCTCACCTTCATACTCCACAACATGGTTCCTGGCTTGCAAGTCCACTATAAAGACAAGTGGGTAACAGCAAAATGTGTCCCCGATTCAATCATCTTGCACATTGGGGACACCATAGAGATATTGAGCAATGGCAAGTACAAGAGTATACTTCATAGAGCACTAGTGAACAAGGAGAAGGTTAGGATATCGTGGCCCGTCTTCTGTGAGCCACCTAAAGAGAGCATTTTGCTCAGGCCTCTGTCTGAGCTTGTCACTGAGTCGGAGCCAGCACTCTTCCCACCTCGAACTTTTGCTCAACATATTCAACACAAGCTTTTCAAGAAAACCCAAGAAACTCTCCTCTCCAAATAA。

the atrabs protein amino acid:

MASSGIQAIPKEYIRSKEERESINDVFEEEKKYNEGPQIPTIDLKGIESEEEMVREKCREELKAASMEWGVMHIVNHGIPDDLIRRLKAVGEAFFELPIEEKEKYANDLASGKIAGYGSKLANNANGQLEWEDYFFHLIFPEEKRDMSIWPKIPSDYIEVTSEYARQIRVLVTKILSVLSLGLGLEEGRLETEVGGMEELLLQLKINYYPKCPLPELALGVEAHTDISALTFILHNMVPGLQVHYKDKWVTAKCVPDSIILHIGDTIEILSNGKYKSILHRALVNKEKVRISWPVFCEPPKESILLRPLSELVTESEPALFPPRTFAQHIQHKLFKKTQETLLSKMSIWPKIPSDYIEVTSEYARQIRVLVTKILSVLSLGLGLEEGRLETEVGGMEELLLQLKINYYPKCPLPELALGVEAHTDISALTFILHNMVPGLQVHYKDKWVTAKCVPDSIILHIGDT。

3.2 analysis of expression of the AtrANS Gene

The AtrANS gene is obtained from the transcriptome difference gene related to the anthocyanin synthesis of akebia trifoliate, and the expression analysis of the gene is carried out by utilizing pericarps with different phenotypes, so that the expression level of the gene in colored (purple and pink) materials is obviously higher than that of colorless (white) materials (see figure 2).

3.3 overexpression of AtrANS promotes the accumulation of Akebia trifoliata anthocyanin

In order to study the role of the AtrANS in the anthocyanin biosynthesis of akebia trifoliate, the invention carries out transient over-expression on the AtrANS gene in the pericarp of akebia trifoliate. PBI121-AtrANS-GFP and PBI121-GFP agrobacteria are injected into the pericarp of akebia trifoliata simultaneously, clear purple pigmentation appears after one week around the injection hole of PBI121-AtrANS-GFP compared with the empty PBI121-GFP, and fruits injected with PBI121-AtrANS-GFP and PBI121-GFP show obvious yellow color compared with CK which is not subjected to any treatment, and the fruits are possibly damaged by the injection of agrobacterium bacterial liquid and yellowing caused by stress. Compared with untreated peel, the expression level of the AtrANS in the treated peel and the anthocyanin content are obviously improved, the expression level of the AtrANS in the peel injected with the AtrANS-PBI121-GFP is 2.54 times that of the peel injected with the PBI121-GFP only and 9.15 times that of the peel not treated, the anthocyanin content also shows similar trend, and the anthocyanin content in the peel injected with the PBI121-AtrANS-GFP is highest (35.22 mg/100 g) and is obviously higher than that of the peel injected with the PBI121-GFP (15.04 mg/100 g) and the peel not treated (9.30 mg/100 g) (FIG. 3). These results indicate that the overexpression of the atrabs induces increased anthocyanin biosynthesis around the injection site, and that the atrabs positively regulates anthocyanin biosynthesis from the pericarp of akebia trifoliate.

3.4 inhibition of AtrANS by VIGS reduces anthocyanin accumulation in the pericarp of Akebia trifoliata

The function of the atrabs was further verified using the virus-induced gene silencing (VIGS) system. The agrobacteria heavy suspension of TRV2-AtrANS+TRV1 and TRV2+TRV1 is used as a material, and the agrobacteria heavy suspension is instantaneously permeated into the pericarp of akebia trifoliate in the S2 color conversion period. One week after the injection of TRV 2-atrabs+trv1, a decrease in purple pigmentation was observed at the injection site, whereas there was no more pronounced change in meat color at the site where trv2+trv1 was injected. The anthocyanin content of the pericarp around the injection site was measured and found to be significantly lower near the injection site of TRV2-AtrANS+TRV1 (46.00 mg/100 g) than the injection site of TRV2+TRV1 alone (60.97 mg/100 g) and the relative non-injection site (57.23 mg/100 g), which was closely related to the reduced expression level of AtrANS (FIG. 4). The results show that the AtrANS plays a positive regulation role in the biosynthesis of the anthocyanin of the pericarp of akebia trifoliate.

In general, the invention over-expresses the atlans gene in the pericarp of akebia trifoliate, promoting anthocyanin accumulation; silencing the AtrANS gene inhibits anthocyanin accumulation. These results demonstrate that the atlans gene can positively regulate the accumulation of anthocyanin, and promote the content of anthocyanin in the pericarp of akebia trifoliate; the method can also be used for over-expression by introducing an AtrANS gene into plants, so that the method is further applied to cultivation of new varieties of high anthocyanin plants.

Claims

1. The akebia trifoliate anthocyanin synthesis regulatory gene AtrANS is characterized in that the nucleotide sequence is shown as SEQ ID NO: 1.

2. A primer pair for cloning the gene atrabs according to claim 1, characterized in that the base sequence is as follows:

an upstream primer: 5'-AATTGCACCAAGACGAAA-3';

a downstream primer: 5'-AATGTCATCAAGAGTGGTAC-3'.

3. An over-expression vector comprising vector PBI121-GFP, wherein said vector PBI121 comprises the gene atrabs of claim 1.

4. A primer pair for constructing the over-expression vector of claim 3, which has the following base sequence:

an upstream primer: 5'-GAGAACACGGGGGACTCTAGAATGGCAACACAAGTAGAGTAAAGTT ACA-3';

a downstream primer: 5'-GCTCACCATGGATCCTCTAGATTATTTGGAGAGGAGAGTTTCTTGG-3'.

5. A virus-induced gene silencing vector comprising vector TRV2, wherein the vector TRV2 comprises the gene AtrANS according to claim 1.

6. A primer pair for constructing the gene silencing vector of claim 5, wherein the base sequence is as follows:

an upstream primer: 5'-AAGGTTACCGAATTCTCTAGAACTAAAGGCTGTTGGTGAAGCTTT-3';

a downstream primer: 5'-TCCCCATGGAGGCCTTCTAGAATCTCTATGGTGTCCCCAATGTG-3'.

7. The protein encoded by the gene atlans according to claim 1, wherein the amino acid sequence is set forth in SEQ ID NO: 2.

8. Use of the gene atrabs according to claim 1 for increasing anthocyanin content in akebia trifoliate pericarp.

9. Use of the gene atrabs according to claim 1 for breeding new varieties of high anthocyanin plants.

10. The use according to claim 9, wherein the plant is akebia trifoliata.