CN105950729B - One kind SNP marker relevant to rubber tree stem girth and its application - Google Patents
One kind SNP marker relevant to rubber tree stem girth and its application Download PDFInfo
- Publication number
- CN105950729B CN105950729B CN201610335314.6A CN201610335314A CN105950729B CN 105950729 B CN105950729 B CN 105950729B CN 201610335314 A CN201610335314 A CN 201610335314A CN 105950729 B CN105950729 B CN 105950729B
- Authority
- CN
- China
- Prior art keywords
- rubber tree
- snp marker
- measured
- genotype
- stem girth
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of SNP marker relevant to rubber tree stem girth and its applications.Wherein, it is G or T which, which is base of the nucleotide sequence shown in SEQIDNO:1 from 5 ' ends at the site 132bp,.The stem girth of SNP marker and rubber tree of the invention is closely related, can be effective for the molecular mark of rubber tree.
Description
Technical field
The present invention relates to a kind of SNP marker and its applications, more particularly to a kind of SNP marker relevant to rubber tree stem girth
And its application.
Background technique
Rubber tree is a kind of tropical tree species played an important role in world economy and military developments, and what is produced is natural
Rubber tree is a kind of important raw material of industry and strategic materials.Currently, the limited area of Chinese suitable planting rubber tree, practical kind
It plants area and has reached the limit, increase the space of yield without expanding cultivated area, increase substantially rubber tree unit area
Yield is a suitable Chinese rubber career development and the feasible way for alleviating natural rubber imbalance between supply and demand pressure.
Rubber tree crossbreeding is always the conventional method of Rubber Tree Breeding, however the conventional breeding period is long and germplasm
The scarcity of resource, restriction rubber tree prevalent variety cultivation and industry development.With the development of Modern Molecular Biotechnology, molecular labeling
Assisted selection can solve the above problems to a certain extent, push Rubber Tree Breeding process.Molecular marker assisted selection is educated
Kind, i.e. molecular breeding are traditional genetic breeding and the breeding method that modern molecular biology organically combines, utilize DNA molecular mark
Note selects breeding material, the important economical trait of comprehensive improvement breeding species.In recent years, rubber tree molecular markers development
Certain progress has been achieved with using work, but far from meeting the needs of rubber tree molecular breeding.
Stem thickness (stem girth) growth of rubber tree is to measure referring mainly to for rubber tree growing way, wood volume amount and Rubber Yield
Mark, and the important evidence of glue productive technology management and economic management is planted, effective rubber tree stem thickness (stem girth) is excavated at this stage
The relevant molecular labeling of character, to realize that breeding accuracy is chosen seeds and improved to early stage, to obtain bigger breeding and genetic progress.
Summary of the invention
The invention reside in deficiency in the prior art is overcome, provide it is a kind of relevant to rubber tree stem girth, can be effective
In the SNP marker of rubber tree breeding and its application etc..
Wherein, SNP (singlenucleotidepolymorphism, SNP, i.e. single nucleotide polymorphism) is 1996 years
The molecule genetic marker proposed by the human genome research center scholar Lander of Massachusetts Institute Technology, mainly
Refer to DNA sequence polymorphism caused by a single nucleotide variation in genomic level.The polymorphism that SNP is shown only relates to
To the variation of single base, performance is that have conversion, transversion, insertion and missing etc..
The first aspect of the invention is to provide a kind of SNP marker relevant to rubber tree stem girth, which is characterized in that described
The sequence of SNP marker as shown in seqid no:1, base of the sequence shown in the SEQIDNO:1 from 5 ' ends at the site 132bp
It is G or T.According to the present invention, nucleotide sequence shown in SEQIDNO:1 is as follows:
GAAGCACTAAGACGGTCCATAGTGTACTTCAGAGGCCAACCGGTTG GCACAATTGCTGCAATTGACC
ATGCCTCAGAGGAGGTTTTGAACTATGAT CAGGTAATTCTTTAACTAAAATTTGATACTATAATXGTTTTTCTAG
CTTTCAG TATGATGAATGGGTGTGAGGCTTGGGAAATTTGCTATTGTAGTTTGTATTGT ATAGAAGGTATGCTG
TCAGATTGTAATCTGTCTCC (SEQIDNO:1).
Inventors have found that genotype is that the stem girth of the rubber tree of heterozygosis GT and homozygosis TT is significant at the site of the SNP marker
It is coarser than the rubber tree that genotype herein is homozygosis GG.In turn, according to the present invention, pass through the above-mentioned SNP, Neng Gouyou of detection rubber tree
Effect ground determines its stem girth character, specifically, as previously mentioned, the SNP loci gene type is the rubber tree of heterozygosis GT and homozygosis TT
Stem girth is significantly coarser than the rubber tree that genotype herein is homozygosis GG, such as the genotype of the SNP site is heterozygosis GT or homozygosis TT
When, then can determine rubber tree to be measured belongs to the thick individual of stem girth.Inventor determines as a result, SNP marker and rubber of the invention
The stem girth character of gum is closely related, can be effective for the molecular mark of rubber tree.And then it can be according to reality
Breeding demand carries out Seedling selection to Rubber Tree Breeding material, is further able to effectively improve the efficiency of breeding and accuracy, mention
The genetic level of high rubber tree reproductive population, so as to accurately and efficiently select rubber tree excellent variety.In addition, utilizing
SNP marker of the invention carries out rubber tree molecular mark, has early screening, saves the time, is low in cost, is accurate
The high advantage of property.
The second aspect of the invention is to provide a kind of for detecting drawing for SNP marker described in first aspect of the present invention
Object pair, the primer pair have nucleotide sequence shown in SEQIDNO:2 and SEQIDNO:3.Specifically, the sequence of the primer pair
Column are as follows:
Upstream primer: GAAGCACTA AGACGGTCCATAG (SEQIDNO:2)；
Downstream primer: GGAGACAGATTACAATCTGACAGC (SEQIDNO:3).
It according to the present invention, can be effectively to the above-mentioned and stem girth character phase of rubber tree to be measured using primer pair of the invention
Segment where the SNP marker of pass carries out PCR amplification, and then can effectively realize the detection to the SNP marker by sequencing, really
The genotype in the fixed rubber tree to be measured SNP marker site, and then can effectively determine the stem girth character of rubber tree to be measured.Specifically
Ground, at the SNP marker site genotype be heterozygosis GT or the stem girth of the rubber tree of homozygosis TT to be significantly coarser than genotype herein be pure
Close GG rubber tree, such as the site SNP genotype be heterozygosis GT or homozygosis TT when, then can determine rubber tree to be measured
Belong to the thick individual of stem girth.It, can be effective for rubber as a result, with the primer pair for detecting mentioned-above SNP marker of the invention
The molecular mark of gum, and then early stage can be assisted to realize short time, low cost, high accuracy ground breeding rubber tree
Excellent variety.
The third aspect of the invention is to provide a kind of for detecting the examination of SNP marker described in first aspect of the present invention
Agent box, it includes primer pairs described in the second aspect of the present invention.In kit i.e. of the invention comprising have SEQIDNO:2 and
The primer pair of nucleotide sequence shown in SEQIDNO:3.According to the present invention, primer included in kit of the invention is utilized
It is right, it can effectively realize the polymorphism of the SNP marker relevant to stem girth character described in the first aspect of rubber tree to be measured
Detection, determines the genotype of the rubber tree to be measured SNP marker site, and then can effectively determine the stem girth of rubber tree to be measured
Shape.Specifically, the stem girth for the rubber tree that genotype is heterozygosis GT and homozygosis TT at the SNP marker site is significantly coarser than base herein
Because of the rubber tree that type is homozygosis GG, for example, the SNP site genotype for heterozygosis GT or homozygosis TT when, then can determine rubber to be measured
Gum belongs to the thick individual of stem girth.The examination for being used to detect SNP marker described in first aspect of the present invention of the invention as a result,
Agent box, can effective for the molecular mark of rubber tree, and then can assist early stage realize the short time, low cost,
High accuracy ground breeding rubber tree excellent variety.
The fourth aspect of the invention is to provide SNP marker, the present invention second as described in first aspect of the present invention
Purposes of the kit described in primer pair described in aspect or third aspect of the present invention in rubber tree breeding.
As previously mentioned, by the reagent that can be used in detecting SNP marker relevant to rubber tree stem girth character of the invention,
Such as primer pair described in the second aspect of the present invention or the kit comprising the primer pair etc., can be effectively detected determine to
The genotype of the above-mentioned SNP marker of rubber tree is surveyed, and then can effectively determine the stem of rubber tree to be measured based on the genotype of acquisition
Character is enclosed, so as to effective auxiliary rubber tree breeding.
In turn, the fifth aspect of the invention is to provide a kind of method for detecting rubber tree stem girth character, by to be measured
Rubber tree carries out the detection of SNP marker described in first aspect of the present invention, determines the stem girth character of the rubber tree to be measured.
It specifically, can be by can be used in detecting the examination of SNP marker relevant to rubber tree stem girth character of the invention
Agent, such as primer pair described in the second aspect of the present invention or the kit comprising the primer pair etc. carry out rubber tree to be measured
PCR amplification, sequencing, to detect the genotype for the above-mentioned SNP marker for determining rubber tree to be measured, and then the genotype based on acquisition
It can effectively determine the stem girth character of rubber tree to be measured.Wherein, as previously mentioned, genotype is heterozygosis GT at the SNP marker site
And the stem girth of the rubber tree of homozygosis TT is significantly coarser than the rubber tree that genotype herein is homozygosis GG, such as the base when the SNP site
When because of type being heterozygosis GT or homozygosis TT, then rubber tree to be measured belongs to the thick individual of stem girth.Detection rubber of the invention as a result,
The method for setting stem girth character, can quickly, efficiently and accurately detect rubber tree stem girth character, and then can be effective for rubber
The molecular mark of tree, so as to assist early stage realize the short time, low cost, high accuracy breeding rubber tree it is excellent
Non-defective unit kind.
Wherein, the method for carrying out SNP marker detection to rubber tree to be measured is not particularly limited.Sequencing, single-strand conformation polymorphism
Property polymerase chain reaction PCR singlestrandconformationpolymorphism, PCR-SSCP), restriction fragment
Length polymorphism polymerase chain reaction (PCR-restriTCionfragmentlength polymorphism, PCR-
RFLP) and the detection of SNP may be implemented in the technologies such as flight time mass spectrum.Wherein, sequencing is a kind of accuracy highest, flexibility
By force, the detection technique that flux is big, detection cycle is short.Only pair of primers need to be designed in the two sides of SNP site, expand 200-
The product of 1000bp, then pass through the genotype for being sequenced and can directly detecting SNP site.Thus, the present invention is using the method being sequenced
Carry out SNP marker detection.According to the present invention, by carrying out the detection of mentioned-above SNP marker to rubber tree to be measured, institute is determined
The stem girth character for stating rubber tree to be measured further comprises: extracting the genomic DNA of rubber tree to be measured；Utilize the present invention second
The genomic DNA of the rubber tree to be measured is carried out PCR amplification, to obtain pcr amplification product by primer pair described in aspect；
The pcr amplification product is sequenced, to obtain sequencing result；Based on the sequencing result, the rubber to be measured is determined
The genotype of the SNP marker of tree；And the genotype of the SNP marker based on the rubber tree to be measured, determine described in
The stem girth character of rubber tree to be measured.Thereby, it is possible to effectively improve the efficiency of detection rubber tree stem girth character.
In the present invention, the method for extracting the genomic DNA of rubber tree to be measured is not particularly limited, and can be used any known
Genome DNA extracting method or kit carry out.Some specific examples according to the present invention extract rubber to be measured using CTAB method
The genomic DNA of gum.Thereby, it is possible to effectively obtain genomic DNA high-quality, with high purity, carried out convenient for subsequent step.
In the present invention, the condition that the genomic DNA of the rubber tree to be measured carries out PCR amplification is not particularly limited.Root
According to some specific examples of the invention, the amplification system of the PCR amplification is calculated as with 25 μ l: 1 μ of 100-200ng/ μ l template DNA
Forward primer shown in l, 10 μM of SEQIDNO:2 and SEQIDNO:3 and each 1 μ l, 10 × PCR reaction buffer of reverse primer
The 0.2 μ l of TapDNA polymerase of 2.5 μ l, 2.5mM dNTP, 2.0 μ l, 5U/ μ l, water surplus.The PCR reaction condition are as follows: 95 DEG C
After initial denaturation 5min, 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min are recycled for 30 totally, 72 DEG C of extension 5min.Thereby, it is possible to quickly,
The segment where SNP marker of the invention is efficiently and accurately expanded, target amplification product is obtained, convenient for the progress of subsequent step.
In the present invention, the method that the pcr amplification product is sequenced is not particularly limited, as long as can effectively obtain
The sequence of segment where pcr amplification product, that is, SNP marker.Some specific examples according to the present invention, can be using choosing
The pcr amplification product is sequenced from at least one of the sequencing approaches such as HISEQ2000, SOLiD, 454 and unimolecule.By
This, can it is high-throughput, quickly, efficiently and accurately obtain sequencing result.
The present invention is based on sequencing results, refer to genome sequence by comparing rubber tree, can effectively determine rubber to be measured
The genotype of the SNP marker of tree is GT, TT or GG.
In the present invention, the GT genotype of the SNP marker and the stem girth of TT genotype individuals are significantly coarser than GG genotype
Body.Mentioned-above SNP marker i.e. of the invention and the stem girth character of rubber tree are closely related.As a result, based on determining rubber to be measured
The genotype of the SNP marker of gum can accurately and effectively determine the stem girth character of rubber tree to be measured, such as the SNP site
Genotype when being GT or TT, then rubber tree to be measured belongs to the thick individual of stem girth.And then method of the invention can be effective
In the molecular mark of rubber tree, so as to assist early stage to realize short time, low cost, high accuracy ground breeding rubber
Gum excellent variety.
Beneficial effects of the present invention:
(1) SNP marker provided by the invention is not limited by age of rubber tree etc., can be used for the early stage breeding of rubber tree,
It can significantly promote the breeding process of rubber tree；
(2) method of detection rubber tree SNP site of 132bp from 5 ' ends as shown in SEQIDNO.1, accurately and reliably,
It is easy to operate；
(3) detection of rubber tree SNP site of 132bp from 5 ' ends as shown in SEQIDNO.1, is rubber tree stem girth
The marker assisted selection of shape provides scientific basis.
Specific embodiment
Below with reference to specific embodiment, the present invention is further illustrated, to better understand the invention.
Embodiment 1: the acquisition of SNP marker relevant to rubber tree stem girth
1.1 rubber tree germplasm materials obtain
Used group is rubber tree 1981'IRRDB germplasm, is planted in Rubber Institute, Chinese Academy of Agricultural Science
National rubber tree Germplasm Resources, genetic background are mainly derived from Brazilian Amazon river region Acree state (Acre), horse
Hold in the palm Grosso state (Mato Grosso) and the state Lang DuoniyaThree states.Acquire 34 parts of germplasm childrens in June, 2014
It is spare that leaflet tablet liquid nitrogen cryopreservation takes back laboratory.
1.2 rubber tree germplasm materials DNA are extracted
The rubber tree blade for taking freezen protective extracts genomic DNA using CTAB method: (1) weighing 1g rubber tree tender leaf,
It is ground into fine powder after liquid nitrogen flash freezer, is transferred in 50ml centrifuge tube.(2) 2 × CTAB that 65 DEG C of 10ml preheatings are added, which is extracted, to be delayed
(2% beta -mercaptoethanol has been added) in fliud flushing in advance, and gently rotating centrifuge tube disperses plant tissue in extraction buffer
It is even, 65 DEG C of incubation 1h, and centrifuge tube is gently rotated frequently.(3) mixture is cooled to room temperature isometric Tris- Fen ︰ Lv Fang ︰ is added
Isoamyl alcohol (25 ︰, 24 ︰ 1), then overturning centrifuge tube makes its mixing, it is to note that not vibrate, prevent from interrupting DNA.(4) room temperature,
12000 rpm centrifugation 10min makes its split-phase.(5) water phase is drawn into another centrifuge tube, adds the chloroform that people is isometric: isoamyl alcohol
(24 ︰ 1), is mixed by inversion.Room temperature, 12000rpm are centrifuged 10min.(6) water phase is drawn into another centrifuge tube, is added isometric
Isopropanol is mixed by inversion, and is placed at room temperature for 20min.(7) room temperature, 14000rpm are centrifuged 20min.Supernatant is abandoned, precipitating is pre- with 1ml ice
75% cold ethyl alcohol rinses 2 times.(every time when rinsing, room temperature, 14000rpm is centrifuged 10min).(8) supernatant, superclean bench are abandoned
On dry DNA precipitating.It is then dissolved in 200 μ l TE (pH 8.0) buffers or ddH2O.Add 1 μ l Rnase A (10mg/ of people
M1), 37 DEG C of water-bath 30min, -20 DEG C save backup.
1.3 obtain the relevant SNP marker of rubber tree stem girth using the sequencing of Sanger method
Based on Sanger method microarray dataset, the sequencing of yield related gene is carried out to 9 samples in above-mentioned group, analyzes its core
Nucleotide polymorphism site is related to known economical character using Tassel 3.0_standalone software analysis SNP site
Property, find a SNP site relevant to rubber tree stem girth.The site is located at the site 132bp of sequence shown in SEQ ID NO:1
Place, in SEQ ID NO:1 sequence with X indicate this at site, and the base in site is G or T herein.Genotype is at the site
The stem girth of the rubber tree of heterozygosis GT or homozygosis TT is significantly coarser than the rubber tree that genotype herein is homozygosis GG.
Embodiment 2: the sequence verification and application of SNP marker relevant to rubber tree stem girth
2.1 nucleotide fragments of the amplification containing SNP site
Using the aforementioned genomic DNA for extracting each rubber tree to be measured obtained as template, forward primer F:5'-GAA is utilized
GCA CTA AGA CGG TCC ATA G-3'(SEQ ID NO:2) and reverse primer R:5'-GGA GAC AGA TTA CAA
TCT GAC AGC-3'(SEQ ID NO:3), amplify the nucleotide fragments where SNP to be measured.Wherein, PCR reaction system is
25 μ l:100-200ng/ μ l template DNA, 1 μ l, 10 μM of primers Fs and R each 1 μ l, 10 × PCR reaction buffer 2.5 μ l, 2.5mM
The 0.2 μ l of Tap archaeal dna polymerase of 2.0 μ l, 5U/ μ l of dNTP, water surplus；PCR reaction condition are as follows: after 95 DEG C of initial denaturation 5min,
94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min are recycled for 30 totally, 72 DEG C of extension 5min.
2.2 sequencing identification SNP site genotype
The PCR product obtained in above-mentioned steps is detected through agarose electrophoresis, recycles and is inserted into pMD 18-T carrier
In, each sample selects 6 monoclonals that (raw work bioengineering Shanghai Co., Ltd) is sequenced, and identifies SEQ ID NO:1 sequence
In column at 132bp (SNP marker i.e. of the invention) genotype.The genotype of the individual SNP site of 34 rubber trees to be measured and
Its stem girth is as shown in table 1 below.
The genotype and its stem girth of the individual SNP site of 1 34, table rubber trees to be measured
| Germplasm number | Genotype | Diameter encloses (cm) | Germplasm number | Genotype | Diameter encloses (cm) |
| XJA00276 | GG | 82.2 | XJA04002 | GT | 91.9 |
| XJA00323 | GG | 67.4 | XJA04071 | GG | 69.8 |
| XJA00445 | GG | 75.2 | XJA04075 | GG | 71.2 |
| XJA01197 | GG | 46.5 | XJA04152 | GG | 60.4 |
| XJA01198 | GG | 64.8 | XJA04210 | GG | 67.1 |
| XJA01663 | GG | 65.1 | XJA04285 | GT | 92.7 |
| XJA01840 | TT | 80.7 | XJA04314 | GG | 65.8 |
| XJA02702 | GG | 60.1 | XJA04397 | GT | 89.3 |
| XJA02967 | GG | 60.3 | XJA04634 | TT | 91.6 |
| XJA02968 | GG | 65.1 | XJA04971 | GG | 59.4 |
| XJA02972 | GT | 77.8 | XJA04975 | GG | 65.4 |
| XJA02974 | GT | 88.2 | XJA05006 | GG | 73.4 |
| XJA03000 | GG | 82.5 | XJA05190 | GG | 68 |
| XJA03019 | GG | 81.7 | XJA05255 | GG | 71.6 |
| XJA03642 | GG | 80.6 | XJA05381 | GG | 68.2 |
| XJA03765 | GG | 81.4 | XJA05728 | GG | 74.6 |
| XJA03788 | GG | 77.9 | XJA05787 | GT | 79.3 |
The association analysis of 2.3 SNP site genotype and stem girth
It is based on table 1 as a result, using Tassel 3.0_standalone software general linear model analyze SNP site
Genotype and stem girth relevance, the correlation of the genotype for finding the SNP site and stem girth reached extremely significant level (R2
=0.28209743, p=0.00606920).Difference between SNP loci gene type frequency and stem girth is analyzed using DPS software
Relationship such as table 2, wherein GT heterozygous and the homozygous individual stem girth mean value of TT are higher, and the homozygous individual stem girth mean value of GG is lower, and
The difference of GT heterozygous and the homozygous individual stem girth mean value of TT and GG genotype individuals stem girth mean value up to it is extremely significant it is horizontal (P <
0.01), i.e., the individual containing allele T (GT heterozygous and the homozygous individual of TT) stem girth is coarser than GG genotype individuals.Into
And, it was demonstrated that nucleotide sequence shown in SEQ ID NO:1 the 132nd bit base G or T and the significant phase of rubber tree stem girth character from 5 ' ends
It closes, is the relevant SNP marker of rubber tree stem girth character, the stem girth of the homozygous individual of the GT heterozygous and TT of the SNP marker is significant
It is coarser than GG genotype individuals, i.e., individual (GT heterozygous and the homozygous individual of TT) stem girth containing allele T is coarser than GG base
Because of type individual.
Difference relationship between the SNP site genotype frequency of the present invention of table 2 and stem girth
Specific embodiments of the present invention are described in detail above, but it is merely an example, the present invention is simultaneously unlimited
It is formed on particular embodiments described above.To those skilled in the art, any couple of present invention carries out equivalent modifications and
Substitution is also all among scope of the invention.Therefore, without departing from the spirit and scope of the invention made by equal transformation and
Modification, all should be contained within the scope of the invention.
Claims (8)
1. a kind of SNP marker relevant to rubber tree stem girth, which is characterized in that the sequence of the SNP marker such as SEQIDNO:1 institute
Show, base of the sequence shown in the SEQIDNO:1 from 5 ' ends at the site 132bp is G or T.
2. SNP marker according to claim 1, which is characterized in that the heterozygosis GT genotype and homozygosis TT of the SNP marker
The stem girth of genotype rubber tree is significantly coarser than homozygous GG genotype rubber tree.
3. a kind of primer pair for SNP marker described in detecting as claimed in claim 1 or 22, which is characterized in that the core of the primer pair
Nucleotide sequence is as shown in SEQIDNO:2 and SEQIDNO:3.
4. a kind of kit for SNP marker described in detecting as claimed in claim 1 or 22, which is characterized in that it includes claims
Primer pair described in 3.
5. SNP marker as claimed in claim 1 or 2, primer pair as claimed in claim 3 or reagent as claimed in claim 4
Purposes of the box in rubber tree breeding.
6. it is a kind of detect rubber tree stem girth character method, which is characterized in that by rubber tree to be measured carry out claim 1 or
The detection of SNP marker described in 2 determines the stem girth character of the rubber tree to be measured.
7. according to the method described in claim 6, it is characterized in that, as claimed in claim 1 or 2 by being carried out to rubber tree to be measured
SNP marker detection, determine the stem girth character of the rubber tree to be measured, further comprise:
Extract the genomic DNA of rubber tree to be measured；
Using primer pair as claimed in claim 3, the genomic DNA of the rubber tree to be measured is subjected to PCR amplification, to obtain
Pcr amplification product；
The pcr amplification product is sequenced, to obtain sequencing result；
Based on the sequencing result, the genotype of the SNP marker of the rubber tree to be measured is determined；And
The genotype of the SNP marker based on the rubber tree to be measured determines the stem girth character of the rubber tree to be measured.
8. the method according to the description of claim 7 is characterized in that the heterozygosis GT genotype and homozygosis TT base of the SNP marker
Because the stem girth of type rubber tree is significantly coarser than homozygous GG genotype rubber tree.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610335314.6A CN105950729B (en) | 2016-05-19 | 2016-05-19 | One kind SNP marker relevant to rubber tree stem girth and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610335314.6A CN105950729B (en) | 2016-05-19 | 2016-05-19 | One kind SNP marker relevant to rubber tree stem girth and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105950729A CN105950729A (en) | 2016-09-21 |
| CN105950729B true CN105950729B (en) | 2019-04-16 |
Family
ID=56913224
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610335314.6A Active CN105950729B (en) | 2016-05-19 | 2016-05-19 | One kind SNP marker relevant to rubber tree stem girth and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105950729B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113846177B (en) * | 2021-07-30 | 2023-04-25 | 中国热带农业科学院橡胶研究所 | SNP molecular marker for number of secondary emulsion tubes of rubber tree and application of SNP molecular marker |
| CN117467794A (en) * | 2022-05-31 | 2024-01-30 | 中国热带农业科学院橡胶研究所 | SNP molecular marker for distinguishing rubber tree varieties and variety identification method |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101812433B (en) * | 2009-11-10 | 2011-12-07 | 中国热带农业科学院橡胶研究所 | Use of hevea brasiliensis invertase and coding gene thereof |
| CN101812434B (en) * | 2009-11-10 | 2011-12-07 | 中国热带农业科学院橡胶研究所 | Invertase and application of encoding gene thereof |
-
2016
- 2016-05-19 CN CN201610335314.6A patent/CN105950729B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105950729A (en) | 2016-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106868132B (en) | SNP molecular marker related to contents of palmitic acid, oleic acid and linolenic acid in oil-tea camellia seed oil and application thereof | |
| KR102029016B1 (en) | SSR primer set for discriminating Agaricus bisporus strain and uses thereof | |
| CN105368935B (en) | SSR primer sets and method for the Purity Identification of capsicum variety Huifeng 2 | |
| CN109852710A (en) | One kind SNP marker relevant to grouper ammonia tolerance and application thereof | |
| CN107217094A (en) | One SNP marker related to the gift tilapia speed of growth and its application | |
| CN105219880A (en) | OncidiumLuridum belongs to EST-SSR labeled primer and application thereof | |
| CN104419706A (en) | SNP (single nucleotide polymorphism) marker and application thereof | |
| CN105838809B (en) | One kind SNP marker relevant to rubber tree latex dust quantity and its application | |
| CN105861498B (en) | One kind SNP marker relevant to rubber tree dry incineration method and its application | |
| CN108411007B (en) | SNP marker and its application | |
| CN105950729B (en) | One kind SNP marker relevant to rubber tree stem girth and its application | |
| CN107022608A (en) | SNP marker and its application | |
| CN104762403B (en) | The GmDGK7 gene molecule markers significantly associated with soybean grease content and its application | |
| CN106048028A (en) | Grouper-growth-rate-related SNP (single-nucleotide polymorphism) marker and application thereof | |
| CN109536632A (en) | Rhododendron dauricum SSR primer pair and screening technique and application based on transcript profile sequencing exploitation | |
| KR102163233B1 (en) | SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof | |
| CN107354222B (en) | STR primer, PCR kit and method for identifying clone of eucalyptus | |
| CN106755526B (en) | Functional molecular marker related to lipped and petal sepal character of cymbidium and identification method thereof | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN108531636A (en) | A kind of molecular marked compound TJcM01 and its application for identifying muskmelon unisexual flower | |
| CN108239675A (en) | A kind of molecular marked compound TJcM02 and its application for being used to identify muskmelon unisexual flower | |
| Yuhanna et al. | Genetic variability of Phaius and Dendrobium orchids based on molecular markers | |
| CN108085404A (en) | Giant pumpkin female trait molecular marker and the primer pair of identification giant pumpkin female character by force by force | |
| CN102094001A (en) | Method for cloning rice complex trait associated gene | |
| KR102066593B1 (en) | Orange Beauty, new cultivar of Lilium lancifolium and molecular marker for discriminating the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |