CN105002278B - A kind of method and its application identified or aid in identification soybean kernel stearic acid content - Google Patents
A kind of method and its application identified or aid in identification soybean kernel stearic acid content Download PDFInfo
- Publication number
- CN105002278B CN105002278B CN201510437891.1A CN201510437891A CN105002278B CN 105002278 B CN105002278 B CN 105002278B CN 201510437891 A CN201510437891 A CN 201510437891A CN 105002278 B CN105002278 B CN 105002278B
- Authority
- CN
- China
- Prior art keywords
- stearic acid
- acid content
- soybean
- sequence
- map
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method and its application identified or aid in identification soybean kernel stearic acid content.A kind of identification or the method for auxiliary identification soybean kernel stearic acid content character that the present invention is provided, comprise the following steps：Detect the genotype based on Map 6506SNP sites in soybean gene group to be measured, if the soybean kernel with high stearic acid content character that AA is homozygous, soybean kernel to be measured is candidate, if the soybean kernel with low stearic acid content character that GG is homozygous, soybean kernel to be measured is candidate；The high stearic acid content refers to that stearic acid content is more than 3.7%；The low stearic acid content refers to that stearic acid content is less than 3.7%.It is demonstrated experimentally that a kind of method for identifying or aiding in identification soybean kernel stearic acid content character provided by the present invention can be used for identifying or aid in identifying the height of stearic acid content in soybean varieties to be measured.
Description
Technical field
Soybean kernel stearic acid content is identified the present invention relates to biological technical field, more particularly to a kind of identification or auxiliary
Method and its application.
Background technology
Soybean (Glycine max) is oil plant cereal crops important in the world, and its seed oil is the mankind and Animal nutrition
And the important sources of food processing industry vegetable edible oil.Soybean oil consumption accounts for 31% (Kim and of whole world edible oil
Krishnan, 2004).Soybean seed oil is mainly what is be made up of glycerine and aliphatic acid, and wherein aliphatic acid accounts for the 90% of seed oil
More than, mainly including palmitic acid (16:0) with stearic acid (18:0) two kinds of saturated fatty acids and oleic acid (18:1), linoleic acid (18:
2) with leukotrienes (18:3) three kinds of unrighted acids such as.Composition and its species proportioning of aliphatic acid determine the product of seed oil
Matter.Stearic acid is saturated fatty acid, is difficult to be absorbed by human digestive, but have no it is edible after the report unfavorable to human health, together
When, stearic acid content is improved, and can strengthen the stability and Shelf-life of soybean seed oil, the increase of soybean stearic acid content is also
The nutritive value of soybean can be increased.
Due to stearic acid content be by controlled by multiple genes quantitative character and easily it is affected by environment, utilize traditional phenotypic evaluation
The kind for cultivating high stearic acid content with breeding method not only needs to take a long time, and is difficult to success, can not
Enough meet the development of current high quality soybean breeding.With molecular labeling exploitation and use, molecular marker assisted selection
(Molecular marker-assisted selection, MAS), which turns into, can save human and material resources and acceleration breeding process
Effective ways (Cregan et al.1999).The great advantage of molecular marker assisted selection is that need not assess phenotype spy
In the case of levying, by being confirmed whether to identify the plant of high stearic acid content with target gene.
Be richly stored with gene in Soybean Germplasm, required for being excavated from material base-germ plasm resource of breeding
Excellent resources and gene can effectively facilitate soybean varieties improvement.It is used as the cultivated soybean area of origin, the Soybean Germplasm of China
Enrich, be now stored in national germplasm resource bank just there are more than 30,000 parts, made a variation on stearic acid content extensive the most in the world
(Liu Xingyuan etc., Crop Germplasm Resources, 1998).Studied and using China's soybean resource in order to effective, (the Crop Science such as Qiu Lijuan
Report, 2009) construct and can represent the multifarious Core Germplasms of China's Soybean Germplasm, to contain in deep excavation germ plasm resource
Favorable genes, effectively widen soybean heredity basis and established material foundation.
Association analysis, also known as association mapping (Association Mapping) are one kind with LD (Linkage
Disequlibrium based on) analyzing, directly genotypic variation and phenotypic variation are analyzed, so that those and character
The gene positioning method (Khush et al.2001) that related identified for genes comes out, it has also become excavate and phenotype correlation molecule
The powerful tool of mark.New molecular marker-SNP because with genome quantity it is many, widely distributed, can high flux
The advantages of detection and be widely used in recent years identification controlled by multiple genes complex character.With being on the increase for SNP marker quantity,
High-throughout SNP partings platform releases one after another, including Goladen Gate and BeadArray (Illumina), GenomeLab
SNP stream (Beckman) and MegAllele (Affymetrix) etc., wherein Illumina companies BeadArray chips
Identification technology have the advantages that efficiently, high flux, cost be low, accuracy is good, is adapted to number of sites from tens to thousands of medium logical
Measure Genotyping research, experiment success rate>99%, it is the solution of preferably middle high flux Genotyping detection, at present
It is widely used in the SNP partings of the species such as the mankind, arabidopsis, paddy rice.
The content of the invention
The purpose of the present invention is identification or auxiliary identifies soybean kernel stearic acid content character, and/or, screening or auxiliary sieve
Soybean kernel of the choosing with different stearic acid contents.
In order to solve the above technical problems, containing present invention firstly provides one kind identification or auxiliary identification soybean kernel stearic acid
The method for measuring character, it may include following steps：The genotype based on Map-6506SNP sites in soybean gene group to be measured is detected,
It is pure if GG if the soybean kernel with high stearic acid content character that AA is homozygous, soybean kernel to be measured is candidate
Mould assembly, soybean kernel to be measured are the soybean kernel with low stearic acid content character of candidate.
In order to solve the above technical problems, the present invention additionally provides a kind of screening or assisting sifting first has different stearic acid
The method of the soybean kernel of content, it may include following steps：Detect in soybean gene group to be measured based on Map-6506SNP sites
Genotype, if the soybean kernel with high stearic acid content character that AA is homozygous, soybean kernel to be measured is candidate, if
For the soybean kernel with low stearic acid content character that GG is homozygous, soybean kernel to be measured is candidate.
In the above method, the place gene in the Map-6506 sites is the 14th article of chromosome of soybean gene group
Glyma.14g121400 genes；The nucleotides sequence of the Glyma.14g121400 genes is classified as the sequence 1 of sequence table；It is described
Map-6506 sites are the 1777th of sequence 1 in sequence table.
In the above method, the high stearic acid content refers to that stearic acid content can be more than 3.7%；The low stearic acid
Content refers to that stearic acid content is less than 3.7%.
In the above method, the method for the genotype based on Map-6506SNP sites in the detection soybean gene group to be measured
It may include：(1) Soybean genomic DNA is extracted.(2) Map-6506 probe groups are added, allele-specific extension and company is carried out
Enzyme connection is connect, one section of fragment comprising Map-6506SNP sites and address sequence can be obtained.(3) obtained fragment is carried out
PCR amplification (in amplification system have Cy3 mark dATP, Cy5 mark dGTP, dCTP and dTTP) afterwards with the chip (U.S.
There is microballon, bead surface is connected with the complementary series of the address sequence on Illumina Products, chip) carry out it is miscellaneous
Hand over.(4) chip scanning, using software is according to two kinds of fluorescence color interpretations and exports genotyping result.So that it is determined that soybean product to be measured
It is that GG is homozygous or AA is homozygous to plant based on Map-6506SNP loci gene types.
Present invention also offers a kind of product.
Product provided by the present invention, can for polymorphism based on Map-6506SNP sites in detection soybean gene group or
The material of genotype；The function of the product is following (a), (b) or (c)：
(a) identify or aid in the stearic acid content character of identification soybean kernel；
(b) identify or aid in the related SNP of identification soybean kernel stearic acid content character；
(c) screening or assisting sifting have the soybean kernel of different stearic acid contents.
In the said goods, in the soybean gene group genotype based on Map-6506SNP sites can for AA it is homozygous or
GG is homozygous.
In the said goods, the place gene in the Map-6506 sites is the 14th article of chromosome of soybean gene group
Glyma.14g121400 genes；The nucleotides sequence of the Glyma.14g121400 genes is classified as the sequence 1 of sequence table；It is described
Map-6506 sites are the 1777th of sequence 1 in sequence table.
In the said goods, the polymorphism detected in soybean gene group based on Map-6506SNP sites or genotype
Material may include Map-6506SNP probe groups.
In the said goods, the stearic acid content is high stearic acid content or low stearic acid content；The high stearic acid contains
Amount refers to that stearic acid content can be more than 3.7%；The low stearic acid content refers to that stearic acid content is less than 3.7%.
Detect the material of polymorphism based on Map-6506SNP sites or genotype in soybean gene group following (1)-
(6) any application in falls within protection scope of the present invention：
(1) identify or aid in the stearic acid content character of identification soybean kernel；
(2) product of the stearic acid content character of identification or auxiliary identification soybean kernel is prepared；
(3) identify or aid in the related SNP of identification soybean kernel stearic acid content character；
(4) identification or the production of the related SNP of auxiliary identification soybean kernel stearic acid content character are prepared
Product；
(5) screening or assisting sifting have the soybean kernel of different stearic acid contents；
(6) preparation screening or assisting sifting have the product of the soybean kernel of different stearic acid contents.
In above-mentioned application, in (1) and/or (2), the stearic acid content character of the soybean kernel can be high hard
Resin acid content character or low stearic acid content character.The high stearic acid content refers to that stearic acid content can be more than 3.7%；
The low stearic acid content refers to that stearic acid content is less than 3.7%.
In above-mentioned application, in (3) and/or (4), the stearic acid content character of the soybean kernel can be high hard
Resin acid content character or low stearic acid content character.The high stearic acid content refers to that stearic acid content can be more than 3.7%；
The low stearic acid content refers to that stearic acid content is less than 3.7%.
In above-mentioned application, in (5) and/or (6), the soybean kernel with different stearic acid contents can be
Soybean kernel with high stearic acid content character or the soybean kernel with low stearic acid content character.The high stearic acid contains
Amount refers to that stearic acid content can be more than 3.7%；The low stearic acid content refers to that stearic acid content is less than 3.7%.
In above-mentioned application, in the soybean gene group genotype based on Map-6506SNP sites can for AA it is homozygous or
GG is homozygous.
In above-mentioned application, the place gene in the Map-6506 sites is the 14th article of chromosome of soybean gene group
Glyma.14g121400 genes；The nucleotides sequence of the Glyma.14g121400 genes is classified as the sequence 1 of sequence table；It is described
Map-6506 sites are the 1777th of sequence 1 in sequence table.
It is described to be used to detect the polymorphism or gene based on Map-6506SNP sites in soybean gene group in above-mentioned application
The material of type may include Map-6506SNP probe groups.
Any of the above-described Map-6506SNP probe groups can be made up of probe 1, probe 2 and probe 3：
The probe 1 is single strand dna, and the sequence of probe 1 is as shown in the nucleotides in sequence 2 in sequence table.
The probe 2 is single strand dna, and the sequence of probe 2 is as shown in the nucleotides in sequence 3 in sequence table.
The probe 3 is single strand dna, and the sequence of probe 3 is as shown in the nucleotides in sequence 4 in sequence table.
In the present invention, the high stearic acid content refers to that stearic acid content can be more than 3.7%；The low stearic acid contains
Amount refers to that stearic acid content is less than 3.7%.
It is demonstrated experimentally that a kind of method identified or aid in identification soybean kernel stearic acid content character provided by the present invention
It can be used for identifying or aid in identifying the height of soybean kernel stearic acid content in soybean varieties to be measured.The high stearic acid content
It is more than 3.7% to refer to stearic acid content；The low stearic acid content refers to that stearic acid content is less than 3.7%.
Embodiment
The present invention is further described in detail with reference to embodiment, the embodiment provided is only for explaining
The bright present invention, the scope being not intended to be limiting of the invention.
Experimental method in following embodiments, is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
Soybean Native Varieties and soybean breeding kind described in following embodiments are recorded in the following literature：Kingdom merit
Chinese soybean variety source catalogue Beijing：Chinese agriculture publishing house, 1982；Chang Ru towns, grandson builds English Chinese soybean variety sources
Catalogue：Sequel Beijing：Agriculture publishing house, 1991；Chang Ru towns, Sun Jianying, Qiu Lijuan, old dance Chinese soybean variety sources
Catalogue：Sequel two, Beijing：Chinese agriculture publishing house, 1996.
In following embodiments, the high stearic acid content refers to that stearic acid content can be more than 3.7%；The low tristearin
Acid content refers to that stearic acid content is less than 3.7%.
Embodiment 1, Map-6506SNP sites are the SNPs related to soybean kernel stearic acid content
First, Map-6506 mononucleotide polymorphism sites essential information
Map-6506 mononucleotide polymorphism sites are located at Glyma.14g121400 gene nucleotide series (sequence 1) the
1777, its essential information is shown in Table 1.
Table 1, Map-6506SNP mononucleotide polymorphism site essential informations
2nd, the association analysis of Map-6506SNP genotype and soybean kernel stearic acid content
1st, the preparation of Map-6506SNP probe groups
According to the full-length genome SNP data sets of independent development, Map-6506SNP sites and artificial synthesized Map- are screened
6506SNP probe groups：
Probe 1:ACTTCGTCAGTAACGGACGGCTCGCTCATCAGCGCGT (sequence 2 in sequence table)；
Probe 2:GAGTCGAGGTCATATCGTGGCTCGCTCATCAGCGCGC (sequence 3 in sequence table)；
Probe 3:CTTGCAACCTCCTAATCCTCTGTGGCAAATCAGATACGGTACTTGTCTGCCTATAGTGAGTC
(sequence 4 in sequence table).
The complementary series of address sequence is connected with the microballon of chip.
2nd, the foundation based on Map-6506SNP Genotyping methods
Using Illumina SNP detection platforms to 46 shown in 75 Soybean Native Varieties and table 3 shown in table 2
Individual genotype of the soybean breeding kind based on Map-6506SNP sites is detected.
Detection object is genomic DNA.Using genomic DNA as template, probe 1, probe 2 and spy prepared by step 1 are added
Pin 3, carries out allele-specific extension and ligase connection, can obtain one section and include Map-6506SNP sites and address
The fragment of sequence.By obtained fragment enter performing PCR amplification (in amplification system have Cy3 mark dATP, Cy5 mark dGTP,
DCTP and dTTP) (there is microballon, bead surface is connected with describedly on U.S.'s Illumina Products, chip with chip afterwards
The complementary series of location sequence) hybridized.Then chip scanning is carried out, using software is according to two kinds of fluorescence color interpretations and exports
Genotyping result.Determine that soybean varieties to be measured are based on Map-6506SNP loci gene types.
As a result show, it is that GG is homozygous or AA is homozygous that soybean varieties to be measured, which are based on Map-6506SNP loci gene types,.
3rd, the association analysis of Map-6506SNP genotype and soybean kernel stearic acid content
(1) stearic acid content of soybean kernel in soybean varieties is detected
In 2010,2011 and 2012 respectively by the soybean breeding kind in the Soybean Native Varieties in table 2 and table 3 in
Plant in Academy of Agricultural Sciences of state crop science research institute Sanya, Hainan base.Completely random district's groups experimental design side is used in field
Case, in triplicate.0.4 meter of field planting line width, row is long 1.5 meters, 0.1 meter of strain spacing.After seed harvest, by the same time, together
Three repetition seeds mixing of one kind, detects the stearic content of soybean kernel, then takes 3 years testing results of same kind
Average value, the stearic acid content of the kind is obtained, as a result as shown in table 2 and table 3.Detect that stearic acid content utilizes HP6890 gas
Chromatography (GC) (Agilent Technologies, Palo Alto, CA, USA) is carried out, and specific detection method refers to Yang
et al.Theor Appl Genet(2010)120:665–678。
(2) carried out according to what step 2 was set up based on Map-6506SNP sites in methods of genotyping, detection table 2 and table 3
Genotype of the soybean varieties based on Map-6506SNP sites, as a result shown in table 2 and table 3.Table 2 is 75 Soybean Native Varieties
Based on the genotype in Map-6506SNP sites, table 3 is 46 genotype of the soybean breeding kind based on Map-6506SNP sites.
2. 75 genotype of the Soybean Native Varieties based on Map-6506SNP sites of table
| Unified number | Variety name | Genotype | Stearic acid content (%) |
| ZDD18512 | Full hedge granule black soya bean | AA | 3.9 |
| ZDD08124 | Here over sixty years of age soya bean | AA | 3.9 |
| ZDD05465 | Chongming white hair is white August | AA | 3.9 |
| ZDD01629 | The big pea of white navel | AA | 3.9 |
| ZDD01060 | Yellow navel | AA | 3.9 |
| ZDD08564 | Roundlet soya bean | AA | 3.9 |
| ZDD07307 | Nine unfertile land height | AA | 3.9 |
| ZDD11044 | Black rolling beans | AA | 3.9 |
| ZDD08690 | Small soya bean | AA | 3.9 |
| ZDD07667 | Bear high mountain granule Huang -3 | AA | 4.0 |
| ZDD01421 | Go back storehouse within 60 days | AA | 4.0 |
| ZDD07809 | Iron pod is blue or green | AA | 4.0 |
| ZDD08603 | Small soya bean | AA | 4.0 |
| ZDD01068 | Little Bai navels | AA | 4.0 |
| ZDD13560 | White hair morning bean or pea | AA | 4.0 |
| ZDD07489 | Tonghua flat-top is fragrant | AA | 4.0 |
| ZDD17375 | Soya bean | AA | 4.0 |
| ZDD00932 | Big black navel | AA | 4.1 |
| WDD00626 | PI196160 | AA | 4.1 |
| ZDD01074 | Little Bai navels | AA | 4.1 |
| ZDD14092 | The fluffy beans of gold | AA | 4.1 |
| ZDD04430 | Taixing short-foot is red | AA | 4.1 |
| ZDD08018 | Miyun master's face | AA | 4.1 |
| ZDD06377 | Rise sub- beans in Xiamen | AA | 4.1 |
| ZDD01761 | First beans | AA | 4.1 |
| ZDD18529 | Opal beans | AA | 4.2 |
| ZDD03153 | The small seed in Miyang is yellow | AA | 4.2 |
| ZDD00294 | Green soya bean | AA | 4.2 |
| ZDD02400 | Summer black soya bean | AA | 4.2 |
| ZDD14240 | Duchang crow beans | AA | 4.4 |
| ZDD10812 | Sauce soya bean | GG | 3.2 |
| ZDD06358 | Dongshan Baima beans | GG | 3.2 |
| ZDD16859 | Precipice county soya bean | GG | 3.3 |
| ZDD12908 | Qionglai tenth of the twelve Earthly Branches river black soya bean | GG | 3.4 |
| ZDD08352 | Local big soya bean | GG | 3.4 |
| ZDD12910 | Hanyuan Bali Semen glycines sojae | GG | 3.4 |
| ZDD16743 | Lianjiang slope soya bean | GG | 3.4 |
| ZDD01169 | Ox hair is yellow | GG | 3.4 |
| ZDD16914 | Tianlin County Pingtang morning soya bean | GG | 3.4 |
| ZDD13341 | July is yellow | GG | 3.4 |
| ZDD06067 | Thick beans | GG | 3.5 |
| ZDD16675 | Big white hair beans | GG | 3.5 |
| ZDD02866 | Great Bai skins | GG | 3.5 |
| ZDD17989 | Yellow big grain | GG | 3.5 |
| ZDD17042 | Ring Jiang Bayue is yellow | GG | 3.5 |
| ZDD13636 | Mung bean | GG | 3.5 |
| ZDD22207 | Horse band black soya bean -3 | GG | 3.5 |
| ZDD12655 | Meishan is quick-fried June | GG | 3.5 |
| ZDD06461 | Shangrao is white August | GG | 3.5 |
| ZDD16011 | Plain boiled water beans | GG | 3.5 |
| ZDD03868 | The small oily beans in Pei County | GG | 3.5 |
| ZDD04092 | Strand rheum officinale shell first | GG | 3.5 |
| ZDD12872 | Qionglai Huang Westerner | GG | 3.5 |
| ZDD06494 | Husky heart beans | GG | 3.5 |
| ZDD01612 | Rabbit eye | GG | 3.5 |
| ZDD10261 | First alms bowl black soya bean | GG | 3.5 |
| ZDD03237 | Zhejiang river chicken coop is yellow | GG | 3.5 |
| ZDD14452 | Short-foot green grass or young crops (Jiangxi beans 2) | GG | 3.5 |
| ZDD07993 | Tong County soya bean | GG | 3.5 |
| ZDD08488 | Big black soya bean | GG | 3.5 |
| ZDD06856 | The small soya bean in Heihe | GG | 3.5 |
| ZDD12845 | Jiange jungle fowl nest beans | GG | 3.5 |
| ZDD07088 | Dragon's fountain soybean (brown navel) | GG | 3.5 |
| WDD00995 | PI88788 | GG | 3.5 |
| ZDD03740 | It is first June that the village is ground in Peixian County | GG | 3.5 |
| ZDD21440 | The precocious fluffy green grass or young crops of hair | GG | 3.5 |
| ZDD21528 | Spend Calusena lansium in vain | GG | 3.5 |
| ZDD10270 | Semen glycines sojae | GG | 3.5 |
| ZDD04081 | The flower of strand five bores top | GG | 3.6 |
| ZDD12386 | Big China's beans | GG | 3.6 |
| ZDD22145 | Big soya bean -2 | GG | 3.6 |
| ZDD02892 | Whooper swan egg | GG | 3.6 |
| ZDD20676 | June is yellow | GG | 3.6 |
| ZDD19027 | Shagreen soya bean | GG | 3.6 |
| ZDD00610 | Ox hair is yellow | GG | 3.6 |
3. 46 genotype of the soybean breeding kind based on Map-6506SNP sites of table
| Unified number | Variety name | Genotype | Stearic acid content (%) |
| ZDD00854 | Jinzhou 4-1 | AA | 3.8 |
| ZDD18845 | Shanxi beans 13 | AA | 3.8 |
| ZDD21485 | Spring becomes 11 | AA | 3.8 |
| ZDD23917 | Ji Huang 13 | AA | 3.8 |
| ZDD01807 | 7694-1 | AA | 3.8 |
| ZDD21208 | The Zhejiang spring No. 3 | AA | 3.8 |
| ZDD07244 | Win honour for No. 1 | AA | 3.8 |
| ZDD23898 | Stone soybean No. 1 | AA | 3.9 |
| ZDD23792 | Logical agriculture 13 | AA | 3.9 |
| WDD01192 | Xepcohckab2 | AA | 3.9 |
| ZDD23781 | Long agriculture 16 | AA | 3.9 |
| ZDD22659 | Close rich 37 | AA | 3.9 |
| ZDD06819 | Tender rich No. 11 | AA | 3.9 |
| ZDD14125 | Pu's beans 451 | AA | 4.0 |
| ZDD23822 | Distant beans 16 | AA | 4.0 |
| WDD01307 | Flora | AA | 4.0 |
| ZDD22793 | Jilin 35 | AA | 4.0 |
| ZDD06836 | Peaceful agriculture 6 | AA | 4.1 |
| ZDD00393 | Breathe out No. 1 | AA | 4.1 |
| ZDD06515 | Hunan beans 4 | AA | 4.1 |
| ZDD00059 | Male rich No. 1 | AA | 4.2 |
| WDD00001 | Clark | AA | 4.3 |
| ZDD23828 | Iron rich 30 | GG | 3.4 |
| ZDD17639 | Tibet soybean 4 | GG | 3.4 |
| WDD01420 | Pojabonar 856-3 | GG | 3.4 |
| ZDD11581 | Middle beans 24 | GG | 3.4 |
| ZDD20652 | 8307-8-1 | GG | 3.5 |
| ZDD19699 | Nasal mucus beans 2 | GG | 3.5 |
| ZDD10100 | Zheng 8516 | GG | 3.5 |
| ZDD24198 | Hunan spring beans 18 | GG | 3.5 |
| WDD01215 | Saikai 20 | GG | 3.5 |
| ZDD19339 | 8588 | GG | 3.5 |
| ZDD19963 | Anhui beans 15 | GG | 3.5 |
| ZDD23896 | Middle product 95-5383 | GG | 3.5 |
| ZDD11588 | 74-424 | GG | 3.5 |
| ZDD19410 | Henan beans 22 | GG | 3.5 |
| ZDD23910 | Ji beans 15 | GG | 3.5 |
| ZDD18847 | Shanxi beans 15 | GG | 3.6 |
| WDD01413 | WilenskabaranatraⅡ-2- 184 | GG | 3.6 |
| ZDD18277 | Red 382 | GG | 3.6 |
| ZDD18632 | Ji beans 7 | GG | 3.6 |
| ZDD19409 | Henan beans 18 | GG | 3.6 |
| WDD01328 | 60CMS superspecial | GG | 3.6 |
| ZDD08024 | Rich No. 6 of section | GG | 3.6 |
| ZDD18394 | Rich No. 1 of section | GG | 3.6 |
| ZDD02626 | Triumph 3 | GG | 3.6 |
The result of table 2 shows that 30 genotype of the kind based on Map-6506SNP sites are AA in 75 Soybean Native Varieties
Homozygous, the stearic average content of soybean kernel is 4.0% in the Soybean Native Varieties of this 30 kinds；75 soybeans
45 genotype of the kind based on Map-6506SNP sites are that GG is homozygous in square kind, soybean kernel in this 45 kinds
The stearic average content of Soybean Native Varieties is 3.5%.Significance test P<0.01.The result of table 3 shows that 46 soybean select
It is that AA is homozygous to educate 22 genotype of the kind based on Map-6506SNP sites in kind, the soybean breeding product of this 22 kinds
The stearic average content of soybean kernel is 4.0% in kind；24 kinds are based on Map- in 46 soybean breeding kinds
The genotype in 6506SNP sites is that GG is homozygous, and soybean kernel is stearic flat in the soybean breeding kind of this 24 kinds
Equal content is 3.5%.Significance test P<0.01.
Statistical result shows that the genotype based on Map-6506SNP sites is 30 homozygous Soybean Native Varieties of AA
In 22 soybean breeding kinds, the stearic acid content of 100% soybean kernel is more than 3.7%；Based on Map-6506SNP sites
Genotype in homozygous 45 Soybean Native Varieties and 24 soybean breeding kinds of GG, the tristearin of 100% soybean kernel
Acid content is less than 3.7%.
It is demonstrated experimentally that step 2 set up methods of genotyping is carried out based on Map-6506SNP sites can be used for identification and treat
Survey the height of soybean kernel stearic acid content in soybean varieties：Genotype of the soybean to be measured based on Map-6506SNP sites is detected,
If the genotype based on Map-6506SNP sites is that AA is homozygous, soybean kernel to be measured is candidate in soybean gene group to be measured
The soybean kernel with high stearic acid content character, if the base based on Map-6506SNP sites in soybean gene group to be measured
Because type is the soybean kernel with low stearic acid content character that GG is homozygous, soybean kernel to be measured is candidate.It is described high stearic
Acid content refers to that stearic acid content is more than 3.7%；The low stearic acid content refers to that stearic acid content is less than 3.7%.
Claims (8)
1. a kind of method identified or aid in identification soybean kernel stearic acid content character, comprises the following steps：Detection is to be measured big
Genotype based on Map-6506 SNP sites in beans genome, if the tool that AA is homozygous, soybean kernel to be measured is candidate
Have the soybean kernel of high stearic acid content character, if GG is homozygous, soybean kernel to be measured there is low stearic acid for candidate's
The soybean kernel of content character；
The place gene in the Map-6506 sites is the Glyma.14g121400 genes of the 14th article of chromosome of soybean gene group；
The nucleotides sequence of the Glyma.14g121400 genes is classified as the sequence 1 of sequence table；The Map-6506 sites is in sequence tables
The 1777th of sequence 1.
2. a kind of method that screening or assisting sifting have the soybean kernel of different stearic acid contents, comprises the following steps：Detection
Genotype based on Map-6506 SNP sites in soybean gene group to be measured, if AA is homozygous, soybean kernel to be measured is waits
The soybean kernel with high stearic acid content character of choosing, if GG is homozygous, soybean kernel to be measured be candidate with low
The soybean kernel of stearic acid content character；
The place gene in the Map-6506 sites is the Glyma.14g121400 genes of the 14th article of chromosome of soybean gene group；
The nucleotides sequence of the Glyma.14g121400 genes is classified as the sequence 1 of sequence table；The Map-6506 sites is in sequence tables
The 1777th of sequence 1.
3. method as claimed in claim 1 or 2, it is characterised in that：The high stearic acid content refers to that stearic acid content is
More than 3.7%；The low stearic acid content refers to that stearic acid content is less than 3.7%.
4. a kind of product, for the polymorphism or the material of genotype in detection soybean gene group based on Map-6506 SNP sites；
The function of the product is as follows（a）、（b）Or（c）：
（a）Identification or the stearic acid content character of auxiliary identification soybean kernel；
（b）Identification or the related SNP of auxiliary identification soybean kernel stearic acid content character；
（c）Screening or assisting sifting have the soybean kernel of different stearic acid contents；
The place gene in the Map-6506 sites is the Glyma.14g121400 genes of the 14th article of chromosome of soybean gene group；
The nucleotides sequence of the Glyma.14g121400 genes is classified as the sequence 1 of sequence table；The Map-6506 sites is in sequence tables
The 1777th of sequence 1.
It is as follows 5. detecting the application of the material of the polymorphism or genotype in soybean gene group based on Map-6506 SNP sites
（1）、（2）、（3）、（4）、（5）Or（6）：
（1）Identification or the stearic acid content character of auxiliary identification soybean kernel；
（2）Prepare the product of the stearic acid content character of identification or auxiliary identification soybean kernel；
（3）Identification or the related SNP of auxiliary identification soybean kernel stearic acid content character；
（4）Prepare the product of identification or the related SNP of auxiliary identification soybean kernel stearic acid content character；
（5）Screening or assisting sifting have the soybean kernel of different stearic acid contents；
（6）Preparation screening or assisting sifting have the product of the soybean kernel of different stearic acid contents；
The place gene in the Map-6506 sites is the Glyma.14g121400 genes of the 14th article of chromosome of soybean gene group；
The nucleotides sequence of the Glyma.14g121400 genes is classified as the sequence 1 of sequence table；The Map-6506 sites is in sequence tables
The 1777th of sequence 1.
6. the application described in product as claimed in claim 4 or claim 5, it is characterised in that：In the soybean gene group
Genotype based on Map-6506 SNP sites is that AA is homozygous or GG is homozygous.
7. the application described in product as claimed in claim 4 or claim 5, it is characterised in that：The stearic acid content is
High stearic acid content or low stearic acid content；The high stearic acid content refers to that stearic acid content is more than 3.7%；It is described low
Stearic acid content refers to that stearic acid content is less than 3.7%.
8. the application described in product as claimed in claim 4 or claim 5, it is characterised in that：It is described to be used to detect soybean
The material of polymorphism or genotype based on Map-6506SNP sites in genome includes Map-6506SNP probe groups；
The Map-6506SNP probe groups are made up of probe 1, probe 2 and probe 3；
The probe 1 is the single strand dna shown in sequence 2 in sequence table；
The probe 2 is the single strand dna shown in sequence 3 in sequence table；
The probe 3 is the single strand dna shown in sequence 4 in sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510437891.1A CN105002278B (en) | 2015-07-23 | 2015-07-23 | A kind of method and its application identified or aid in identification soybean kernel stearic acid content |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510437891.1A CN105002278B (en) | 2015-07-23 | 2015-07-23 | A kind of method and its application identified or aid in identification soybean kernel stearic acid content |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105002278A CN105002278A (en) | 2015-10-28 |
| CN105002278B true CN105002278B (en) | 2017-08-25 |
Family
ID=54375139
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510437891.1A Active CN105002278B (en) | 2015-07-23 | 2015-07-23 | A kind of method and its application identified or aid in identification soybean kernel stearic acid content |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105002278B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106048045B (en) * | 2016-07-13 | 2019-11-26 | 中国科学院遗传与发育生物学研究所 | Gene relevant to isoflavone like substance synthesis and photosynthesis and molecular labeling |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9271455B2 (en) * | 2007-05-31 | 2016-03-01 | Monsanto Technology Llc | Soybean polymorphisms and methods of genotyping |
| US8710295B2 (en) * | 2010-05-10 | 2014-04-29 | Pioneer Hi-Bred International Inc | Soybean sequences associated with the FAP3 locus |
-
2015
- 2015-07-23 CN CN201510437891.1A patent/CN105002278B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105002278A (en) | 2015-10-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ammar et al. | Assessment of genetic diversity among faba bean genotypes using agro-morphological and molecular markers | |
| Kurasiak-Popowska et al. | Analysis of yield and genetic similarity of Polish and Ukrainian Camelina sativa genotypes | |
| Prasanna | Phenotypic and molecular diversity of maize landraces: characterization and utilization | |
| Kallamadi et al. | Molecular diversity in castor (Ricinus communis L.) | |
| ES2843271T3 (en) | Fine mapping and validation of QTL underlying fiber content and seed coat color traits and identification of SNP markers for marker-assisted selection of these traits derived from the yellow seed coat (YSC) rapeseed line YN01- 429 and its lineage | |
| CN107201404A (en) | A kind of molecular biology identification method and its application for Asparagus dioecian plant sex | |
| Dong et al. | Studying genetic diversity in the core germplasm of confectionary sunflower (Helianthus annuus L.) in China based on AFLP and morphological analysis | |
| CN107794308A (en) | Identify special SNP and its application of wheat seed character | |
| Jin et al. | Genetic diversity and population structure in lentil (Lens culinaris Medik.) germplasm detected by SSR markers | |
| CN107937591A (en) | The SNP marker of the Ⅺ relevant QTL site of end low-temperature resistance saccharification of tuberosum chromosomes and its application | |
| Madhubabu et al. | Assessment of genetic variability for micronutrient content and agro-morphological traits in rice (Oryza sativa L.) | |
| CN105002278B (en) | A kind of method and its application identified or aid in identification soybean kernel stearic acid content | |
| CN103468791B (en) | Molecular marker assisted method used for variety selection of cowpea variety with grain-filling resistance, and PCR primer set used in molecular marker assisted method | |
| CN105567818A (en) | Method for identification or auxiliary identification of fat content of soybean seeds and applications thereof | |
| CN101768643A (en) | Auxiliary method for identifying wheat with different thousand grain weight properties, and special primer thereof | |
| CN105002279B (en) | A kind of method and its application identified or aid in identification soybean kernel linolenic acid content | |
| CN105132531B (en) | A kind of method and its application identified or aid in identification soybean kernel palmitic acid content | |
| Liu et al. | SRAP markers and morphological traits could be used in test of distinctiveness, uniformity, and stability (DUS) of lettuce (Lactuca sativa) varieties | |
| CN103667484B (en) | Oil content character main gene locus of rape 6F313 and applications thereof | |
| CN101613754B (en) | A pair of special primers for assisted evaluation of oil content locus of soybean kernel and method thereof | |
| Pushpavalli et al. | Discerning genetic diversity among super early pigeonpea germplasm using microsatellite markers | |
| CN106811508A (en) | With the molecular labeling SVmc3 of hasked millet color gene close linkage | |
| CN106811509A (en) | With the molecular labeling SVmc2 of hasked millet color gene close linkage | |
| CN110373489A (en) | KASP label relevant to wheat seed protein content and its application | |
| Chepkoech et al. | Assessment of genetic variability of passion fruit using simple sequence repeat (SSR) markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |