CN105950748A - Method for identifying high-homology marine vibrios based on rpoB genes - Google Patents
Method for identifying high-homology marine vibrios based on rpoB genes Download PDFInfo
- Publication number
- CN105950748A CN105950748A CN201610385806.6A CN201610385806A CN105950748A CN 105950748 A CN105950748 A CN 105950748A CN 201610385806 A CN201610385806 A CN 201610385806A CN 105950748 A CN105950748 A CN 105950748A
- Authority
- CN
- China
- Prior art keywords
- vibrio
- marine
- vibrios
- rpob
- glue
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for identifying high-homology marine vibrios based on rpoB genes. The method comprises the steps that firstly, marine vibrio rpoB gene specific primers are designed by analyzing an rpoB gene sequence between marine vibrio strains; secondly, genomic DNA of 50 marine vibrios serves as templates, a proper amplification system and proper amplification conditions are selected for PCR amplification with the primers, and marine vibrios are quickly and accurately identified with the combination of the sequencing technique. By means of the method, marine vibrios high in homology can be easily and quickly detected, the accuracy is high, and the problem that the accuracy in 16S rRNA sequencing identification at present is low is solved. The method can be used for monitoring and detecting water body and clinical samples and carrying out epidemiological investigation and evolution analysis on marine vibrios and the like, relates to the fields of clinical diagnosis, aquaculture, food safety and the like, and has profound and lasting social benefits and high economic benefits.
Description
Technical field
The invention belongs to Bacteria Detection technical field, be specifically related to a kind of based on RNA polymerase β subunit (rpoB) gene
Detection method, is difficult to the detection of the vibrio marinopraesens identified for homology high (16S rRNA sequence similarity is more than 99%).
Background technology
Vibrio marinopraesens is present in the dominant microflora on sea water and marine organism.Ocean aquatic animal infects vibrio and can produce
Raw disease, the sea water that the mankind are carried disease germs by the edible marine product polluted by vibrio or Wound contact also can cause infection.Vibrio reflects
Surely can be used for water body and the supervision of clinical sample and detection, the Epidemiological study of vibrio marinopraesens and evolutionary analysis etc., relate to facing
The fields such as bed diagnosis, aquaculture, food safety.U.S.'s Epidemiological study shows the infection day of vibrio marinopraesens in recent years increasingly
Weight.Therefore the qualification of vibrio marinopraesens is even more important.
At present, the qualification to vibrio marinopraesens is based primarily upon traditional microorganism detection, complex operation, and the cycle is long, is just identifying
Really rate is low.In order to improve the detection of vibrio and identify accuracy, Protocols in Molecular Biology based on DNA sequencing has been built up
Come.Well-conserved, the universality of distribution in bacterial 16 S rRNA gene molecule structure and contained bulk information thereof, make
16S rRNA gene becomes an ideal gene target sequence in microbial identification.Although 16S rRNA gene is by extensively
It is applied in microbial identification, however poor, such as vibrio, Rhodopseudomonas etc. for some strain resolving effect belonged to.People
Typically sets the 16S rRNA gene order similarity prokaryote more than 97% as same kind, but a lot of the most of the same race micro-
Its 16S rRNA gene order similarity biological is but higher than 97%.Research confirms, Vibrio 16S rRNA sequence similarity reaches
More than 99%.As vibrio parahaemolytious and vibrio alginolyticus 16S rRNA similarity reach 99.4%, vibrio alginolyticus and sea God vibrio 16S
RRNA sequence similarity reaches 100%, and therefore, 16S rRNA order-checking can not carry out secured identification to vibrio marinopraesens.
Summary of the invention
In order to solve above technical problem, the invention provides a kind of inspection identifying vibrio marinopraesens based on rpoB gene sequencing
Survey method, overcomes conventional 16S rRNA order-checking and identifies that vibrio marinopraesens identifies the problem that accuracy is low, and the present invention is simple and quick, mirror
Determine accuracy high.
Technical scheme is as follows:
1) bacteria resuscitation and cultivation: take out in ultra cold storage freezer and treat recovery bacterial strain, after verification strain number, uses sterile toothpick
The frozen thing of the appropriate solid of picking, in 2216E culture medium, uses three zoning collimation methods to inoculate, is placed in by flat board in 28 DEG C of incubators
Cultivate to 16-18 hour；
2) boiling method extracts bacterial genomes DNA: add 50 l sterilized water, the single bacterium colony of picking in aseptic EP pipe
In the most fully mixing, modulation bacterium solution, to 1-2 turbidity, is shaken 15 seconds；Put in 100 DEG C of boiling water and boil 10min, after taking-up
Place 10 minutes on ice；13000 leave the heart 5 minutes, take supernatant about 30 μ l and are DNA extraction liquid；
3) PCR amplification:
Vibrio marinopraesens rpoB gene sequencing primer, can expand the rpoB gene of vibrio marinopraesens, generates
Specific fragment between vibrio kind.Its nucleotides sequence is classified as:
PCR amplification system is:
PCR response parameter is: 94 DEG C of 8 min(denaturation)；Double-strand is opened in 94 DEG C of 40 s(degeneration), 55 DEG C of 40 s
(annealing), 72 DEG C of 1 min 30 s(extends), circulate 30 times；72 DEG C of 8 min(extends), product 4 DEG C preservation；
4) agarose gel electrophoresis detection
Loading comb is fixed in glue groove, the glue prepared is poured in offset plate, makes glue slowly flatten, it is ensured that there is no bubble
After, glue groove is placed in room temperature and makes glue solidify completely；After glue solidifies completely, gel is placed in electrophoresis tank, add 1 ×
TAE electrophoretic buffer is to not having offset plate 1-2mm；After taking 9 lPCR products and 1 l 10 × loading buffer mixing, add
In glue hole, 100V electrophoresis 30 minutes；By the gel after electrophoresis in viewed under ultraviolet radiation, it is left that the band of rpoB gene is positioned at 800bp
Right.Take positive findings PCR primer and send the order-checking of INVITROGEN TRADING (SHANGHAI) CO. LTD. company.
5) pcr amplification product sequencing result is analysed and compared: after comparison method is for using pcr amplification product direct Sequencing, sequence
5 ' ends of row and 3 ' the sequence reliabilities held are relatively low.Remove 30bp and 40bp respectively at 5 ' ends and 3 ' ends, then use in NCBI
Blast software carries out sequence alignment.In blast result, when Identification is more than 99%, it is believed that this bacterium with
The corresponding strain name provided in " Description " is consistent.
The present invention uses PCR amplification rpoB gene-specific primer for the qualification of vibrio marinopraesens, has the advantage that
1) simple and quick: traditional detection method is broadly divided into Zengjing Granule, point step such as pure, microscopy and biochemical test, detection week
Phase is long, and the positive detection cycle at least needs 72 hours, and complex operation.Round pcr based on order-checking can terminate in 12 hours,
It it is a kind of detection means simple, quick.
2) identify that accuracy is high: between many vibrio marinopraesens kinds, biochemical reaction is similar to, and is difficult to district with conventional biochemical authentication method
Point, identify that accuracy is low, molecular biology method the most more advantage based on DNA sequencing.The present invention is by finding vibrio marinopraesens
Fragment special between conservative species in the kind of rpoB gene, designs primer.Then primer sets is utilized to synthesize PCR detection system, energy
The most directly by high homology vibrio marinopraesens the most separately.The present invention has carried out rpoB order-checking to 50 strain vibrio marinopraesenses and 16S rRNA surveys
Sequence, result shows, vibrio marinopraesens is identified that accuracy reaches 92% by rpoB order-checking, is just being significantly higher than the qualification of 16S rRNA order-checking
Really rate (18%).Therefore, in the classification and qualification of high homology vibrio marinopraesens (16S rRNA sequence similarity is more than 99%),
RpoB gene can be as than the 16S more preferable molecular target of rRNA gene.At this it is emphasized that 16S rRNA with rpoB order-checking is right
The vibrio marinopraesens relatively low in qualification 16S rRNA sequence similarity is the most applicable, is identifying that 16S rRNA sequence similarity is higher,
Especially sequence similarity more than 99% vibrio marinopraesens time, rpoB check order the most advantageously.
Accompanying drawing explanation
Fig. 1 is 2 strain Vibrio harveyi pcr amplification product sepharose electrophoresis figures, and 1,2 expand electrophoretogram for rpoB, and 3,4 is 16S
RNA amplification electrophoretogram；
Fig. 2 is VIB 651 rpoB order-checking comparison chart；
Fig. 3 is VIB642 rpoB order-checking comparison chart；
Fig. 4 is VIB651 16S rRNA order-checking comparison chart；
Fig. 5 is VIB642 16S rRNA order-checking comparison chart.
Detailed description of the invention
Below in conjunction with embodiment, the present invention is further illustrated.
Embodiment 1
The present embodiment is with 50 strain vibrio marinopraesenses as object of study, including Vibrio harveyi (25 strain), vibrio parahaemolytious (10 strain), molten algae
Vibrio (7 strain), vibrio mimicus (2 strain), Vibrio anguillarum (2 strain), Vibrio splindidus (2 strain), tower vibrio (1 strain), vibrio orientalis (1
Strain).Selected microorganism is shown in Table microorganism in 1.
During for confirming detection homology high vibrio marinopraesens, rpoB gene sequencing has superiority than 16S rRNA order-checking, this reality
Execute example and 50 strain vibrio marinopraesenses are carried out 16S rRNA Yu rpoB order-checking simultaneously, and sequencing result is compared.
Method particularly includes:
1) bacteria resuscitation and cultivation: take out in ultra cold storage freezer and treat recovery bacterial strain, after verification strain number, uses sterile toothpick
The frozen thing of the appropriate solid of picking, in 2216E culture medium, uses three zoning collimation methods to inoculate, is placed in by flat board in 28 DEG C of incubators
Cultivate 16-18 hour；
2) boiling method extracts bacterial genomes DNA: add 50 l sterilized water, the single bacterium of picking in aseptic EP pipe
Falling within and the most fully mix, modulation bacterium solution, to 1-2 turbidity, is shaken 15 seconds；Put in 100 DEG C of boiling water and boil 10min, take out
After place 10 minutes on ice；13000 leave the heart 5 minutes, take supernatant about 30 μ l and are DNA extraction liquid.
3) PCR amplification:
Amplification step: PCR amplification system is
2×PCRmix Taq 25 µl；
10 μMs of forward primer 1 l；
10 μMs of downstream primer 1 l；
Deionized water 20 l；
DNA profiling 1 l；
PCR response parameter is: 94 DEG C of 8 min(denaturation)；Double-strand is opened in 94 DEG C of 40 s(degeneration)；55 DEG C of 40 s(moves back
Fire)；72 DEG C of 1 min 30 s(extends)；72 DEG C of 8 min(extends)；Circulate 30 times, product 4 DEG C preservation；
Primer illustrates: 16S rRNA, rpoB order-checking is except the primer difference when PCR expands, and remaining step is the most identical.16S
The universal primer of rRNA sequencing primer reference literature report.RpoB gene sequencing design of primers step: search for mesh in GenBank
Front surveyed vibrio marinopraesens and the rpoB gene order of other γ-mycetozoans, log in http://www.ebi.ac.uk/Tools/
Msa/clustalo/ carries out tetraploid rice, determines in vibrio fragment special between conservative, other γ-mycetozoans.Foundation
Vibrio rpoB gene specific conserved sequence, we use two primers of Primer 5 software design, amplified fragments size
At about 800bp.Primer is by the synthesis of Ying Weijie base trade Co., Ltd.
4) pcr amplification product sepharose electrophoresis detection: loading comb is fixed in glue groove, pours the glue prepared into offset plate
In, make glue slowly flatten, it is ensured that after there is no bubble, glue groove is placed in room temperature and makes glue solidify completely；Glue solidifies completely
After, gel is placed in electrophoresis tank, adds 1 × TAE electrophoretic buffer to not having offset plate 1-2mm；Take 9 lPCR products and 1 l
After 10 × loading buffer mixing, add in glue hole, 100V electrophoresis 30 minutes；Gel after electrophoresis is seen under ultraviolet
Examining, the band of 16S rRNA gene is positioned at about at 1500bp, and the band of rpoB gene is positioned at about 800bp.Take positive findings
PCR primer send INVITROGEN TRADING (SHANGHAI) CO. LTD. company's order-checking (order-checking comparative result is shown in Table 2)；
5) pcr amplification product sequencing result is analysed and compared: after pcr amplification product order-checking, removes 30bp respectively at 5 ' ends and 3 ' ends
And 40bp, then use blast software in NCBI to carry out 16S rRNA and rpoB gene order comparison.In blast result, when
When Identification is more than 99%, it is believed that this bacterium is consistent to the corresponding strain name provided in " Description "；
Comparison result statistics display (table 2), 9 strain bacterium (18%) in 50 strain bacterium only can correctly be identified by 16S rRNA order-checking, surplus
41 strain bacterium (82%) of Yuing obtain the qualification result inconsistent with raw information, wherein 35(70%) strain bacterium is due in comparison result
The Identification bacterial strain more than 99% has and multiple causes final qualification result to accept or reject.The qualification of 16S rRNA order-checking
Accuracy low owing to vibrio various between 16S rRNA sequence very high homology, such as Vibrio harveyi and vibrio alginolyticus 16S rRNA phase
Reaching 99.0% like degree, vibrio parahaemolytious and vibrio alginolyticus 16S rRNA similarity reach 99.4%, vibrio alginolyticus and sea God vibrio 16S
RRNA sequence similarity reaches 100%, and vibrio mimicus and vibrio cholera 16S rRNA sequence similarity reach 100% etc..And rpoB order-checking
Then 46 strains (92%) in 50 strain bacterium correctly can be identified, be significantly higher than the qualification accuracy (18%) of 16S rRNA order-checking.This
Lower than 16S rRNA sequence similarity owing to vibrio rpoB sequence similarity, wherein Vibrio harveyi and vibrio alginolyticus rpoB sequence
Row similarity is 95.7%, and vibrio parahaemolytious and vibrio alginolyticus rpoB sequence similarity are 96.8%, vibrio alginolyticus and sea God vibrio
RpoB sequence similarity is 96.9%, and vibrio mimicus and vibrio cholera rpoB sequence nucleotide sequence similarity are 95.8%, is below corresponding
16S rRNA sequence similarity.Thus it is less to illustrate that 16S rRNA gene belongs to interspecific difference for high homology vibrio marinopraesens,
Resolving power is limited.RpoB gene is compared 16S rRNA gene and is had higher species specificity, the accuracy when identifying vibrio marinopraesens
Higher.
。
Embodiment 2
Use 2 strain Vibro harveyi VIB 651, VIB 642 for identifying bacterial strain, carry out 16S rRNA, rpoB order-checking respectively.16S
RRNA, rpoB sequencing procedure is except the primer difference when PCR expands, and remaining step is the most identical.
1) bacteria resuscitation and cultivation: take out in ultra cold storage freezer and treat recovery bacterial strain VIB 651, VIB642, check bacterial strain
After numbering, with the sterile toothpick picking frozen thing of appropriate solid in 2216E culture medium, three zoning collimation methods are used to inoculate, will be flat
Plate is placed in 28 DEG C of incubators cultivation 16-18 hour.
2) bacterial genomes DNA is extracted: adding 50 l sterilized water in aseptic PCR pipe, the single bacterium colony of picking is in the most abundant
Mixing, modulation bacterium solution, to 1-2 turbidity, is shaken 15 seconds；Put in 100 DEG C of boiling water and boil 10min, after taking-up, place 10 points on ice
Clock；13000 leave the heart 5 minutes, take supernatant about 30 μ l and are DNA extraction liquid.
3) PCR amplification: PCR amplification system (totally 50 l) is 2 × PCRmix Taq 25 l；Forward primer 1 l；Downstream
Primer 1 l；Deionized water 20 l；DNA profiling 1 l.PCR response parameter is: 94 DEG C of 8 min(denaturation)；94 ℃ 40 s
(double-strand is opened in degeneration)；55 DEG C of 40 s(annealing)；72 DEG C of 1 min 30 s(extends)；72 DEG C of 8 min(extends)；Circulation
30 times, product 4 DEG C preservation.
The detection primer sequence of 16S rRNA gene is:
27F:5 '-AGAGTTTGATC (C/A) TGGCTCAG-3 ' (SEQ:ID:NO:3)
1492R:5’- TACGG(C/T)TACCTTGTTACGAC-3’(SEQ:ID:NO:4)
The detection primer sequence of rpoB gene is:
F1: 5’AGGCGTGTTCTTCGACAGCGATAA3’
R1: 5’TCGTCCACTTCGCCTTTACC3’
4) pcr amplification product sepharose electrophoresis detection: loading comb is fixed in glue groove, pours the glue prepared into offset plate
In, make glue slowly flatten, it is ensured that after there is no bubble, glue groove is placed in room temperature and makes glue solidify completely；Glue solidifies completely
After, gel is placed in electrophoresis tank, adds 1 × TAE electrophoretic buffer to not having offset plate 1-2mm；Take 9 lPCR products and 1 l
After 10 × loading buffer mixing, add in glue hole, 100V electrophoresis 30 minutes；Gel after electrophoresis is seen under ultraviolet
Examining, the band of 16S rRNA gene is positioned at about at 1500bp, and the band of rpoB gene is positioned at about 800bp (Fig. 1).Take the positive
Result PCR primer send the order-checking of INVITROGEN TRADING (SHANGHAI) CO. LTD. company；
5) pcr amplification product sequencing result is analysed and compared: after comparison method is for using pcr amplification product direct Sequencing, sequence
5 ' ends and 3 ' the sequence reliabilities held are relatively low.Remove 30bp and 40bp respectively at 5 ' ends and 3 ' ends, then use blast in NCBI
Software carries out 16S rRNA and rpoB gene order comparison.In blast result, when Identification is more than 99%, can
Think that this bacterium is consistent to the corresponding strain name provided in " Description ".VIB 651 rpoB sequencing result
The Identification 18 strains that are shown as more than 99% are Vibrio harveyi (Fig. 2), VIB 642 rpoB sequencing result
The Identification 12 strains that are shown as more than 99% are also Vibrio harveyi (Fig. 3).And 16S rRNA sequencing result
Identification is shown as multiple the most of the same race more than 99%.Wherein VIB 651 16S rRNA sequencing result
Identification has 22 strain bacterium more than 99%, and 10 strains identify vibrio, 6 strain vibrio parahaemolytious, 3 strain vibrio alginolyticus, and 1
Strain Vibrio harveyi, 1 strain vibrio azureus, 1 strain Bacillus bacteria (Fig. 4).VIB 642 16S rRNA sequencing result
Identification has 19 strain bacterium more than 99%, and 8 strains identify vibrio, 5 strain vibrio alginolyticus, 3 strain vibrio parahaemolytious, 2 strains
Vibrio harveyi, 1 strain vibrio azureus(Fig. 5).Therefore 16S rRNA order-checking can not precise Identification to kind a level.
In sum, the present invention is by the design of vibrio marinopraesens rpoB gene primer, the groping of PCR reaction condition, building
The method that vertical a kind of resolving power is high, for expanding the rpoB sequence of vibrio marinopraesens, is compared with sequence in NCBI by order-checking,
Setting up Bacteria Detection diagnostic method, accuracy is better than 16S rRNA order-checking.
<110>Hu Chengjin
<120>a kind of method based on rpoB gene identification height homology vibrio marinopraesens
<160>2
<210>1
<211>24
<212>DNA
<213>artificial sequence
<220>
<221>misc_feature
<222>(1)..(24)
<223>primer
<400>1
AGG CGT GTT CTT CGA CAG CGA TAA 24
<210>2
<211>20
<212>DNA
<213>artificial sequence
<220>
<221>misc_feature
<222>(1)..(20)
<223>primer
<400>2
TCG TCC ACT TCG CCT TTA CC 20
Claims (1)
1. a method based on rpoB gene identification height homology vibrio marinopraesens, it is characterised in that comprise the steps of
1) bacteria resuscitation and cultivation:
Ultra cold storage freezer takes out and treats recovery bacterial strain, after verification strain number, with the sterile toothpick picking frozen thing of appropriate solid
In 2216E culture medium, use three zoning collimation methods to inoculate, flat board is placed in 28 DEG C of incubators cultivation 16-18 hour；
2) boiling method extraction bacterial genomes DNA:
Adding 50 l sterilized water in aseptic EP pipe, the single bacterium colony of picking is in the most fully mixing, and modulation bacterium solution, to 1-2 turbidity, is shaken
Swing 15 seconds；Put in 100 DEG C of boiling water and boil 10min, place 10 minutes on ice after taking-up；13000 leave the heart 5 minutes, take
Clear liquid about 30 μ l is DNA extraction liquid；
3) PCR amplification:
Its nucleotides sequence is classified as:
VF 5’AGGCGTGTTCTTCGACAGCGATAA3’；
VR 5’TCGTCCACTTCGCCTTTACC3’；
PCR amplification system is:
2×PCRmix Taq 25µl；
10 μMs of primer VF 1 l；
10 μMs of primer VR 1 l；
ddH2O 20µl；
DNA profiling 1 l；
PCR response parameter is: 94 DEG C of 8 min；94 DEG C of 40 s, 55 DEG C of 40 s, 72 DEG C of 1 min 30 s, circulates 30 times；
72 DEG C of 8 min, product 4 DEG C preservation；
4) agarose gel electrophoresis detection
Loading comb is fixed in glue groove, the glue prepared is poured in offset plate, makes glue slowly flatten, it is ensured that there is no bubble
After, glue groove is placed in room temperature and makes glue solidify completely；After glue solidifies completely, gel is placed in electrophoresis tank, add 1 ×
TAE electrophoretic buffer is to not having offset plate 1-2mm；After taking 9 lPCR products and 1 l 10 × loading buffer mixing, add
In glue hole, 100V electrophoresis 30 minutes；By the gel after electrophoresis in viewed under ultraviolet radiation, it is left that the band of rpoB gene is positioned at 800bp
Right；Take the order-checking of positive findings PCR primer；
5) pcr amplification product sequencing result is analysed and compared:
After using pcr amplification product direct Sequencing, 5 ' ends of sequence and 3 ' the sequence reliabilities held are relatively low；At 5 ' ends and 3 ' ends point
Not Qu Chu 30bp and 40bp, then use blast software in NCBI to carry out sequence alignment；In blast result, when
When Identification is more than 99%, it is believed that this bacterium is consistent to the corresponding strain name provided in " Description ".
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610385806.6A CN105950748A (en) | 2016-06-03 | 2016-06-03 | Method for identifying high-homology marine vibrios based on rpoB genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610385806.6A CN105950748A (en) | 2016-06-03 | 2016-06-03 | Method for identifying high-homology marine vibrios based on rpoB genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105950748A true CN105950748A (en) | 2016-09-21 |
Family
ID=56908285
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610385806.6A Pending CN105950748A (en) | 2016-06-03 | 2016-06-03 | Method for identifying high-homology marine vibrios based on rpoB genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105950748A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109811034A (en) * | 2019-03-30 | 2019-05-28 | 西北农林科技大学 | A kind of preparation method of high-purity DNA profiling |
| CN111534607A (en) * | 2019-09-02 | 2020-08-14 | 广州微芯生物科技有限公司 | Fluorescent quantitative PCR method for detecting toxigenic vibrio cholerae and corresponding kit |
| CN113416743A (en) * | 2021-07-26 | 2021-09-21 | 广东省农业科学院动物卫生研究所 | Nucleic acid molecule, PCR primer pair and kit for detecting avian trichomonas rpoB gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101067155A (en) * | 2007-06-05 | 2007-11-07 | 宁波大学 | Marine vibrio multiple PCR reaction reagent kit and detecting method thereof |
| CN103215347A (en) * | 2012-03-13 | 2013-07-24 | 山东出入境检验检疫局检验检疫技术中心 | Fluorescence quantitative PCR rapid detection method of Vibrio metschnikovii in aquatic product based on TaqMan |
-
2016
- 2016-06-03 CN CN201610385806.6A patent/CN105950748A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101067155A (en) * | 2007-06-05 | 2007-11-07 | 宁波大学 | Marine vibrio multiple PCR reaction reagent kit and detecting method thereof |
| CN103215347A (en) * | 2012-03-13 | 2013-07-24 | 山东出入境检验检疫局检验检疫技术中心 | Fluorescence quantitative PCR rapid detection method of Vibrio metschnikovii in aquatic product based on TaqMan |
Non-Patent Citations (1)
| Title |
|---|
| JANG-SEU KI等: "Analysis of RNA Polymerase Beta Subunit (rpoB) Gene Sequences for the Discriminative Power of Marine Vibrio Species", 《MICROB ECOL》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109811034A (en) * | 2019-03-30 | 2019-05-28 | 西北农林科技大学 | A kind of preparation method of high-purity DNA profiling |
| CN111534607A (en) * | 2019-09-02 | 2020-08-14 | 广州微芯生物科技有限公司 | Fluorescent quantitative PCR method for detecting toxigenic vibrio cholerae and corresponding kit |
| CN113416743A (en) * | 2021-07-26 | 2021-09-21 | 广东省农业科学院动物卫生研究所 | Nucleic acid molecule, PCR primer pair and kit for detecting avian trichomonas rpoB gene |
| CN113416743B (en) * | 2021-07-26 | 2023-06-16 | 广东省农业科学院动物卫生研究所 | Nucleic acid molecule, PCR primer pair and kit for detecting trichomonas fowl rpoB gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Massana et al. | Changes in marine bacterioplankton phylogenetic composition during incubations designed to measure biogeochemically significant parameters | |
| van Opijnen et al. | Genome‐Wide Fitness and Genetic Interactions Determined by Tn‐seq, a High‐Throughput Massively Parallel Sequencing Method for Microorganisms: Emerging Technologies | |
| CN101617057B (en) | Microorganism detection method and microorganism detection kit | |
| CN102757960B (en) | Semi-random polymerase chain reaction (PCR) technique for amplifying unknown sequence and primer and kit used for technique | |
| ES2510216A1 (en) | Micro-organism that can convert ellagic acid and ellagitannins into urolithins and use of same | |
| ES2616235T3 (en) | Ratiometric analysis of pre-rRNA | |
| CN105950748A (en) | Method for identifying high-homology marine vibrios based on rpoB genes | |
| CN102154497B (en) | M-PCR (Multiplex Polymerase Chain Reaction) primers, probes and detection methods for vibrio cholerae, vibrio parahaemolyticus and salmonella | |
| CN105505879B (en) | A kind of method and culture medium for cultivating transgenic animal embryo cell or transgenic animals | |
| CN109439781A (en) | For detecting the application of the Primer composition, kit and kit of clostridium difficile gene | |
| Akinyemi et al. | Molecular characterization of bacteria isolates from farm-raised catfish Clarias gariepinus (Burchell, 1822) | |
| CN102676698A (en) | PRV, PCV-2, PPV multiple PCR (Polymerase Chain Reaction) detection kit | |
| CN104372078B (en) | The HDA primer of C.perfringens and application process thereof in a kind of food | |
| CN107723348B (en) | NASBA detection method for identifying Listeria monocytogenes 1/2c serotype | |
| CN109486971A (en) | The detection method of salmonella in a kind of coastal seawater | |
| CN108424866A (en) | A kind of sturgeon source Aeromonas media AMth-1 and PCR detection primer and application | |
| CN106868179A (en) | Efflux pump SMeDEF combines the method for mediation germ oligotrophy unit cell Multiresistant genes positioning with I class integrase gene | |
| CN102382881B (en) | Kit and method for detecting fish pathogenic bacteria | |
| Dalusi et al. | Genetic relationship between clinical and environmental Vibrio cholerae isolates in Tanzania: A comparison using repetitive extragenic palindromic (REP) and enterobacterial repetitive intergenic consensus (ERIC) fingerprinting approach | |
| Wijayanti et al. | DNA Barcoding of Swamp Sediment Bacterial Isolates for Swamp Aquaculture Probiotic | |
| KR20150143347A (en) | Primer set for high sensitive real-time multiplex loop-mediated isothermal amplification reaction for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli, and method for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli using the same | |
| Chen et al. | Typing of Neisseria gonorrhoeae Opa and NG-MAST gene of 12 pairs of sexual contact gonorrhea patients in China | |
| KR101749977B1 (en) | Primer set for high sensitive real-time loop-mediated isothermal amplification reaction for detecting Campylobacter jejuni, and method for detecting Campylobacter jejuni using the same | |
| CN108546743A (en) | A kind of Vibrio harveyi rapid detection method | |
| Morammazi et al. | Sequence variation in GAL1 and GAL2 genes in Khuzestan local chickens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160921 |