CN109486971A - The detection method of salmonella in a kind of coastal seawater - Google Patents
The detection method of salmonella in a kind of coastal seawater Download PDFInfo
- Publication number
- CN109486971A CN109486971A CN201811425303.2A CN201811425303A CN109486971A CN 109486971 A CN109486971 A CN 109486971A CN 201811425303 A CN201811425303 A CN 201811425303A CN 109486971 A CN109486971 A CN 109486971A
- Authority
- CN
- China
- Prior art keywords
- pcr
- salmonella
- dna
- seq
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses a kind of detection method of salmonella in coastal seawater, include the following steps: that (1) expands target fragment；(2) standard plasmid template is constructed；(3) Q-PCR quantitation curves are established；(4) environmental sample salmonella measures.Advantages of the present invention: real-time, quickly, detection time is shortened, by 10-12 days of original method, shorten to 1 day, 3-4 hour is only needed in the case where establishing Q-PCR quantitation curves；The problem of can not cultivating salmonella can not be measured by overcoming original method, improve the accuracy of identification.
Description
Technical field
The present invention relates to common bacteria detection technique fields, in particular to the detection method of salmonella in coastal seawater.
Background technique
In recent years, with the continuous improvement of China's rapid development of economy and living standards of the people, coastal seawater, especially
Bathing beach becomes the important place of summer people stress-relieving activity.But since some urban sewage treatment systems are incomplete, very
More raw sewerages are directly discharged into offshore waters, cause great threat to the publilc health of bathing beach.Salmonella is
Gram-negative bacteria, majority are the sporeless bacterium with flagellum and locomotivity.It is widely distributed in nature, air,
It can usually be detected in water, food and excrement, and potential threat is caused to the health of humans and animals.Epidemiological survey shows
The most common pathogenic mode of salmonella is to cause human body enterogastritis, accounts for about the 70% of entire salmonella morbidity case.Morbidity
Person usually chilly, fever, and with dizzy, headache, vomiting, abdominal pain thus the symptoms such as diarrhea generation.Since 1985, generation
It is dramatically increased within the scope of boundary by salmonellal number of patients.
But at present for the detection method of salmonella in coastal seawater mainly using traditional bacterium separation and biochemical mirror
Determine method, there are the following problems for these methods, firstly, method is time-consuming and laborious, when facing high-volume environmental sample, is difficult to meet
The requirement that paralic environment detects real-time, quickly.Secondly, these methods can not detect not educable salmonella.
Summary of the invention
The purpose of the present invention is overcoming detection salmonella of the existing technology, time-consuming, and manpower and material resources consumption is big, nothing
In standard measure seawater not educable salmonella the problem of, provide it is a kind of quickly, Salmonella in easy, sensitive coastal seawater
The detection method of bacterium.
Technical solution of the present invention is summarized as follows:
The detection method of salmonella, includes the following steps: in a kind of coastal seawater
(1) target fragment is expanded
A. on for the distinctive salmonella invasin protein virulence gene design of salmonella shown in SEQ ID NO.1
Swim primer and the upstream primer shown in SEQ ID NO.2；
B. the DNA obtained using positive control salmonella carries out PCR amplification, 2 × PCR Master Mix, 13 μ as template
L、ddH29 μ L of O, 10 μM of 1 μ L of upstream primer, 10 μM of 1 μ L of downstream primer, 1 DNA μ L；PCR program: 95 DEG C of pre- changes
Property 5min；95 DEG C of denaturation 1min, 58 DEG C of annealing 1min, 72 DEG C of extension 40s, 35 recycle；72 DEG C extend 10min eventually；
C. the agarose gel electrophoresis for carrying out 1% to PCR product detects, and the DNA fragmentation in gel extraction purpose band；
(2) standard plasmid template is constructed
Using PCR instrument by the DNA fragmentation of gel extraction it is purified after constant temperature is connect at 16 DEG C with PGM-18 carrier；Connection
After, it takes 10 μ L to be added in the 1.5mL centrifuge tube containing 100 μ L E. coli DH5 α competent cells, mixes ice bath
30 minutes, 1mL LB liquid medium is added after 42 DEG C of water-baths heat shock 180s, ice bath 1min, at 37 DEG C, 180rpm, shaken cultivation
2h；10000rpm is centrifuged 2min, removes supernatant, and precipitating is inhaled and plays mixing, takes 100 μ L to be coated on green containing 50 μ g/mL ammonia benzyls
On the LB solid selection medium of mycin, 37 DEG C of inversion overnight incubations after sealing；With the random picking single colonie of sterile toothpick 15,
The shake culture 2h in the LB liquid medium containing 50 μ g/mL ampicillins, obtains bacterium solution, using bacterium solution as template, using load
Body primer special: downstream primer RV-M shown in upstream primer M13-47, SEQ ID NO.4 shown in SEQ ID NO.3 is carried out
PCR amplification screening positive clone, and positive colony is detected with 1% agarose gel electrophoresis；By the corresponding bacterium solution of positive colony,
It is incubated overnight in the LB culture solution that 5mL contains 100 μ g/mL ampicillins；Plasmid and through sequence verification is extracted, standard is obtained
Plasmid template；
(3) Q-PCR quantitation curves are established
Plasmid concentration in standard plasmid template is measured, to standard plasmid template pure water gradient dilution, 3.2 × 100~
3.2×104Q-PCR experiment, reaction system are carried out within the scope of copies/ μ L are as follows: 2 × SYBR Green QPCR Mix, 10 μ L,
ddH21 μ L of upstream primer shown in 7 μ L of O, 10 μM of concentration of SEQ ID NO.1, shown in 10 μM of concentration of SEQ ID NO.2
1 μ L of downstream primer, 1 μ L of each sample DNA after gradient dilution；Q-PCR program: 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 10s, 58 DEG C
Anneal 30s, 72 DEG C of extension 30s, 40 circulations；It is bent that Q-PCR quantitative criterion is established with Ct value and log copy number after the reaction was completed
Line；
(4) environmental sample salmonella measures
Using the method for suction filtration, the filtering with microporous membrane for being 0.22 μm by coastal seawater aperture uses E.N.Z.A.TM
Water DNA Kit kit extracts the DNA of bacterium on the miillpore filter；The DNA is subjected to Q-PCR experiment, reaction system
Are as follows: 2 × SYBR Green QPCR Mix, 10 μ L, ddH2Upstream primer 1 shown in 7 μ L of O, 10 μM of concentration of SEQ ID NO.1
1 μ L of downstream primer, 1 DNA μ L shown in μ L, 10 μM of concentration of SEQ ID NO.2；Q-PCR program are as follows: 95 DEG C of initial denaturation 3min；
95 DEG C of denaturation 10s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 40 recycle；Then according to Q-PCR quantitation curves by Ct value
It is converted into log copy number, to quantify the concentration of salmonella in environmental sample.
Advantages of the present invention: real-time, quickly, detection time is shortened, by 10-12 days of original method, shorten to 1 day, is building
3-4 hour is only needed in the case where vertical Q-PCR quantitation curves；Salmonella can not be cultivated by overcoming original method and can not measuring
The problem of, improve the accuracy of identification.
Detailed description of the invention
Fig. 1 is agarose gel electrophoresis figure, be successively from left to right 1, Marker 2, s1/s2 strain (positive control) 3,
Certain bathing beach seawater (sample 1) 4, another bathing beach seawater (sample 2) 5, blank sample 6, Tanghe River river water (sample 3) 7,
Three bathing beach seawater (sample 4).
Fig. 2 is Q-PCR amplification curve.
Fig. 3 is Q-PCR solubility curve.
Fig. 4 is Q-PCR standard curve.
Fig. 5 is the environmental sample concentration measured.
Specific embodiment
The distinctive salmonella invasin protein virulence gene of salmonella, gene order Genomic Sequence:NC_
003197.2。
E.N.Z.A.TM Water DNA Kit kit (Omega, USA)
Positive control salmonella, (Salmonella, typhoid fever are husky by the strain number Strain No.CMCC 50098 of purchase
Door Salmonella, September 30 in 2015, China, Chinese medicine bacterium preservation administrative center, 010-53852671http: //
www.cmccb.org.cn/cmccbnew/index.php)
Upstream primer: GTGAAATTATCGCCACGTTCGGGCAA (SEQ ID NO.1)
Downstream primer: TCATCGCACCGTCAAAGGAACC (SEQ ID NO.2)
PGM-18 carrier (commercially available)
LB liquid medium: tryptone (tryptone) 10g is added in 950ml ddH2O；Yeast extract
(yesat extract)5g；NaCl 10g.PH value is adjusted to 7.0 with the NaOH of 1M, is settled to 1L.121 DEG C, 20min high pressure is gone out
Bacterium, 4 DEG C of storages.
Tryptone (tryptone) 10g is added in LB solid selection medium in 950ml ddH2O；Yeast extract
(yesat extract)5g；NaCl 10g.PH value is adjusted to 7.0 with the NaOH of 1M, is settled to 1L.Then 15g agar is added
Powder.121 DEG C, 20min high pressure sterilization, when being cooled to 50-60 DEG C, plate processed.
Upstream primer M13-47:CGCCAGGGTTTTCCCAGTCACGAC (SEQ ID NO.3)
Downstream primer RV-M:GAGCGGATAACAATTTCACACAGG (SEQ ID NO.4)
Embodiment 1
The detection method of salmonella, includes the following steps: in a kind of coastal seawater
(1) target fragment is expanded
A. on for the distinctive salmonella invasin protein virulence gene design of salmonella shown in SEQ ID NO.1
Swim primer and the upstream primer shown in SEQ ID NO.2；
B. the DNA obtained using positive control salmonella carries out PCR amplification, 2 × PCR Master Mix, 13 μ as template
L、ddH29 μ L of O, 10 μM of 1 μ L of upstream primer, 10 μM of 1 μ L of downstream primer, 1 DNA μ L；PCR program: 95 DEG C of pre- changes
Property 5min；95 DEG C of denaturation 1min, 58 DEG C of annealing 1min, 72 DEG C of extension 40s, 35 recycle；72 DEG C extend 10min eventually；
C. the agarose gel electrophoresis for carrying out 1% to PCR product detects, and the DNA fragmentation in gel extraction purpose band；
(2) standard plasmid template is constructed
Using PCR instrument by the DNA fragmentation of gel extraction it is purified after constant temperature is connect at 16 DEG C with PGM-18 carrier；Connection
After, it takes 10 μ L to be added in the 1.5mL centrifuge tube containing 100 μ L E. coli DH5 α competent cells, mixes ice bath
30 minutes, 1mL LB liquid medium is added after 42 DEG C of water-baths heat shock 180s, ice bath 1min, at 37 DEG C, 180rpm, shaken cultivation
2h；10000rpm is centrifuged 2min, removes supernatant, and precipitating is inhaled and plays mixing, takes 100 μ L to be coated on green containing 50 μ g/mL ammonia benzyls
On the LB solid selection medium of mycin, 37 DEG C of inversion overnight incubations after sealing；With the random picking single colonie of sterile toothpick 15,
The shake culture 2h in the LB liquid medium containing 50 μ g/mL ampicillins, obtains bacterium solution, using bacterium solution as template, using load
Body primer special: downstream primer RV-M shown in upstream primer M13-47, SEQ ID NO.4 shown in SEQ ID NO.3 is carried out
PCR amplification screening positive clone, and positive colony is detected with 1% agarose gel electrophoresis；By the corresponding bacterium solution of positive colony,
It is incubated overnight in the LB culture solution that 5mL contains 100 μ g/mL ampicillins；Plasmid and through sequence verification is extracted, standard is obtained
Plasmid template；
(3) Q-PCR quantitation curves are established
Plasmid concentration in standard plasmid template is measured, to standard plasmid template pure water gradient dilution, 3.2 × 100~
3.2×104copies/μL(3.2×100、3.2×101、3.2×102、3.2×103、3.2×104Copies/ μ L)) in range
Carry out Q-PCR experiment, reaction system are as follows: 2 × SYBR Green QPCR Mix, 10 μ L, ddH27 μ L of O, 10 μM of concentration of SEQ
1 μ L of upstream primer shown in ID NO.1,1 μ L of downstream primer shown in 10 μM of concentration of SEQ ID NO.2, it is each after gradient dilution
1 μ L of sample DNA；Q-PCR program: 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 10s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 40
Circulation；Q-PCR quantitation curves are established with Ct value and log copy number after the reaction was completed；
(4) environmental sample salmonella measures
Using the method for suction filtration, by certain bathing beach seawater (sample 1), another bathing beach seawater (sample 2), Tang Hehe
The filtering with microporous membrane that water (sample 3) and third bathing beach seawater (sample 4) water sample aperture are 0.22 μm, is used
E.N.Z.A.TM Water DNA Kit kit extracts the DNA of bacterium on the miillpore filter；It is real that the DNA is subjected to Q-PCR
It tests, reaction system are as follows: 2 × SYBR Green QPCR Mix, 10 μ L, ddH2Shown in 7 μ L of O, 10 μM of concentration of SEQ ID NO.1
1 μ L of upstream primer, 10 μM of concentration of SEQ ID NO.2 shown in 1 μ L of downstream primer, 1 DNA μ L；Q-PCR program are as follows: 95 DEG C
Initial denaturation 3min；95 DEG C of denaturation 10s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 40 recycle；Then according to Q-PCR quantitative criterion
Ct value is converted into log copy number by curve, to quantify the concentration (Fig. 5) of salmonella in environmental sample.
Sequence table
<110>University Of Tianjin
<120>in a kind of coastal seawater salmonella detection method
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gtgaaattat cgccacgttc gggcaa 26
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tcatcgcacc gtcaaaggaa cc 22
<210> 3
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cgccagggtt ttcccagtca cgac 24
<210> 4
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gagcggataa caatttcaca cagg 24
Claims (1)
1. the detection method of salmonella in a kind of coastal seawater, it is characterized in that including the following steps:
(1) target fragment is expanded
A. draw for the distinctive salmonella invasin protein virulence gene design of salmonella upstream shown in SEQ ID NO.1
Object and the upstream primer shown in SEQ ID NO.2；
B. the DNA obtained using positive control salmonella is template, progress PCR amplification, 2 × PCR Master Mix, 13 μ L,
ddH29 μ L of O, 10 μM of 1 μ L of upstream primer, 10 μM of 1 μ L of downstream primer, 1 DNA μ L；PCR program: 95 DEG C of initial denaturations
5min；95 DEG C of denaturation 1min, 58 DEG C of annealing 1min, 72 DEG C of extension 40s, 35 recycle；72 DEG C extend 10min eventually；
C. the agarose gel electrophoresis for carrying out 1% to PCR product detects, and the DNA fragmentation in gel extraction purpose band；
(2) standard plasmid template is constructed
Using PCR instrument by the DNA fragmentation of gel extraction it is purified after constant temperature is connect at 16 DEG C with PGM-18 carrier；Connection terminates
Afterwards, it takes 10 μ L to be added in the 1.5mL centrifuge tube containing 100 μ L E. coli DH5 α competent cells, mixes ice bath 30 and divide
Clock 1mL LB liquid medium is added after 42 DEG C of water-baths heat shock 180s, ice bath 1min, at 37 DEG C, 180rpm, shaken cultivation 2h；
10000rpm is centrifuged 2min, removes supernatant, and precipitating is inhaled and plays mixing, 100 μ L is taken to be coated on containing 50 μ g/mL ampicillins
LB solid selection medium on, 37 DEG C of inversion overnight incubations after sealing；With the random picking single colonie of sterile toothpick 15, containing
There is shake culture 2h in the LB liquid medium of 50 μ g/mL ampicillins, obtains bacterium solution, it is special using carrier using bacterium solution as template
PCR is carried out with primer: downstream primer RV-M shown in upstream primer M13-47, SEQ ID NO.4 shown in SEQ ID NO.3
Screening positive clone is expanded, and detects positive colony with 1% agarose gel electrophoresis；By the corresponding bacterium solution of positive colony,
It is incubated overnight in the LB culture solution that 5mL contains 100 μ g/mL ampicillins；Plasmid and through sequence verification is extracted, standard matter is obtained
Grain template；
(3) Q-PCR quantitation curves are established
Plasmid concentration in standard plasmid template is measured, to standard plasmid template pure water gradient dilution, 3.2 × 100~3.2 ×
104Q-PCR experiment, reaction system are as follows: 2 × SYBR Green QPCR Mix, 10 μ L, ddH are carried out within the scope of copies/ μ L2O 7
1 μ L of upstream primer shown in μ L, 10 μM of concentration of SEQ ID NO.1, downstream primer shown in 10 μM of concentration of SEQ ID NO.2
1 μ L, 1 μ L of each sample DNA after gradient dilution；Q-PCR program: 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 10s, 58 DEG C of annealing 30s,
72 DEG C of extension 30s, 40 circulations；Q-PCR quantitation curves are established with Ct value and log copy number after the reaction was completed；
(4) environmental sample salmonella measures
Using the method for suction filtration, the filtering with microporous membrane for being 0.22 μm by coastal seawater aperture, with E.N.Z.A.TM Water
DNA Kit kit extracts the DNA of bacterium on the miillpore filter；The DNA is subjected to Q-PCR experiment, reaction system are as follows: 2 ×
SYBR Green QPCR Mix 10μL、ddH2It is 1 μ L of upstream primer shown in 7 μ L of O, 10 μM of concentration of SEQ ID NO.1, dense
1 μ L of downstream primer, 1 DNA μ L shown in the SEQ ID NO.2 of 10 μM of degree；Q-PCR program are as follows: 95 DEG C of initial denaturation 3min；95℃
It is denaturalized 10s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s, 40 recycle；Then Ct value is converted according to Q-PCR quantitation curves
At log copy number, to quantify the concentration of salmonella in environmental sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811425303.2A CN109486971A (en) | 2018-11-27 | 2018-11-27 | The detection method of salmonella in a kind of coastal seawater |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811425303.2A CN109486971A (en) | 2018-11-27 | 2018-11-27 | The detection method of salmonella in a kind of coastal seawater |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109486971A true CN109486971A (en) | 2019-03-19 |
Family
ID=65696965
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811425303.2A Pending CN109486971A (en) | 2018-11-27 | 2018-11-27 | The detection method of salmonella in a kind of coastal seawater |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109486971A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110760600A (en) * | 2019-07-17 | 2020-02-07 | 天津大学 | Rapid detection method for enterococcus in offshore water area |
| CN113930528A (en) * | 2020-07-13 | 2022-01-14 | 天津大学 | Method for detecting vibrio in coastal seawater |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101570783A (en) * | 2009-03-20 | 2009-11-04 | 郑秋月 | Detection kit and detection method for 9 species of pathogenic organisms in marine products |
| CN102154472A (en) * | 2011-01-18 | 2011-08-17 | 西安建筑科技大学 | Quantitative detection method of salmonella living body in water |
-
2018
- 2018-11-27 CN CN201811425303.2A patent/CN109486971A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101570783A (en) * | 2009-03-20 | 2009-11-04 | 郑秋月 | Detection kit and detection method for 9 species of pathogenic organisms in marine products |
| CN102154472A (en) * | 2011-01-18 | 2011-08-17 | 西安建筑科技大学 | Quantitative detection method of salmonella living body in water |
Non-Patent Citations (1)
| Title |
|---|
| 商君阳: "基于Q-PCR技术的秦皇岛近岸海域病原菌现状研究", 《中国优秀硕士学位论文全文数据库工程科技Ⅰ辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110760600A (en) * | 2019-07-17 | 2020-02-07 | 天津大学 | Rapid detection method for enterococcus in offshore water area |
| CN113930528A (en) * | 2020-07-13 | 2022-01-14 | 天津大学 | Method for detecting vibrio in coastal seawater |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102965438B (en) | Duplex polymerase chain reaction (PCR) detection primer group, kit and method for pathogenic channa source aeromonas schubertii | |
| CN107385111A (en) | The real-time fluorescence quantitative PCR detection primer and its kit of a kind of goose astrovirus | |
| CN112940982B (en) | Snakehead source Bacillus belezii and application thereof | |
| CN109486971A (en) | The detection method of salmonella in a kind of coastal seawater | |
| CN102174652A (en) | Detection method of mycobacterium tuberculosis pyrazinamide drug resistance | |
| CN103276061A (en) | Kit having LAMP nucleic acid test strips and used for detecting brucella spp., and application thereof | |
| CN109735604A (en) | A kind of method of rapid quantitative detection VBNC state vibrio parahemolyticus | |
| CN102827928B (en) | Rapid diagnosis method for plesimonas shigelloides | |
| CN108060265A (en) | For detecting the primer sets of the oyster herpetovirus of infection blood clam and probe and its application | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN104372078B (en) | The HDA primer of C.perfringens and application process thereof in a kind of food | |
| Voronina et al. | Regularities of the ubiquitous polyhostal microorganisms selection by the example of three taxa | |
| CN103436619A (en) | Method for identifying atypical Escherichia coli in calf diarrhea | |
| CN106167823A (en) | Colibacillary detection method in a kind of coastal seawater | |
| CN102140513B (en) | Primer sequences for detecting Edwardsiella tarda, Edwardsiella ictarda or pathogenic Edwardsiella tarda, and detection method and application thereof | |
| CN108048586A (en) | A kind of detection method of ox kind Brucella sp attenuated vaccine strain S19 | |
| Imtiaz et al. | Development of PCR protocol for detection of Escherichia coli in drinking water | |
| CN103305613A (en) | PCR (Polymerase Chain Reaction) diagnostic kit for pathogenic aeromonas hydrophila of giant salamander | |
| Florence et al. | Determination of toxinotypes of environmental Clostridium perfringens by polymerase chain reaction | |
| Farahmandfar et al. | Comparison of two methods for detection of E. coli O157H7 in unpasteurized milk | |
| Lleò et al. | Gram-positive bacteria in the marine environment | |
| Cai et al. | A novel multiplex PCR method for detecting virulent strains of Vibrio alginolyticus | |
| CN104313154A (en) | Double PCR (Polymerase Chain Reaction) method for simultaneously detecting mycoplasma hyopneumoniae and porcine pasteurella multocida | |
| CN105154438B (en) | To Hafnia alvei G5907, G5908, G5913, nucleotide special G5916 and its application | |
| CN108715897A (en) | Aeromonas veronii detection primer, kit, detection method and its development approach based on specific sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190319 |
|
| WD01 | Invention patent application deemed withdrawn after publication |