CN105002279B - A kind of method and its application identified or aid in identification soybean kernel linolenic acid content - Google Patents
A kind of method and its application identified or aid in identification soybean kernel linolenic acid content Download PDFInfo
- Publication number
- CN105002279B CN105002279B CN201510438014.6A CN201510438014A CN105002279B CN 105002279 B CN105002279 B CN 105002279B CN 201510438014 A CN201510438014 A CN 201510438014A CN 105002279 B CN105002279 B CN 105002279B
- Authority
- CN
- China
- Prior art keywords
- soybean
- linolenic acid
- map
- linolenic
- acid content
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method and its application identified or aid in identification soybean kernel linolenic acid content.A kind of method identified or auxiliary identifies soybean kernel linolenic acid content character provided by the invention, includes the following steps:Detect the genotype based on 6017 SNP sites of Map in soybean genome to be measured, if the soybean kernel with high linolenic content character that TT is homozygous, soybean kernel to be measured is candidate, if the soybean kernel with low linolenic character that CC is homozygous, soybean kernel to be measured is candidate;The high linolenic content refers to that linolenic acid content is more than 8.5%;The low linolenic refers to that linolenic acid content is less than 8.5%.It is demonstrated experimentally that a kind of method for identifying or aiding in identification soybean kernel linolenic acid content character provided by the present invention can be used for identifying or aid in identifying the height of linolenic acid content in soybean varieties to be measured.
Description
Technical field
The present invention relates to biological technical field, more particularly to a kind of identification or auxiliary to identify soybean kernel linolenic acid content
Method and its application.
Background technology
Soybean (Glycine max) is oil plant cereal crops important in the world, its seed oil is the mankind and Animal nutrition
And the important sources of food processing industry vegetable edible oil.Soybean oil dosage accounts for 31% (Kim and of whole world edible oil
Krishnan, 2004).Soybean seed oil is mainly what is be made of glycerine and aliphatic acid, and wherein aliphatic acid accounts for the 90% of seed oil
More than, mainly including palmitic acid (16:0) with stearic acid (18:0) two kinds of saturated fatty acids and oleic acid (18:1), linoleic acid (18:
2) with leukotrienes (18:3) three kinds of unrighted acids such as.Composition and its species proportioning of aliphatic acid determine the product of seed oil
Matter.Leukotrienes is essential fatty acid, and having reduces the important physiology work(such as serum cholesterol and triglycerides and softening blood vessel
Can, it is referred to as " safe fats acid " by nutritionist.The World Health Organization and FAO (Food and Agriculture Organization of the United Nation) point out:" in view of more insatiable hungers
With aliphatic acid human development and health in have the function that it is indispensable, it is proposed that should all contain in all dispensed food for baby
Polyunsaturated fatty acid ".Leukotrienes has different physiological roles, is the docosahexaenoic acid (DHA) being rich in deep sea fish oil
With the important metabolic precursor thereof of eicosapentaenoic acid (EPA), especially to living in hinterland, seldom edible deep-sea product people
Health is particularly important.Leukotrienes and its metabolin must be added in American and Britain, method, moral, Deng states law-making stipulation infant food.
In order to solve the problems, such as that our people absorbs flax subacidity, it is necessary to improve soybean linolenic acid content, improve Fatty acids composition with
Increase the nutritive value of soybean.
Due to linolenic acid content be by controlled by multiple genes quantitative character and easily it is affected by environment, utilize traditional phenotypic evaluation
The kind of high linolenic content is cultivated with breeding method not only to be needed to take a long time, and is difficult to success, cannot
Enough meet the development of current high quality soybean breeding.With the exploitation and use of molecular labeling, molecular marker assisted selection
(Molecular marker-assisted selection, MAS), which becomes, can save human and material resources and acceleration breeding process
Effective ways (Cregan et al.1999).The great advantage of molecular marker assisted selection is that need not assess phenotype spy
In the case of sign, by being confirmed whether to identify the plant of high linolenic content with target gene.
Be richly stored with gene in Soybean Germplasm, required for being excavated from material base-germ plasm resource of breeding
Excellent resources and gene can effectively facilitate soybean varieties improvement.As the cultivated soybean area of origin, the Soybean Germplasm in China
The abundantest in the world, be now stored in national germplasm resource bank just has more than 30,000 parts, makes a variation on linolenic acid content extensive
(Liu Xingyuan etc., Crop Germplasm Resources, 1998).In order to effectively study and utilize the (Crop Sciences such as China's soybean resource, Qiu Lijuan
Report, 2009) construct and can represent the multifarious Core Germplasms of China's Soybean Germplasm, to contain in deep excavation germ plasm resource
Favorable genes, effectively widen soybean heredity basis and established material foundation.
Association analysis, also known as association mapping (Association Mapping) are one kind with LD (Linkage
Disequlibrium based on) analyzing, directly genotypic variation and phenotypic variation are analyzed, so that those and character
Related identified for genes comes out the gene positioning method of (Khush et al.2001), it has also become excavates and phenotype correlation molecule
The powerful tool of mark.New molecular marker-SNP because with genome quantity it is more, it is widely distributed, can high throughput
The advantages that detection and be widely used in recent years identification controlled by multiple genes complex character.With being on the increase for SNP marker quantity,
High-throughout SNP partings platform releases one after another, including Goladen Gate and BeadArray (Illumina), GenomeLab
The BeadArray chips of SNP stream (Beckman) and MegAllele (Affymetrix) etc., wherein Illumina companies
Identification technology have the advantages that efficiently, high throughput, cost is low, accuracy is good, be adapted to number of sites from tens to thousands of medium logical
Measure Genotyping research, experiment success rate>99%, it is the solution of preferably middle high throughput Genotyping detection, at present
It is widely used in the SNP partings of the species such as the mankind, arabidopsis, rice.
The content of the invention
The purpose of the present invention is identifying or aiding in identification soybean kernel linolenic acid content character, and/or, screening or auxiliary sieve
Soybean kernel of the choosing with different linolenic acid contents.
To contain in order to solve the above technical problems, present invention firstly provides one kind identification or auxiliary identification soybean kernel leukotrienes
The method for measuring character, it may include following steps:The genotype based on Map-6017SNP sites in soybean genome to be measured is detected,
It is pure if CC if the soybean kernel with high linolenic content character that TT is homozygous, soybean kernel to be measured is candidate
Mould assembly, the soybean kernel with low linolenic character that soybean kernel to be measured is candidate.
In order to solve the above technical problems, present invention also offers one kind screening or assisting sifting to have different linolenic acid contents
Soybean kernel method, it may include following steps:Detect the gene based on Map-6017SNP sites in soybean genome to be measured
Type, if the soybean kernel with high linolenic content character that TT is homozygous, soybean kernel to be measured is candidate, if CC
Soybean kernel homozygous, to be measured is the soybean kernel with low linolenic character of candidate.
In the above method, the place gene in the Map-6017 sites is the 2nd article of chromosome of soybean genome
Glyma.02g138100 genes;The nucleotides sequence of the Glyma.02g138100 genes is classified as the sequence 1 of sequence table;It is described
Map-6017 sites are the 3230th of sequence 1 in sequence table.
In the above method, the high linolenic content refers to that linolenic acid content can be more than 8.5%;The low linolenic
Content refers to that linolenic acid content is less than 8.5%.
In the above method, the method for the genotype based on Map-6017SNP sites in the detection soybean genome to be measured
It may include:(1) Soybean genomic DNA is extracted.(2) Map-6017 probe groups are added, carry out allele-specific extension and company
Enzyme connection is connect, one section of fragment comprising Map-6017SNP sites and address sequence can be obtained.(3) obtained fragment is carried out
PCR amplification (in amplification system have Cy3 mark dATP, Cy5 mark dGTP, dCTP and dTTP) afterwards with the chip (U.S.
Illumina Products, have microballon on chip, bead surface is connected with the complementary series of described address sequence) carry out it is miscellaneous
Hand over.(4) chip scanning, according to two kinds of fluorescence color interpretations and genotyping result is exported using software.So that it is determined that soybean product to be measured
Kind is that TT is homozygous or CC is homozygous based on Map-6017SNP loci gene types.
Present invention also offers a kind of product.
Product provided by the present invention, can be in detection soybean genome polymorphism based on Map-6017SNP sites or
The material of genotype;The function of the product is following (a), (b) or (c):
(a) identify or aid in the linolenic acid content character of identification soybean kernel;
(b) identify or aid in the identification relevant single nucleotide polymorphism of soybean kernel linolenic acid content character;
(c) screening or assisting sifting have the soybean kernel of different linolenic acid contents.
In the said goods, genotype based on Map-6017SNP sites in the soybean genome can be TT it is homozygous or
CC is homozygous.
In the said goods, the place gene in the Map-6017 sites is the 2nd article of chromosome of soybean genome
Glyma.02g138100 genes;The nucleotides sequence of the Glyma.02g138100 genes is classified as the sequence 1 of sequence table;It is described
Map-6017 sites are the 3230th of sequence 1 in sequence table.
In the said goods, the polymorphism detected in soybean genome based on Map-6017SNP sites or genotype
Material may include Map-6017SNP probe groups.
In the said goods, the linolenic acid content is high linolenic content or low linolenic;The high linolenic contains
Amount refers to that linolenic acid content can be more than 8.5%;The low linolenic refers to that linolenic acid content is less than 8.5%.
Detect in soybean genome the material of polymorphism based on Map-6017SNP sites or genotype following (1)-
(6) any application in falls within protection scope of the present invention:
(1) identify or aid in the linolenic acid content character of identification soybean kernel;
(2) product of the linolenic acid content character of identification or auxiliary identification soybean kernel is prepared;
(3) identify or aid in the identification relevant single nucleotide polymorphism of soybean kernel linolenic acid content character;
(4) identification or the production of the auxiliary identification relevant single nucleotide polymorphism of soybean kernel linolenic acid content character are prepared
Product;
(5) screening or assisting sifting have the soybean kernel of different linolenic acid contents;
(6) product of the soybean kernel of screening or assisting sifting with different linolenic acid contents is prepared.
In above application, in (1) and/or (2), the linolenic acid content character of the soybean kernel can be Gao Ya
Numb acid content character or low linolenic character.The high linolenic content refers to that linolenic acid content can be more than 8.5%;
The low linolenic refers to that linolenic acid content is less than 8.5%.
In above application, in (3) and/or (4), the linolenic acid content character of the soybean kernel can be Gao Ya
Numb acid content character or low linolenic character.The high linolenic content refers to that linolenic acid content can be more than 8.5%;
The low linolenic refers to that linolenic acid content is less than 8.5%.
In above application, in (5) and/or (6), the soybean kernel with different linolenic acid contents can be
Soybean kernel with high linolenic content character or the soybean kernel with low linolenic character.The high linolenic contains
Amount refers to that linolenic acid content can be more than 8.5%;The low linolenic refers to that linolenic acid content is less than 8.5%.
In above application, genotype based on Map-6017SNP sites in the soybean genome can be TT it is homozygous or
CC is homozygous.
In above application, the place gene in the Map-6017 sites is the 2nd article of chromosome of soybean genome
Glyma.02g138100 genes;The nucleotides sequence of the Glyma.02g138100 genes is classified as the sequence 1 of sequence table;It is described
Map-6017 sites are the 3230th of sequence 1 in sequence table.
It is described to be used to detect the polymorphism or gene based on Map-6017SNP sites in soybean genome in above application
The material of type may include Map-6017SNP probe groups.
Any of the above-described Map-6017SNP probe groups can be made of probe 1, probe 2 and probe 3:
The probe 1 is single strand dna, and the sequence of probe 1 is as shown in the nucleotide in sequence 2 in sequence table.
The probe 2 is single strand dna, and the sequence of probe 2 is as shown in the nucleotide in sequence 3 in sequence table.
The probe 3 is single strand dna, and the sequence of probe 3 is as shown in the nucleotide in sequence 4 in sequence table.
In the present invention, the high linolenic content refers to that linolenic acid content can be more than 8.5%;The low linolenic contains
Amount refers to that linolenic acid content is less than 8.5%.
A kind of it is demonstrated experimentally that method identified or auxiliary identifies soybean kernel linolenic acid content character provided by the present invention
It can be used for identifying or aid in identifying the height of soybean kernel linolenic acid content in soybean varieties to be measured.The high linolenic content
It is more than 8.5% to refer to linolenic acid content;The low linolenic refers to that linolenic acid content is less than 8.5%.
Embodiment
The present invention is further described in detail with reference to embodiment, the embodiment provided is only for explaining
The bright present invention, the scope being not intended to be limiting of the invention.
Experimental method in following embodiments, is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples, is commercially available unless otherwise specified.
Soybean Native Varieties and soybean breeding kind described in following embodiments are recorded in the following literature:Kingdom merit
Chinese soybean variety source catalogue Beijing:Chinese agriculture publishing house, 1982;Chang Ru towns, grandson build English Chinese soybean variety sources
Catalogue:Sequel Beijing:Agriculture publishing house, 1991;Chang Ru towns, Sun Jianying, Qiu Lijuan, old dance Chinese soybean variety sources
Catalogue:Sequel two, Beijing:Chinese agriculture publishing house, 1996.
In following embodiments, the high linolenic content refers to that linolenic acid content can be more than 8.5%;Described low flax
Acid content refers to that linolenic acid content is less than 8.5%.
Embodiment 1, Map-6017SNP sites are and the relevant single nucleotide polymorphism of soybean kernel linolenic acid content
First, Map-6017 mononucleotide polymorphism sites essential information
Map-6017 mononucleotide polymorphism sites are located at Glyma.02G138100 gene nucleotide series (sequence 1)
3230, its essential information is shown in Table 1.
Table 1, Map-6017SNP mononucleotide polymorphism site essential informations
2nd, Map-6017SNP genotype and the association analysis of soybean kernel linolenic acid content
1st, the preparation of Map-6017SNP probe groups
According to the full-length genome SNP data sets of independent development, Map-6017SNP sites and artificial synthesized Map- are screened
6017SNP probe groups:
Probe 1:ACTTCGTCAGTAACGGACGGATTCTTGGCGGCAGCCCA (sequence 2 in sequence table);
Probe 2:GAGTCGAGGTCATATCGTGGATTCTTGGCGGCAGCCCG (sequence 3 in sequence table);
Probe 3:AAATGTATTCTTGAGCCTTTCTTTGGACCAGAGCACGGGTAGTTTGTCTGCCTATAGTGAGTC
(sequence 4 in sequence table).
The complementary series of address sequence is connected with the microballon of chip.
2nd, the foundation based on Map-6017SNP Genotyping methods
Using the SNP detection platforms of Illumina to 27 shown in 59 Soybean Native Varieties and table 3 shown in table 2
A genotype of the soybean breeding kind based on Map-6017SNP sites is detected.
Detection object is genomic DNA.Using genomic DNA as template, probe 1, probe 2 and spy prepared by step 1 are added
Pin 3, carries out allele-specific extension and is connected with ligase, can obtain one section and include Map-6017SNP sites and address
The fragment of sequence.By obtained fragment carry out PCR amplification (in amplification system have Cy3 mark dATP, Cy5 mark dGTP,
DCTP and dTTP) (U.S.'s Illumina Products, have microballon on chip, bead surface is connected with describedly with chip afterwards
The complementary series of location sequence) hybridized.Then chip scanning is carried out, according to two kinds of fluorescence color interpretations and is exported using software
Genotyping result.Determine that soybean varieties to be measured are based on Map-6017SNP loci gene types.
The result shows that it is that CC is homozygous or TT is homozygous that soybean varieties to be measured, which are based on Map-6017SNP loci gene types,.
3rd, Map-6017SNP genotype and the association analysis of soybean kernel linolenic acid content
(1) linolenic acid content of soybean kernel in soybean varieties is detected
In 2010,2011 and 2012 respectively by the soybean breeding kind in the Soybean Native Varieties in table 2 and table 3 in
Plant in Academy of Agricultural Sciences of state crop science research institute Sanya, Hainan base.Completely random district's groups experimental design side is used in field
Case, in triplicate.0.4 meter of field planting line width, row is 1.5 meters long, 0.1 meter of strain spacing.After seed harvest, by the same time, together
One kind repeats seed mixing three times, detects the linolenic content of soybean kernel, then takes 3 years testing results of same kind
Average value, the linolenic acid content of the kind is obtained, as a result as shown in table 2 and table 3.Detection linolenic acid content utilizes HP6890 gas
Chromatography (GC) (Agilent Technologies, Palo Alto, CA, USA) carries out, and specific detection method refers to Yang
et al.Theor Appl Genet(2010)120:665–678。
(2) methods of genotyping is carried out based on Map-6017SNP sites according to what step 2 was established, detected in table 2 and table 3
Genotype of the soybean varieties based on Map-6017SNP sites, as a result shown in table 2 and table 3.Table 2 is 59 Soybean Native Varieties
Based on the genotype in Map-6017SNP sites, table 3 is 27 genotype of the soybean breeding kind based on Map-6017SNP sites.
Genotype of the soybean kernel based on Map-6017SNP sites of 2. 59 Soybean Native Varieties of table
Unified number | Variety name | Genotype based on Map-6017SNP sites | Linolenic acid content (%) |
ZDD13233 | Winter soya bean -1 | TT | 9.2 |
ZDD03540 | The red skin gleditsia sinensis seed of universal love | TT | 9.3 |
ZDD07993 | Tong County soya bean | TT | 9.4 |
ZDD09566 | Black soya bean | TT | 9.4 |
ZDD14505 | Yizhang is yellow June | TT | 9.5 |
ZDD05494 | Honghu is quick-fried June | TT | 9.5 |
ZDD07580 | Baicheng fodder food beans | TT | 9.5 |
ZDD02096 | Its goose egg | TT | 9.5 |
ZDD06375 | Smalt benevolence | TT | 9.6 |
ZDD14782 | Long sand mud beans | TT | 9.6 |
ZDD08510 | Big black soya bean | TT | 9.7 |
ZDD06438 | Sha County crow beans | TT | 9.7 |
ZDD14783 | Short raw mud beans are 1. | TT | 9.8 |
ZDD12453 | Qu County is yellow August | TT | 9.9 |
ZDD16859 | Precipice county soya bean | TT | 9.9 |
ZDD14252 | The early black beans in Fengcheng | TT | 10.0 |
ZDD08728 | White Dew beans | TT | 10.0 |
ZDD06363 | Big grain is yellow | TT | 10.0 |
ZDD11323 | Dantu's little Wu first | TT | 10.1 |
ZDD07610 | Kingsoft tea fodder food beans | TT | 10.1 |
ZDD08986 | Small 2 > of white peas or beans < | TT | 10.1 |
ZDD03237 | Zhejiang river chicken coop is yellow | TT | 10.2 |
ZDD06377 | Rise sub- beans in Xiamen | TT | 10.5 |
ZDD09832 | Green soya bean | TT | 10.5 |
ZDD20676 | June is yellow | TT | 10.6 |
ZDD04620 | Taixing ox hair Huang second | TT | 10.6 |
ZDD08251 | Big village Semen glycines sojae | TT | 10.6 |
ZDD03651 | Black soya bean | TT | 10.9 |
ZDD03191 | Zhongmou County iron angle two is rough | TT | 11.2 |
ZDD00698 | Dark brown beans | CC | 7.4 |
ZDD11014 | Green rolling beans | CC | 7.5 |
ZDD10812 | Sauce soya bean | CC | 7.6 |
ZDD15624 | Gleditsia sinensis beans | CC | 7.6 |
ZDD00326 | Founder fodder food beans | CC | 7.6 |
ZDD18529 | Opal beans | CC | 7.6 |
ZDD01074 | Little Bai navels | CC | 7.7 |
ZDD20340 | Green meat casting skin beans | CC | 7.8 |
ZDD00603 | Changchun is bought securities with all one's capital gold | CC | 7.8 |
ZDD01612 | Rabbit eye | CC | 7.9 |
ZDD01489 | Jade beans | CC | 7.9 |
ZDD04092 | Strand rheum officinale shell first | CC | 7.9 |
ZDD08564 | Roundlet soya bean | CC | 8.0 |
ZDD00383 | Gold dollar 1 | CC | 8.1 |
ZDD06358 | Dongshan Baima beans | CC | 8.1 |
ZDD02159 | Big black soya bean | CC | 8.1 |
ZDD09773 | Bovine eye | CC | 8.1 |
ZDD00294 | Green soya bean | CC | 8.1 |
ZDD17989 | Yellow big grain | CC | 8.1 |
ZDD00638 | Unfertile land is high | CC | 8.1 |
ZDD07370 | Cherish the big grain of moral white flower | CC | 8.1 |
ZDD00078 | Buy securities with all one's capital gold | CC | 8.1 |
ZDD05465 | Chongming white hair is white August | CC | 8.2 |
ZDD17233 | Ebony Hill benevolence peak soya bean | CC | 8.2 |
ZDD14092 | The fluffy beans of gold | CC | 8.2 |
ZDD11159 | Spend greenish-yellow beans | CC | 8.2 |
ZDD18771 | Green soya bean | CC | 8.2 |
ZDD11703 | Dawn soya bean | CC | 8.2 |
ZDD04572 | Wujiang ox hair in May is yellow | CC | 8.2 |
ZDD06856 | The small soya bean in Heihe | CC | 8.2 |
3. 27 genotype of the soybean breeding kind based on Map-6017SNP sites of table
Unified number | Variety name | Genotype based on Map-6017SNP sites | Linolenic acid content (%) |
WDD00903 | Punjab-1 | TT | 8.4 |
ZDD14190 | The white autumn No. 1 | TT | 10.7 |
ZDD23883 | Middle yellow 20 | TT | 9.4 |
WDD01192 | Xepcohckab2 | CC | 7.8 |
ZDD01797 | 7651-1 | CC | 7.9 |
WDD01069 | Biaoge du lot et gerome | CC | 7.9 |
ZDD22798 | It is lucky No. 138 yellow | CC | 7.9 |
ZDD00059 | Male rich No. 1 | CC | 8.0 |
ZDD19699 | Nasal mucus beans 2 | CC | 8.0 |
ZDD18870 | Dongshan 69 | CC | 8.0 |
ZDD10100 | Zheng 8516 | CC | 8.0 |
ZDD18632 | Ji beans 7 | CC | 8.1 |
ZDD08697 | Elm selects No. 13 | CC | 8.1 |
ZDD18845 | Shanxi beans 13 | CC | 8.2 |
ZDD00393 | Breathe out No. 1 | CC | 8.2 |
ZDD06823 | Close rich 25 | CC | 8.3 |
WDD01420 | Pojabonar 856-3 | CC | 8.3 |
ZDD11588 | 74-424 | CC | 8.3 |
ZDD00003 | Black agriculture 2 | CC | 8.3 |
ZDD23221 | Weihe River J127 | CC | 8.3 |
ZDD19339 | 8588 | CC | 8.4 |
ZDD06819 | Tender rich No. 11 | CC | 8.4 |
ZDD22642 | Black life 101 | CC | 8.4 |
ZDD19410 | Henan beans 22 | CC | 8.4 |
ZDD01807 | 7694-1 | CC | 8.4 |
ZDD04451 | Gold is big by 332 | CC | 8.4 |
WDD01442 | It is general wide | CC | 8.4 |
Table 2 is the results show that 29 genotype of the kind based on Map-6017SNP sites are TT in 59 Soybean Native Varieties
Homozygous, the linolenic average content of soybean kernel is 9.96% in the Soybean Native Varieties of this 29 kinds;59 soybean
30 genotype of the kind based on Map-6017SNP sites are homozygous for CC in local varieties, the Soybean Native of this 30 kinds
The linolenic average content of soybean kernel is 7.96% in kind.Significance test P<0.01.Table 3 is the results show that 27 big
3 genotype of the kind based on Map-6017SNP sites are homozygous for TT in beans Cultivars, the soybean breeding of this 3 kinds
The linolenic average content of soybean kernel is 9.50% in kind;24 kinds are based on Map- in 27 soybean breeding kinds
The genotype in 6017SNP sites is homozygous for CC, and soybean kernel is linolenic flat in the soybean breeding kind of this 24 kinds
Equal content is 8.18%.Significance test P<0.01.
Statistical result shows that the genotype based on Map-6017SNP sites is 29 homozygous TT Soybean Native Varieties
In 3 soybean breeding kinds, the linolenic acid content of 97% soybean kernel is more than 8.5%;Based on Map-6017SNP sites
Genotype is the leukotrienes of 100% soybean kernel in CC homozygous 30 Soybean Native Varieties and 24 soybean breeding kinds
Content is less than 8.5%.
It is demonstrated experimentally that step 2 establish methods of genotyping is carried out based on Map-6017SNP sites can be used for identification and treat
Survey the height of soybean kernel linolenic acid content in soybean varieties:Genotype of the soybean to be measured based on Map-6017SNP sites is detected,
If the genotype based on Map-6017SNP sites in soybean genome to be measured is that TT is homozygous, soybean kernel to be measured is candidate
The soybean kernel with high linolenic content character, if the base based on Map-6017SNP sites in soybean genome to be measured
Because type is the soybean kernel with low linolenic character that CC is homozygous, soybean kernel to be measured is candidate.Described high flax
Acid content refers to that linolenic acid content is more than 8.5%;The low linolenic refers to that linolenic acid content is less than 8.5%.
Claims (7)
1. a kind of method identified or auxiliary identifies soybean kernel linolenic acid content character, includes the following steps:Detect to be measured big
Genotype based on Map-6017 SNP sites in beans genome, if the tool that TT is homozygous, soybean kernel to be measured is candidate
There is the soybean kernel of high linolenic content character, if CC is homozygous, soybean kernel to be measured has low linolenic for candidate's
The soybean kernel of content character;
The place gene in the Map-6017 sites is the Glyma.02g138100 genes of the 2nd article of chromosome of soybean genome;Institute
The nucleotides sequence for stating Glyma.02g138100 genes is classified as the sequence 1 of sequence table;The Map-6017 sites are sequence in sequence table
The 3230th of row 1.
2. a kind of method that screening or assisting sifting have the soybean kernel of different linolenic acid contents, includes the following steps:Detection
Genotype based on Map-6017 SNP sites in soybean genome to be measured, if TT is homozygous, soybean kernel to be measured is waits
The soybean kernel with high linolenic content character of choosing, if CC is homozygous, soybean kernel to be measured is candidate with low
The soybean kernel of linolenic acid content character;
The place gene in the Map-6017 sites is the Glyma.02g138100 genes of the 2nd article of chromosome of soybean genome;Institute
The nucleotides sequence for stating Glyma.02g138100 genes is classified as the sequence 1 of sequence table;The Map-6017 sites are sequence in sequence table
The 3230th of row 1.
3. method as claimed in claim 1 or 2, it is characterised in that:The high linolenic content refers to that linolenic acid content is
More than 8.5%;The low linolenic refers to that linolenic acid content is less than 8.5%.
It is as follows 4. detecting the application of the material of the polymorphism or genotype in soybean genome based on Map-6017 SNP sites
(1)、(2)、(3)、(4)、(5)Or(6):
(1)Identification or the linolenic acid content character of auxiliary identification soybean kernel;
(2)Prepare the product of the linolenic acid content character of identification or auxiliary identification soybean kernel;
(3)Identification or the auxiliary identification relevant single nucleotide polymorphism of soybean kernel linolenic acid content character;
(4)Prepare the product of identification or the auxiliary identification relevant single nucleotide polymorphism of soybean kernel linolenic acid content character;
(5)Screening or assisting sifting have the soybean kernel of different linolenic acid contents;
(6)Prepare the product of the soybean kernel of screening or assisting sifting with different linolenic acid contents;
The place gene in the Map-6017 sites is the Glyma.02g138100 genes of the 2nd article of chromosome of soybean genome;Institute
The nucleotides sequence for stating Glyma.02g138100 genes is classified as the sequence 1 of sequence table;The Map-6017 sites are sequence in sequence table
The 3230th of row 1.
5. application as claimed in claim 4, it is characterised in that:Based on Map-6017 SNP sites in the soybean genome
Genotype is that TT is homozygous or CC is homozygous.
6. as claim 4 is applied, it is characterised in that:The linolenic acid content is high linolenic content or low linolenic;
The high linolenic content refers to that linolenic acid content is more than 8.5%;The low linolenic refers to that linolenic acid content is small
In 8.5%.
7. application as claimed in claim 4, it is characterised in that:It is described to be used to detect to be based on Map-6017 in soybean genome
The polymorphism of SNP site or the material of genotype include Map-6017SNP probe groups;
The Map-6017SNP probe groups are made of probe 1, probe 2 and probe 3;
The probe 1 is the single strand dna shown in sequence 2 in sequence table;
The probe 2 is the single strand dna shown in sequence 3 in sequence table;
The probe 3 is the single strand dna shown in sequence 4 in sequence table.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510438014.6A CN105002279B (en) | 2015-07-23 | 2015-07-23 | A kind of method and its application identified or aid in identification soybean kernel linolenic acid content |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510438014.6A CN105002279B (en) | 2015-07-23 | 2015-07-23 | A kind of method and its application identified or aid in identification soybean kernel linolenic acid content |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105002279A CN105002279A (en) | 2015-10-28 |
CN105002279B true CN105002279B (en) | 2018-04-13 |
Family
ID=54375140
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510438014.6A Active CN105002279B (en) | 2015-07-23 | 2015-07-23 | A kind of method and its application identified or aid in identification soybean kernel linolenic acid content |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105002279B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106048045B (en) * | 2016-07-13 | 2019-11-26 | 中国科学院遗传与发育生物学研究所 | Gene relevant to isoflavone like substance synthesis and photosynthesis and molecular labeling |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101613754A (en) * | 2009-08-07 | 2009-12-30 | 中国科学院遗传与发育生物学研究所 | The a pair of primer special and the method thereof of assisted evaluation of oil content locus of soybean kernel |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101680035B (en) * | 2007-03-28 | 2017-05-31 | 孟山都技术有限公司 | The effectiveness of the SNP marker related to main soybean plant maturity and habit genome area |
-
2015
- 2015-07-23 CN CN201510438014.6A patent/CN105002279B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101613754A (en) * | 2009-08-07 | 2009-12-30 | 中国科学院遗传与发育生物学研究所 | The a pair of primer special and the method thereof of assisted evaluation of oil content locus of soybean kernel |
Non-Patent Citations (4)
Title |
---|
Effect of a novel mutation in a 9-stearoyl-ACP-desaturase on soybean seed oil composition;Paul Ruddle ,et al;《Theor Appl Genet》;20131231;241-249页 * |
Mapping the Fas Locus Controlling Stearic Acid Content in Soybean;M. M. Spencer,et al;《Theoretical and Applied Genetics》;20021022;第106卷;615-619页 * |
Targeted association mapping demonstrating the complex molecular genetics of fatty acid formation in soybean;Ying-hui Li,et al;《BMC Genomics》;20151023;第16卷;1-13 * |
大豆脂肪酸组成性状全基因组关联分析;韩世凤;《中国优秀硕士学位论文全文数据库 农业科技辑》;20140815(第8期);D047-199页 * |
Also Published As
Publication number | Publication date |
---|---|
CN105002279A (en) | 2015-10-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Krishnappa et al. | Molecular mapping of the grain iron and zinc concentration, protein content and thousand kernel weight in wheat (Triticum aestivum L.) | |
Chattopadhyay et al. | Detection of stable QTLs for grain protein content in rice (Oryza sativa L.) employing high throughput phenotyping and genotyping platforms | |
Xu et al. | Breeding wheat for enhanced micronutrients | |
Kallamadi et al. | Molecular diversity in castor (Ricinus communis L.) | |
US11713490B2 (en) | Marker assisted selection of traits for producing meal from Brassica napus | |
Wang et al. | Enrichment of a common wheat genetic map and QTL mapping for fatty acid content in grain | |
Raman et al. | Analyses using SSR and DArT molecular markers reveal that Ethiopian accessions of white lupin (Lupinus albus L.) represent a unique genepool | |
CN101892307A (en) | SSCP marker closely linked with major wheat scab resistance QTL and application thereof | |
Dong et al. | Studying genetic diversity in the core germplasm of confectionary sunflower (Helianthus annuus L.) in China based on AFLP and morphological analysis | |
Teng et al. | Identification of quantitative trait loci underlying seed protein content of soybean including main, epistatic, and QTL× environment effects in different regions of Northeast China | |
CN107937591A (en) | The SNP marker of the Ⅺ relevant QTL site of end low-temperature resistance saccharification of tuberosum chromosomes and its application | |
CN105002279B (en) | A kind of method and its application identified or aid in identification soybean kernel linolenic acid content | |
Hossain et al. | Development of a selection tool for seed shape and QTL analysis of seed shape with other morphological traits for selective breeding in chickpea (Cicer arietinum L.) | |
CN105567818A (en) | Method for identification or auxiliary identification of fat content of soybean seeds and applications thereof | |
CN105002278B (en) | A kind of method and its application identified or aid in identification soybean kernel stearic acid content | |
CN101613754B (en) | A pair of special primers for assisted evaluation of oil content locus of soybean kernel and method thereof | |
CN102534026B (en) | Method for assisting identification of 100-seed weight related loci of soybeand special primer thereof | |
CN105132531B (en) | A kind of method and its application identified or aid in identification soybean kernel palmitic acid content | |
Wang et al. | Genetic relationships among Cucurbita pepo ornamental gourds based on EST-SSR markers. | |
CN103667484B (en) | Oil content character main gene locus of rape 6F313 and applications thereof | |
Alkimim et al. | Genetic diversity and molecular characterization of physic nut genotypes from the active germplasm bank of the Agricultural Research Company of Minas Gerais, Brazil | |
CN106811508A (en) | With the molecular labeling SVmc3 of hasked millet color gene close linkage | |
CN106811509A (en) | With the molecular labeling SVmc2 of hasked millet color gene close linkage | |
Chepkoech et al. | Assessment of genetic variability of passion fruit using simple sequence repeat (SSR) markers | |
Kumari et al. | Nutritional improvement in soybean (Glycine max (L.) Merrill) through plant breeding and biotechnological interventions |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |