CN105950734A - Haplotype BnHapFatty related with oilseed rape fatty acid character and application - Google Patents
Haplotype BnHapFatty related with oilseed rape fatty acid character and application Download PDFInfo
- Publication number
- CN105950734A CN105950734A CN201610362173.7A CN201610362173A CN105950734A CN 105950734 A CN105950734 A CN 105950734A CN 201610362173 A CN201610362173 A CN 201610362173A CN 105950734 A CN105950734 A CN 105950734A
- Authority
- CN
- China
- Prior art keywords
- acid
- haplotype
- bnhapfatty
- snp
- fatty acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a haplotype BnHapFatty related with oilseed rape fatty acid character and application. An association population is formed by 370 parts of oilseed rape from different breeding ages and with larger domestic and abroad genetic difference and different glucosinolate contents, the genome-wide association study is performed by utilizing the gene data and the content phenotype data of palmitic acid, stearic acid, oleic acid, linoleic acid, eicosenoic acid and erucic acid, and the haplotype BnHapFatty with index contribution rates of 66.57percent, 62.96percent, 80.26percent, 62.19 percent, 79.54 percent and 80.89 percent is obtained. The haplotype BnHapFatty has the advantages that the selection efficiency is improved; the contribution rate of haplotype BnHapFatty to phenotype is large, the detection is convenient and quick, the single plant or plant system with high and low contents of six characters is quickly and preliminarily sorted and is used for the breeding of oilseed rape with different purposes, the breeding selection goal is clear, and the cost is reduced.
Description
Technical field
The present invention relates to genetic breeding and technical field of molecular biology.It is specifically related to one and canola fatty acids character phase
The haplotype BnHapFatty closed and application.
Background technology
Brassica campestris L is one of three big oil crop in the world, and its vegetable oil produced constitutes about cosmopolitian plant oil total amount
13%.In addition, Brassica campestris L is also one of important potential energy source crop and vegetable protein sources.Coming as vegetable edible oil
One of source, Brassica campestris L realizing " double low, three-hypers, two change " (low erucic acid, low-sulfur glycosides, high yield, high anti-, efficiently, industrialization and machinery
Change) it is primary breeding objective；As energy crop and the raw material of industry, Brassica campestris L except pursue " three high " and " two change " breeding objective it
Outward, it is also main breeding objective with high unsaturated fatty acid (high linoleic acid, high linolenic and high erucic acid etc.).20 end of the centurys, I
State has become rapeseed cultivation big country of the world, becomes one of erucic acid major country of production.Product, in addition to meeting domestic demand, also exports to
To the country such as Japanese, the most American-European (Pu Dingfu, Yuan Daibin, etc. new high erucic acid hybrid rapeseed Mianyou 15 in Brassica napus L. for industrial use selection-breeding. China
Oil crop journal, 2005,27 (4): 38-40).The Brassica campestris L such as Canada and France main exit state achieves the most substantially entirely at present
Journey mechanization production.Its production cost is low, and the oil content of Semen Allii Tuberosi is the most generally than China Yangtze river basin and the high 2-3 in the Yellow River and Huai He River winter rape district
Percentage point, the development of serious impact China Rape industry (Li Jiana. China's Rape-seed production processing status, facing challenges and
Countermeasure [M]. Beijing: Chinese agriculture publishing house, 2002,27 31).Supply falls short of demand always for China's edible vegetable oil, and import volume is annual
In increasing trend, reach 2300-2400 ten thousand tons to total quantity consumed in 2010, and domestic edible vegetable oil be only about 10,000,000 tons,
Need import to cover the shortage, edible oil security situation the severeest (Zhang Dongqing. Zhejiang Province's quality rape Advances in Breeding [J]. Zhejiang
Agricultural sciences, 2015,05:650-654.).Therefore, accelerate China's rapeseed breeding process, improve China's Rape-seed production level, carry
Rise international competitiveness extremely the most urgent.
Palmic acid, also known as palmitic acid, is a kind of saturated higher fatty acid, is prevalent in animals and plants with the form of glyceride
In oils and fats, it is distributed very wide, mainly for the production of soap, wax candle, lubricant, softening agent, synthetic detergent etc. in nature.Firmly
Fat acid, i.e. octadecanoid acid, be widely used in making cosmetics, plastics cold resistant plasticizer, releasing agent, stabilizer, surfactant, rubber
Glue vulcanization accelerator, waterproofing agent, polishing agent, metallic soap, softening agent, pharmaceuticals and other organic chemicals etc..But Petiolus Trachycarpi
Acid and stearic acid broadly fall into satisfied fatty acid, and as edible vegetable oil, they content should be the not highest.Because satisfied fatty acid is taken in
Measuring too high meeting causes cholesterolemia, triacylglycerol, low-density lipoprotein cholesterol to raise, and secondary causes arterial lumen narrow, shape
Become atherosclerosis, increase the risk suffering from coronary heart disease.Eicosenoic acid belongs to unsaturated fatty acid, is long-chain fatty acid synthesis
In approach, essential mesostate, belongs to unsaturated fatty acid, is mainly used in commercial production.Oleic acid and linoleic acid help
Digest in absorption of human body, there is reduction serum cholesterol in humans and triglyceride and the merit such as vessel softening and prevention thrombosis
Effect, the oleic acid and the linoleic acid content that therefore improve Oleum Brassicae campestris become the important goal on current rapeseed breeding.Several at Brassica campestris L
In main fatty acid component, content of erucic acid and other content of fatty acid are negative correlation, and therefore low erucic acid breeding is high gas oil ratio and height
Linoleic acid breeding provide favourable basis (Wu Xianmeng, official's spring cloud, Lee. the progress of canola fatty acids quality-improving
[J]. crop investigations, 2003,03:152-158).
Erucic acid is the fatty acid compound of a kind of complexity, containing the unsaturated fatty acid of a double bond, water soluble, second
Alcohol and methanol etc., be highly soluble in ether.Erucic acid molecule carbon chain is longer, has stronger hydrophobicity and water proofing property, excellent lubrication
Property (Wu Guanting, Lang Chunxiu, Chen Jinqing. the production of erucic acid and derived product exploitation. Chinese oil, 2007 volume 32, the 6th
Phase: 27-31).The application of erucic acid originates from generation nineteen sixty, is a kind of important oil-fat chemical products, manufacture, machinery, rubber,
Chemical industry, paint, weave, metallurgical and medicine and other fields has extensive use (Deng Dinghui. the exploitation profit of high and low erucic acid Oleum Brassicae campestris
With. pesticide herd product is developed, 1997, (5): 16-17).In addition to the value of erucic acid self, its derivant is in medicine, pesticide, cosmetic
The aspects such as product, anticorrosion, detergent, oil development, coating be also used widely (Zeng Dengfa. the purposes of erucic acid and producing. Jiangxi
Science, 1989,7 (3): 43-46).Although, erucic acid industrially range of application is relatively wide, but takes in too much erucic acid to human body
Certain harm can be produced, myocardial fatty deposition and heart damage may be caused.Zoopery proves, a large amount of erucic acid of taking in contain
Measuring high Oleum Brassicae campestris, can cause myocardial fibrosis, cause cardiomyopathy, cause animal weightening finish slow, dysplasia, reproductivity declines
Deng harmful effect.Therefore as industrial Brassica campestris L, the Semen Brassicae campestris of high erucic acid content need to be pursued, and plant with edible as animal feed
Thing oil, reduces the top priority that content of erucic acid is Improvement of fatty acid.
Molecular marker assisted selection (MAS, marker assisted selection) is as modern molecular biology
Developing rapidly of technology and the new technique that produces, be on the basis of gene clone or location, by target gene itself or with
Closely linked molecular marker can analyze rapidly and accurately from molecular level individuality genetic constitution, thus realize to base
Because of the directly selecting of type, gene transgression (Gene transgression), build the aspects such as gene line.Its advantage mainly has following
Several aspects: (1) can be that target carries out material screening, by multiple gene pyramidings to same material to multiple genes simultaneously
In so that it is optimized；(2) in advance objective trait can be screened according to genotype information, reduce later stage work amount；
(3) qualification to objective trait is postponed, such as when to the Resistance Identification of multiple pest and disease damage, because the harm of some pest and disease damage is led
Cause plant death in advance or No kernels or seeds are gathered, as in a year of scarcity, thus phenotype can be made to be difficult to simultaneously and identify, and it is possible to forfeiture has excellent
The material of different performance, but molecular marking technique can be used then can first to identify the target gene of multiple character, treat that the next generation is again
Carry out phenotype checking (Zhu Yujun, Fan Yeyang, Huang get Run, village outstanding person's cloud etc. molecular marker assisted selection in rice breeding should
With [J]. nuclear agricultural science report 2012,26 (5): 756-761).At present, Molecular Marker Assisted Selection Technology application is concentrated mainly on gene
Polymerization (Ge ne pyramiding).
Linkage disequilibrium (Linkage disequilibriuln, LD) refers on different genes seat allelic
Nonrandomness combines.Association analysis (Association analysis) is should in Quantitative Traits in Plants research and plant breeding
A kind of newer analysis method.It identifies character and genetic marker or candidate in a certain colony based on linkage disequilibrium
Intergenic relation (Mackay I, Powell W.Methods for linkage disequllibrium mapping in
Crops [J] .Trends Pl ant Sci, 2007,12:57-63).Colony compares with restructuring, and its remarkable advantage is high pass
Amount, can detect the character control of the substantial amounts of Germplasms with different genetic background in the range of full-length genome effectively
Gene loci processed or region；In addition to high flux advantage, owing to whole-genome association is usually with existing natural population it is
Material, thus few more a lot of than the time that general restructuring colony spends；Meanwhile, precision is high, can reach monogenic level (poplar
Little red etc. Reviews of Association Analysis for Quantitative Traits in Plants [J]. Acta Agronomica Sinica, 2007,33 (4): 523-530).
The decay distance (LD decay) of linkage disequilibrium determines during the association analysis carrying out full-length genome scope required
The number of labelling and degree of accuracy, the LD level in natural population determines the resolution of whole-genome association to a certain extent
Rate (M ichael D, et al.Genetic properties of the maize nested association
Mapping population [J] .Science, 2009,737:325).The size of the gene frequency between site and weight
Group rate can affect the level of linkage disequilibrium, so natural mutation in colony, restructuring, subpopulation structure, artificial selection
Pressure and genetic drift etc. all can affect linkage disequilibrium (LD) structure (Gupta et al., 2005；Oraguzie et
Al., 2007).When carrying out whole-genome association, between the subgroup structure and material in colony, sibship makes whole
The linkage disequilibrium degree of association colony strengthens, and this may provide false positive results.So, having before being associated analyzing must
Group structure and sibship are analyzed, and will can be effectively as covariant using group structure and sibship
Reduce the generation of false positive markings.
Haplotype (Haplotype) be in item chromosome specific region one group is interrelated, and tends to whole
Body entails the combination of the mononucleotide polymorphic of offspring, also known as haplotype or haplotype.Chain injustice on same chromosome
The situation of multiple molecular markers of weighing apparatus is haplotype.And the fatty acid correlated traits in Semen Brassicae campestris belongs to the most quantitative
Shape, exploitation identifies that haplotype that specific trait is relevant can be in the containing of these character of Preliminary Identification plant later stage Semen Brassicae campestris in seedling stage
Amount.
This research, by building the association colony of 370 parts of rape varieties, utilizes high density SNP chip to carry out gene type,
Phenotypic data in conjunction with 3 years 26 fatty acid correlated traits under totally five environment has carried out whole-genome association,
Be intended to position and filter out the molecular marker relevant to these trait content, and build haplotype, for molecular marker assisted selection,
Molecular breeding and the clone of related gene.
Summary of the invention
Present invention aim at providing a kind of haplotype BnHapFatty relevant to canola fatty acids character, described
Haplotype BnHapFatty is made up of three SNP marker, respectively Bn-A08-p12814556, Bn-A08-p12820786
And Bn-A08-p12599446.The sequence that what described Bn-A08-p12814556 was corresponding comprise SNP be SEQ ID NO.1 or
Shown in SEQ ID NO.2；The sequence that what described Bn-A08-p12820786 was corresponding comprise SNP is SEQ ID NO.3 or SEQ
Shown in ID NO.4；The sequence that what described Bn-A08-p12599446 was corresponding comprise SNP be SEQ ID N O.5 or SEQ ID
Shown in NO.6.
Still another purpose is that of the present invention provides a kind of haplotype relevant to canola fatty acids character
BnHapFatty application in canola fatty acids content character breeding, described fatty acid be Palmic acid, stearic acid, oleic acid,
Linoleic acid, eicosenoic acid or erucic acid.This haplotype can these 6 fatty acids of when phase Rapid identification Semen Brassicae campestris in office be correlated with
The content of character, provides valuable foundation for molecular marker assisted selection, is the related gene of these character from now on simultaneously
Clone provides certain basis.
Further object is that and provide primer based on tri-SNP site designs of haplotype BnHapFatty
Or probe, it is preferred that its primer is respectively as follows: Bn-A08-p12814556:TGTTCACAACCGCACTCTTT, TGCATT
ATTTCAGATGTCTCAGA；Bn-A08-p12820786:TCTGAAGTTTTGATTTCGTGAGT, AC
ATGGACGATTAAAGTAAGT；Bn-A08-p12599446:TCTTATCGGACCTTCGCTCC, CCAC
CTCCAACCAACACCTA.Preferably, its probe is respectively as follows: the probe sequence of Bn-A08-p12814556 and is: AT
AAAAATATTTTTACTGTTTTGCATTATTTCAGATGTCTCAGAAAGTTA；The probe sequence of Bn-A08-p12820786
For: TTATCTTCTTCTTTTTCTATTACTTTAACATGGACGATTAAAGTAAGTT T；The probe of Bn-A08-p12599446
Sequence is: TCCACCTCCAACCAACACCTAACAACACACTTA CACTTGTAAGAAAGTCA.
Final object of the present invention there are provided based on tri-SNP site designs of haplotype BnHapFatty drawing
Thing or probe application in canola fatty acids content character breeding.Utilize primer or probe that the present invention provides, can be to monomer
The type of type Bn HapFatty is identified, quickly, accurately, simply.
In order to realize above-mentioned purpose, the present invention uses techniques below measure:
The preparation method of a kind of haplotype BnHapFatty identifying 6 fatty acid correlated traits of Brassica campestris L, it includes as follows
Step:
A) the totally 370 parts of cabbage type rapes utilizing collection main Brassica campestris L manufacturing country from the whole world build association colony；
B) CTAB method is used to extract blade STb gene (Doyle J.Arapid DNA isolation procedure
For small quantities of fresh leaf tissue.Phytochemical Bulletin, 1987,19,11-
15) extract the blade STb gene of every part of material of association colony, then by 60K SNP chip, the DNA of colony is carried out SNP typing
Detection.
C) by detecting chip quality and the screening of high-quality SNP, specific standards is: call frequency >=
85%, MAF >=0.05, cluster separation scored >=0.4, heterozygosity≤0.15.And will be singled out
The source sequence of the SNP come and genome (Chalhoub B, et al.Early allopolyploid evolution in
The post-Neolithi c Brassica napus oilseed genome.Science 345,950-3 (2014) .) enter
Row comparison, it is thus achieved that position unique high-quality SNP data set.
D) utilize Structure and Tassel software to carry out group structure and Genetic relationship, obtain Q and K matrix, use
In follow-up whole-genome association.
E) seed collecting association population material when maturation carries out infrared diaphanoscopy, measures 6 fatty acids in seed
The content of correlated traits.
F) combine genotype and 6 fatty acid correlated traits phenotypic datas, Tassel software carries out full-length genome pass
Connection is analyzed, and identifies the site of 6 fatty acid correlated traits significant correlations, and obtains the most notable with 6 fatty acid correlated traits
Relevant SNP, then builds haplotype BnHapFatty according to the genotype data of related locus.
Abovementioned technology, inventor is utilized to be finally obtained multiple significant correlations with 6 fatty acid correlated traits
SNP site, and three SNP the most notable, that contribution margin is maximum have been built into a haplotype BnHapFatty, specific as follows:
This haplotype BnHapFatty, is positioned at A08 chromosome, by SNP marker Bn-A08-p12814556, Bn-A08-p12820786 and
Bn-A08-p12599446 collectively forms.The sequence that what wherein said Bn-A08-p12814556 was corresponding comprise SNP is SEQ
Shown in ID NO.1 or SEQ ID NO.2；The sequence that what described Bn-A08-p12820786 was corresponding comprise SNP is SEQ ID
Shown in NO.3 or SEQ ID NO.4；The sequence that what described Bn-A08-p12599446 was corresponding comprise SNP is SEQ ID NO.5
Or shown in SEQ ID NO.6.The detection of Tassel 5.0 software analysis is utilized to obtain three SN P (Bn-A08-p12814556, Bn-
A08-p12820786 and Bn-A08-p12599446) and 6 fatty acid correlated traits pole significant correlations, three SNP constitute monomers
The phenotype contribution rate of Palmic acid, stearic acid, oleic acid, linoleic acid, eicosenoic acid and erucic acid is respectively reached by type BnHapFatty
66.57%, 62.96%, 80.26%, 62.19%, 79.54% and 80.89%.
The protection content of the present invention also includes based on the SNP in the sequence comprising SNP that haplotype BnHapFatty is corresponding
The primer of design or probe, it is preferred that the primer designed for the SNP in SEQ ID NO.1～SEQ ID NO.6 is:
Bn-A08-p12814556:TGTTCACAACCGCACTCTTT, TGCATTATTTCAGATGTCTCAG A；
Bn-A08-p12820786:TCTGAAGTTTTGATTTCGTGAGT, ACATGGACGATTAAAGTA AGT；
Bn-A08-p12599446:TCTTATCGGACCTTCGCTCC, CCACCTCCAACCAACACCTA.
Preferably, the probe of the SNP sequential design comprised for content of fatty acid haplotype BnHapFatty is:
The probe sequence of Bn-A08-p12814556 is: ATAAAAATATTTTTACTGTTTTGCATTATTTCAGA
TGTCTCAGAAAGTTA；
The probe sequence of Bn-A08-p12820786 is: TTATCTTCTTCTTTTTCTATTACTTTAACATGGAC
GATTAAAGTAAGTTT；
The probe sequence of Bn-A08-p12599446 is: TCCACCTCCAACCAACACCTAACAACACACTTA
CACTTGTAAGAAAGTCA。
Content of fatty acid haplotype BnHapFatty or the primer designed based on its SNP site or probe lose at Brassica campestris L molecule
Pass the application in breeding, include but not limited to utilize the usual manner of prior art, rape DNA to be detected is checked order, really
Surely be belonging in SEQ ID NO.1～SEQ ID NO.6 is any, to determine its genotype.Or utilize SNP marker
Primer or probe carry out PCR amplification to cabbage type rape DNA, quickly judge SNP site situation, to determine genotype.
Compared with prior art, the invention have the advantages that
The present invention utilize whole-genome association method to located in Brassica campestris L 1 affects 6 fatty acid correlated traits
Haplotype BnHapFatty, it respectively reaches 66.57% to the contribution rate of 6 fatty acid correlated traits of Brassica campestris L, 62.96%,
80.26%, 62.19%, 79.54% and 80.89%, the highest for contribution rate in the QTL of these 6 fatty acid correlated traits of Brassica campestris L.
In traditional breeding way, the mensuration of these 6 kinds of content of fatty acid could need to measure when Semen Brassicae campestris is gathered in the crops, and required time is long, no
Determine many factors, therefore can considerably increase time and the cost of the rapeseed breeding of different purposes.And by detection plant
Haplotype Bn HapFatty, can eliminate at rape seedling and not meet individual plant or the strain of breeding man wish, not only save life
Produce cost and substantially increase efficiency of selection.The site of 6 fatty acid correlated traits haplotype BnHapFatty in the present invention
Locality specific, phenotype contribution rate is big, easy to detect quickly, the most affected by environment, breeding efficiency is high.6 fatty acids are utilized to be correlated with
The S NP label information detection of character i.e. can be with the content of 6 fatty acid correlated traits of preliminary forecasting height, and then can be quick
Filtering out Brassica campestris L individual plant or the strain of the high and low content of different purposes, assistant breeding selects with clearly defined objective, has saved breeding one-tenth
This.
Accompanying drawing explanation
Fig. 1 be association colony 3 years 26 fatty acid correlated traits under totally 5 environment through optimum linearity unbiased
Estimate the phenotypic frequency scattergram after (B LUP) process.
Result shows that 6 fatty acid correlated traits performance distributions are distributed in seriality, but variation distribution is not in normal distribution,
Prove that 6 fatty acid correlated traits belong to simple quantitative trait, and there is major gene loci；
Fig. 2 is group structure analysis result.
The distribution on K=1-10 of A:Ln (D) value；B: Δ K is in the distribution of K=2-9.Result shows that associating colony is divided into
Three subgroups are the most reasonable；
Fig. 3 is the scattergram of association population genetic relationships.
Result shows that the sibship between the material of whole colony is more weak, it is adaptable to grinding of whole-genome association
Study carefully.
Fig. 4 is the Manhattan figure of 6 fatty acid correlated traits whole-genome association results.
Chromosome (1-19 represents A01-A10 and C01-C09 respectively) the upper opsition dependent order that the expression of abscissa is different is arranged
The SN P of row, vertical coordinate is the-log of SNP10(P) value, horizontal line represents the threshold value (-log of significance level10(P)=6.34), horizontal
Point on line represents the SNP with phenotype significant correlation.
Detailed description of the invention
According to following example, the present invention can be better understood from, but described embodiment is to preferably explain this
Invention rather than limitation of the present invention.Agents useful for same of the present invention and method if not otherwise specified, derive from commercial channel,
Described technical scheme, if not otherwise specified, is the conventional scheme of this area.
Embodiment 1:
The mensuration of 6 fatty acid correlated traits of association colony
The 370 parts of brassica napus that colony is the main Brassica campestris L manufacturing country from the world used in the present embodiment.This
Association colony used in research is by the 370 parts of cabbage type rape structures being bred as the age from difference, domestic and international hereditary difference is bigger
Become, the most domestic material totally 295 parts, essentially from Hubei, Hunan, Shaanxi, Jiangsu and other places, foreign material 75 parts, essentially from
The countries such as France, Australia, Japan and Sweden.The mensuration of 3 years 26 fatty acid correlated traits of totally five environment is equal
Infrared diaphanoscopy Semen Brassicae campestris is used to obtain.The data of multiple years use minimum dispersion linear unbiased estimator (BLUP) to process,
Inheritability ratio to Palmic acid, stearic acid, oleic acid, linoleic acid, eicosenoic acid and erucic acid is respectively as follows: 85.2%, and 93.4%,
97.8%, 95.6%, 97.5%, 98.1%, show that the height of the content of these character is mainly determined by genetic factor.Association group
The content distribution result of these 6 character of body is seriality distribution, but variation distribution is not in normal distribution, it was demonstrated that these character belong to
In simple quantitative trait and there is major gene loci (see Fig. 1).
Embodiment 2:
The extraction of association colony leaves STb gene
CTAB method is used to extract association colony leaves STb gene (Doyle J.A rapid DNA isolation
Procedure f or small quantities of fresh leaf tissue.Phytochemical Bulletin,
1987,19,11-15), method particularly includes:
A) young leaflet tablet is put in 10% ethanol and rinse；Then, during clip 0.1-0.2g blade puts into stone roller alms bowl, liquid nitrogen is utilized
Quickly it is milled to powder, loads in 2mL centrifuge tube；
B) preheating DNA extraction liquid 700 μ L is added；Mix 1h, every 10-15min in rearmounted 65 DEG C of water-baths to mix 1 time；
C) 700 μ L mixed liquors (phenol: chloroform: isoamyl alcohol=25: 24: 1), gently reverse mixing 10min are added；Room temperature
Under, 10 000 × g is centrifuged 15min；
D) Aspirate supernatant is in new 2mL centrifuge tube；Add equal-volume mixed liquor (chloroform: isoamyl alcohol=24: 1), top
Falling to mix, stand 5min, 10000 × g, centrifugal 15min, with in rifle Aspirate supernatant to new centrifuge tube；
E) add 2 times of volume dehydrated alcohol, stand 1h, 10 000 × g, centrifugal 10min at 20 DEG C after mixing, abandon supernatant
Liquid；Add 75% washing with alcohol precipitation of 500 μ L pre-coolings, remove supernatant；After continuous 2 washing precipitations, dry；
F) adding containing 2%RNase solution A 100 μ L, after standing 1h at 37 DEG C, 4 DEG C overnight；With equal-volume mixed liquor (chlorine
Imitative: isoamyl alcohol=24: 1) again extract DNA solution, reverse mixing, stand 10min, 10 000 × g, be centrifuged 15 or 20min, go
Except RNase A, Aspirate supernatant (about 60 μ L), recentrifuge, 1min；
G) agarose gel electrophoresis (0.8%) and UV spectrophotometer measuring DNA concentration, quality and integrity are utilized；
H) determine that absorbance 260/280 ratio of all DNA sample is between 1.8-2.0.In-20 DEG C of ice after detectable concentration
Case saves backup.And utilize 60K SNP chip that material DNA is carried out gene type.
Embodiment 3:
Association colony's group structure and Genetic relationship
Due in colony if there is more substantially group structure and nearer sibship likely can be to association analysiss
Result produces false-positive SNP, so being necessary when carrying out whole-genome association to carry out group structure and sibship
Analyze.Group structure is analyzed and is used Structure 2.3 software to carry out, and result shows that associating colony is divided into three subgroups most suitable
(Fig. 2).Sibship itself is the genetic similarty between genetic similarty and any materials between definition two certain materials
Relative value.Use Tassel5.0 software to carry out the assessment of sibship (relative kinship), calculate sibship
The matrix (K matrix) of value.Result shows: the sibship overall average between this population material is 0.1077 (Fig. 3), Qi Zhongfa
Existing sibship be 0 for 58.04%, sibship be 0-0.05 for 7.87%, these results show the material of whole colony
Sibship between material is more weak, is suitable for whole-genome association.
Embodiment 4:
The whole-genome association of 6 fatty acid correlated traits and the structure of haplotype BnHapFatty
After the phenotype obtaining 6 fatty acid correlated traits and genotype data, use mixed in Tassel 5.0 software
Q+K model in linear model (MLM) carries out whole-genome association.Result (Fig. 4 and Biao 1) shows that all character exist
Peak value (the p < 4.57 × 10 of significant correlation is detected on A08 chromosome-7), jointly detect that SNP has 4.A08 is detected jointly
Arrive, and the most significant three SNP (Bn-A08-p12814556, Bn-A08-p12820786 and Bn-A08-p12599446) build
For haplotype BnHapFatty (table 2), the close linkage between them, the bag that wherein said Bn-A08-p12814556 is corresponding
Sequence containing SNP is SEQ ID NO.1 or shown in SEQ ID NO.2；What described Bn-A08-p12820786 was corresponding comprises SNP
Sequence be SEQ ID NO.3 or shown in SEQ ID NO.4；What described Bn-A08-p12599446 was corresponding comprises the sequence of SNP
It is classified as shown in SEQ ID NO.5 or SEQ ID NO.6.
For tri-SNP molecule marks of Bn-A08-p12814556, Bn-A08-p12820786 and Bn-A08-p12599446
The primer of the SNP site design that note is corresponding is as follows:
Bn-A08-p12814556:TGTTCACAACCGCACTCTTT, TGCATTATTTCAGATGTCTCAGA；
Bn-A08-p12820786:TCTGAAGTTTTGATTTCGTGAGT, ACATGGACGATTAAAGTAAGT；
Bn-A08-p12599446:TCTTATCGGACCTTCGCTCC, CCACCTCCAACCAACACCTA.
Final 370 parts of cabbage type rapes, by detection, the haplotype type of BnHapFatty is divided into three kinds (tables 2), when
When the genotype of BnHapFatty is AA_CC_AA, Palmic acid, stearic acid, oleic acid, linoleic acid, eicosenoic acid and erucic acid are average
Content is 3.27%, 0.34%, 18.97%, 13.54%, 10.90% and 39.56%, for six fat above-mentioned during AG_AC_AG
The average content of acid is 3.86%, 0.57%, 39.04%, 16.40%, 6.33% and 23.14%, and when genotype GG_AA_
During GG, the average content of the most above-mentioned six fatty acids is 4.23%, 0.68%, 54.08%, 18.57%, and 2.33% He
10.32%, use ANOVA to calculate haplotype BnHapFatty to the contribution rate of the phenotype of these 6 character to 66.57%,
62.96%, 80.26%, 62.19%, 79.54% and 80.89%.
Therefore, can be by the type of haplotype, to the Palmic acid of cabbage type rape to be detected, stearic acid, oleic acid, sub-oil
The average content of acid, eicosenoic acid and erucic acid is assessed, in advance to accelerate breeding speed.
Table 1 full genome association analysis detects and 6 significant SNP of fatty acid correlated traits and information thereof
The haplotype type of table 2 BnHapFatty and phenotypic data statistics
Embodiment 5:
Haplotype BnHapFatty application in 6 fatty acid correlated traits height low content breedings of Brassica campestris L
To in high gas oil ratio, high linoleic acid, low eicosenoic acid, low erucic acid material double No. 11, in double No. 4 and double No. 5 three of China
Individual material takes blade respectively in seedling stage and extracts DNA, and (primer is shown in embodiment to utilize the primer of three SNP marker of BnHapFatty
4) carry out Molecular Identification, and when later stage maturation, measure 6 fatty acid correlated traits in seed.Result shows: in double No. 11
Haplotype BnHapFatty be: GG_AA_GG, containing of Palmic acid, stearic acid, oleic acid, linoleic acid, eicosenoic acid and erucic acid
Amount is respectively 4.19%, 0.51%, 59.81%, 17.78%, 0.27% and 8.99%；In the haplotype of double No. 4
BnHapFatty is: GG_AA_GG, and the content of Palmic acid, stearic acid, oleic acid, linoleic acid, eicosenoic acid and erucic acid is respectively
4.08%, 0.53%, 62.23%, 17.48%, 0.85%, 7.14%；The haplotype BnHapF atty that China is double No. 5 is also GG_
AA_GG, above-mentioned 6 character are respectively as follows: 4.02%, 0.81%, 61.74%, 17.33%, 1.31%, 4.77%, molecule are described
Label screening can be in seedling stage according to the content of genotype these character of Preliminary Identification effectively of haplotype.
To low oleic acid, low linoleic acid and high eicosenoic acid, high erucic acid material in oil 821, Zhejiang oil No. 7 (76337) and
Triumph 52 these three materials take blade respectively in seedling stage and extract DNA, utilize the primer of three SNP marker of BnHapFatty to carry out
Molecular Identification, and when later stage maturation, measure 6 fatty acid correlated traits in seed.Result shows: the list of these three material
Build BnHapFatty is AA_CC_AA, and the middle Palmic acid of oily 821, stearic acid, oleic acid, linoleic acid, eicosenoic acid and mustard
The content of acid is respectively 3.12%, 0.31%, 15.97%, 12.25%, 12.03% and 43.39%；Zhejiang oil 7 (76337) point
It is not 3.13%, 0.017%, 8.23%, 13.56%, 11.94% and 48.48%；Containing of triumph 52 these 6 kinds of fatty acid character
Amount is respectively 3.11%, 0.20%, 9.16%, 13.46%, 12.55% and 47.32%.
By identifying that above-mentioned haplotype BnHapFatty predicts the height of the content of 6 kinds of fatty acid character in Semen Brassicae campestris,
Carry out eliminating in seedling stage and can carry out eliminating of individual plant or strain, not only save production cost but also be greatly improved efficiency of selection,
The breeding process of rape variety can be improved rapidly.
SEQUENCE LISTING
<110>Inst. of Oil Crops, Chinese Academy of Agriculture
<120>a kind of haplotype BnHapFatty relevant to canola fatty acids character and application
<130>a kind of haplotype BnHapFatty relevant to canola fatty acids character and application
<160> 15
<170> PatentIn version 3.1
<210> 1
<211> 121
<212> DNA
<213>artificial sequence
<400> 1
ttatgtttta aaataaatgt attatttrca tatgttcaca accgcactct tttagaataa 60
ataactttct gagacatctg aaataatgca aaacagtaaa aatattttta ttagttattg 120
g 121
<210> 2
<211> 121
<212> DNA
<213>artificial sequence
<400> 2
ttatgtttta aaataaatgt attatttrca tatgttcaca accgcactct tttagaataa 60
gtaactttct gagacatctg aaataatgca aaacagtaaa aatattttta ttagttattg 120
g 121
<210> 3
<211> 121
<212> DNA
<213>artificial sequence
<400> 3
ctcttccaca ttaggctggt aaagtctcar ttctgaagtt ttgatttcgt gagtaacaac 60
taaacttact ttaatcgtcc atgttaaagt aatagaaaaa gaagaagata atttytaatc 120
t 121
<210> 4
<211> 121
<212> DNA
<213>artificial sequence
<400> 4
ctcttccaca ttaggctggt aaagtctcar ttctgaagtt ttgatttcgt gagtaacaac 60
gaaacttact ttaatcgtcc atgttaaagt aatagaaaaa gaagaagata atttytaatc 120
t 121
<210> 5
<211> 201
<212> DNA
<213>artificial sequence
<400> 5
tttctccagc aactcggtcg ccatggaagg gatcttatcg gaccttcgct cccacatcaa 60
aaaggtaatc actttgatgt ctaattgttt tgcagagacg atgactttct tacaagtgta 120
agtgtgttgt taggtgttgg ttggaggtgg agaggaggcw gtgaagagga acacaagtag 180
aaacaagctt ttgcctagag a 201
<210> 6
<211> 201
<212> DNA
<213>artificial sequence
<400> 6
tttctccagc aactcggtcg ccatggaagg gatcttatcg gaccttcgct cccacatcaa 60
aaaggtaatc actttgatgt ctaattgttt tgcagagacg gtgactttct tacaagtgta 120
agtgtgttgt taggtgttgg ttggaggtgg agaggaggcw gtgaagagga acacaagtag 180
aaacaagctt ttgcctagag a 201
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
tgttcacaac cgcactcttt 20
<210> 8
<211> 23
<212> DNA
<213>artificial sequence
<400> 8
tgcattattt cagatgtctc aga 23
<210> 9
<211> 23
<212> DNA
<213>artificial sequence
<400> 9
tctgaagttt tgatttcgtg agt 23
<210> 10
<211> 21
<212> DNA
<213>artificial sequence
<400> 10
acatggacga ttaaagtaag t 21
<210> 11
<211> 20
<212> DNA
<213>artificial sequence
<400> 11
tcttatcgga ccttcgctcc 20
<210> 12
<211> 20
<212> DNA
<213>artificial sequence
<400> 12
ccacctccaa ccaacaccta 20
<210> 13
<211> 50
<212> DNA
<213>artificial sequence
<400> 13
ataaaaatat ttttactgtt ttgcattatt tcagatgtct cagaaagtta 50
<210> 14
<211> 50
<212> DNA
<213>artificial sequence
<400> 14
ttatcttctt ctttttctat tactttaaca tggacgatta aagtaagttt 50
<210> 15
<211> 50
<212> DNA
<213>artificial sequence
<400> 15
tccacctcca accaacacct aacaacacac ttacacttgt aagaaagtca 50
Claims (6)
1. a haplotype BnHapFatty relevant to canola fatty acids character, including three SNP marker, is respectively as follows:
Bn-A08-p12814556, Bn-A08-p12820786 and Bn-A08-p12599446；
The sequence that what described Bn-A08-p12814556 was corresponding comprise SNP is SEQ ID NO.1 or shown in SEQ ID NO.2；
The sequence that what described Bn-A08-p12820786 was corresponding comprise SNP is SEQ ID NO.3 or shown in SEQ ID NO.4；
The sequence that what described Bn-A08-p12599446 was corresponding comprise SNP is SEQ ID NO.5 or shown in SEQ ID NO.6.
2. primer based on the sequential design comprising SNP corresponding to haplotype described in claim 1 or probe.
3. based on the primer of molecular marker design described in claim 1:
Bn-A08-p12814556:TGTTCACAACCGCACTCTTT, TGCATTATTTCAGATGTCTCAGA；
Bn-A08-p12820786:TCTGAAGTTTTGATTTCGTGAGT, ACATGGACGATTAAAGTAAGT；
Bn-A08-p12599446:TCTTATCGGACCTTCGCTCC, CCACCTCCAACCAACACCTA.
4. based on the probe of molecular marker design described in claim 1:
The probe sequence of Bn-A08-p12814556 is:
ATAAAAATATTTTTACTGTTTTGCATTATTTCAGATGTCTCAGAAAGTTA ；
The probe sequence of Bn-A08-p12820786 is:
TTATCTTCTTCTTTTTCTATTACTTTAACATGGACGATTAAAGTAAGTTT ；
The probe sequence of Bn-A08-p12599446 is:
TCCACCTCCAACCAACACCTAACAACACACTTACACTTGTAAGAAAGTCA。
5. haplotype BnHapFatty described in claim 1 or set based on described haplotype BnHapFatty SNP marker
The primer of meter or probe application in canola fatty acids content character breeding.
Application the most according to claim 5, described fatty acid is Palmic acid, stearic acid, oleic acid, linoleic acid, 20 carbon
Olefin(e) acid or erucic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610362173.7A CN105950734B (en) | 2016-05-27 | One kind haplotype BnHapFatty relevant to canola fatty acids character and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610362173.7A CN105950734B (en) | 2016-05-27 | One kind haplotype BnHapFatty relevant to canola fatty acids character and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105950734A true CN105950734A (en) | 2016-09-21 |
| CN105950734B CN105950734B (en) | 2019-07-16 |
Family
ID=
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699481A (en) * | 2019-11-20 | 2020-01-17 | 华中农业大学 | Gene closely related to glucosinolate content of rape leaves, molecular marker and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011075716A1 (en) * | 2009-12-18 | 2011-06-23 | Cargill, Incorporated | Brassica plants yielding oils with a low total saturated fatty acid content |
| CN103451283A (en) * | 2013-08-20 | 2013-12-18 | 华中农业大学 | Molecular detection method of Brassica napus self-incompatible S-locus haplotype |
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011075716A1 (en) * | 2009-12-18 | 2011-06-23 | Cargill, Incorporated | Brassica plants yielding oils with a low total saturated fatty acid content |
| CN103451283A (en) * | 2013-08-20 | 2013-12-18 | 华中农业大学 | Molecular detection method of Brassica napus self-incompatible S-locus haplotype |
Non-Patent Citations (1)
| Title |
|---|
| FENG LI等: "Genome-Wide Association Study Dissects the Genetic Architecture of SeedWeight and Seed Quality in Rapeseed (Brassica napus L.)", 《DNA RESEARCH》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699481A (en) * | 2019-11-20 | 2020-01-17 | 华中农业大学 | Gene closely related to glucosinolate content of rape leaves, molecular marker and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106676102B (en) | One kind SNP marker relevant to arachidonic acid content in Seed of Camellia oleifera grease and its application | |
| CN103060318B (en) | SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and application of SSR core primer group | |
| CN102286492B (en) | Major gene locus for thousand-grain weight trait of rape and application thereof | |
| Priolli et al. | Association mapping of oil content and fatty acid components in soybean | |
| CN105755140B (en) | The method that cotton cells matter male sterile restoring line InDel is marked and its identified | |
| CN110527738A (en) | Main effect QTL site, SNP marker and its application of cabbage type rape seed oleic acid content | |
| CN109929945B (en) | Molecular marker BrSF2604 primer of main effect QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
| CN108728575A (en) | Main effect QTL site, SNP marker and the application of cabbage type rape Pod length character | |
| CN108949907A (en) | One kind SNP marker primer pair relevant to Suhuai pig intramuscular fat content and its application | |
| TW201629228A (en) | Fine mapping and validation of QTL underlying fiber content and seed coat color traits and identification of SNP markers for marker assisted selection of these traits derived from yellow seed coat (YSC) canola line YN01-429 and its lineage | |
| CN107502665A (en) | Differentiate the method for locust tree kind based on Capillary Electrophoresis fluorescence SSR finger-prints | |
| CN110358854A (en) | Main effect QTL site, SNP marker exploitation and the application of one cabbage type rape main inflorescence silique number character | |
| CN103215289B (en) | Gene sequence a for causing watermelon bisexual flower development and obtaining method thereof | |
| CN105950734B (en) | One kind haplotype BnHapFatty relevant to canola fatty acids character and application | |
| CN110527739A (en) | Main effect QTL site, SNP marker and its application of cabbage type rape seed sulphur resources | |
| CN105950734A (en) | Haplotype BnHapFatty related with oilseed rape fatty acid character and application | |
| CN109880928A (en) | Detect SNP mutation occurs for rape als gene labeled primer, detection kit and its application | |
| CN102226189A (en) | Seed number per pod character major gene site of rape and application thereof | |
| CN111100946B (en) | Molecular marker primer of rape grain weight character major gene locus and application | |
| CN103667484B (en) | Oil content character main gene locus of rape 6F313 and applications thereof | |
| CN101613754B (en) | A pair of special primers for assisted evaluation of oil content locus of soybean kernel and method thereof | |
| CN110373489A (en) | KASP label relevant to wheat seed protein content and its application | |
| CN105803098B (en) | It is a kind of identify rape thio-glycoside content haplotype BnHapGLU and its application | |
| CN105002278B (en) | A kind of method and its application identified or aid in identification soybean kernel stearic acid content | |
| CN105441434B (en) | A kind of method for screening the high-quality ox kind of Blackett black cow and the primer and kit that use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |