CN105936906B - Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof - Google Patents
Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof Download PDFInfo
- Publication number
- CN105936906B CN105936906B CN201610343119.8A CN201610343119A CN105936906B CN 105936906 B CN105936906 B CN 105936906B CN 201610343119 A CN201610343119 A CN 201610343119A CN 105936906 B CN105936906 B CN 105936906B
- Authority
- CN
- China
- Prior art keywords
- cpg
- oligodeoxynucleotide
- modified
- units containing
- sequence units
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/17—Immunomodulatory nucleic acids
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to oligodeoxynucleotide molecules of the sequence units containing CpG being modified in a kind of immunotherapy techniques field and application thereof;Application the present invention relates to the oligodeoxynucleotide for the sequence units containing CpG being modified as immunopotentiator;Also relate to oral or sucking preparation application of the oligodeoxynucleotide as treatment tumour for the sequence units containing CpG being modified.The present invention relates to a kind of CpG oligodeoxynucleotide (CpG ODN) through structural modification is had the CpG ODN of immunoloregulation function by the modification of the peptide fragment of specific combination, the fatty acid of certain chain lengths or lipid structure and is obtained.The CPG ODN of this structural modification has better oral administration biaavailability and immunoloregulation function, it can be used as oral immunity enhancing and immunotherapy medicaments, organism is improved to the immune response of antigen, is applied to anaphylactia, communicable disease, immunodefiiciency disease and cancer etc..
Description
The application is the divisional application of original application, the applying date of original application are as follows: 2013.11.08;Application No. is:
201310554389.X;Invention and created name are as follows: the oligodeoxynucleotide molecule and its use for the sequence units containing CpG being modified
On the way.
Technical field
The invention belongs to immunotherapy techniques fields, and in particular to a kind of oligomerization for the sequence units containing CpG being modified is de-
Oxygen nucleic acid molecule and application thereof.
Background technique
Early in the nineties in 19th century, bacterium crude extract is applied to 900 long-term swollen by U.S. oncologist Coley discovery
Tumor patient has 40% patient tumors that can voluntarily subside, at that time it is believed that being that lipopolysaccharides in bacterium crude extract plays activity
Effect, does not cause enough attention.Later, the Mice Body carried out with BCG vaccine (Bacillus Calmette-Guerin, BCG)
Interior experiment discovery, does not have antitumor action with the processed BCG of DNA enzymatic, illustrates that DNA of bacteria is only and mediates this antitumor effect
Substance [Tokunaga, T., et al., Antitumor activity of the deoxyribonucleic acid answered
fraction from Mycobacteriumbovis BCG.I.Isolation,physicochemical
characterization,and antitumor activity.J Natl Cancer Inst,1984.72(4):955-
62].Then, researcher confirms that DNA of bacteria has direct immunostimulation and antitumor action [Yamamoto, S., et
al.,DNA from bacteria,but not from vertebrates,induces interferons,activates
natural killer cells and inhibits tumor growth.MicrobiolImmunol,1992.36(9):
983-97].Pisetsky seminar, which reports the DNA of bacteria (bDNA) of purifying and poly- (dG, dC), to induce B cell to increase
Grow and secretory antibody, and the DNA of mammal cannot [Messina, J.P., G.S.Gilkeson, and D.S.Pisetsky,
Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA.J
Immunol,1991.147(6):1759-64].Then, researcher has found that the methylation of cytimidine in poly- (dG, dC) can be led
Mitogen activity is caused to lose [Messina, J.P., G.S.Gilkeson, and D.S.Pisetsky, The influence of
DNA structure on the in vitro stimulation of murine lymphocytes by natural
and synthetic polynucleotide antigens.Cell Immunol,1993.147(1):148-57].But work as
When researcher the methylation of CpG is connected from the different immunocompetences of bacterium and mammalian DNA, they
It is the higher structure that conjecture methylation destroys bDNA.
It is ground by the experiment carried out with the oligodeoxynucleotide (oligodeoxynucleotides, ODN) of synthesis
Study carefully, discovery DNA of bacteria is due to wherein containing the non-methylated CpG core with specific flanking sequence with immunostimulation
Thuja acid motif [Yamamoto, T., et al., Lipofection of synthetic oligodeoxyribonucleotide
having a palindromic sequence of AACGTT to murine splenocytes enhances
interferon production and natural killer activity.MicrobiolImmunol,1994.38
(10):831-6].Different from DNA of bacteria, the frequency that CpG motif occurs in mammal and other vertebrate DNA moleculars is very
It is low, and the 5th carbon atom of cytimidine methylates in 60%~90% CpG motif, therefore, mammal itself
DNA molecular does not have immunostimulation [Barton, G.M., J.C.Kagan, and R.Medzhitov, Intracellular
localization of Toll-like receptor 9prevents recognition of self DNA but
facilitates access to viral DNA.Nature Immunology,2006.7(1):49-56]。Arthur
M.Krieg et al. tentatively obtains immunostimulating CpG by the immunostimulatory activity of the different sequence C pG ODN of analysis synthesis
The basic law of ODN structure: sequence must contain the CpG motif of non-methylation;The basic structure of CpG motif is 5'-X 1X
2CGY 1Y 2-3', wherein X 1 represents a purine, and X 2 represents a purine or a thymidine, and Y 1 and Y 2 are represented
Pyrimidine.There can be one or more CpG motif in a CpG ODN, CpG motif two sides special purine and pyrimidine, with
And it is separated by the different immunostimulation types and intensity [Krieg, A.M., et that can all influence CpG motif of base between CpG motif
al.,CpG motifs in bacterial DNA trigger direct B-cell activation.Nature,
1995.374(6522):546-9;Krieg,A.M.,CpG motifs in bacterial DNA and their immune
effects.Annual Review of Immunology,2002.20:709-760;Krieg,A.M.,G.Hartmann,and
A.K.Yi,Mechanism of action of CpG DNA.Immunobiology of Bacterial Cpg-DNA,
2000.247:1-21]。
Human immune system sorts out to generate different cytological effects infection it can be found that pathogenic infection,
Crucial structure is special, high-affinity the antigen receptor having in immunocyte (such as T cell, B cell), referred to as mode
Identification receptor (pattern-recognition receptor, PRR).PRR can be combined with the antigen above pathogen, these
Antigen is collectively referred to as pathogen associative mode molecule (pathogen-associated molecular pattern, PAMP).Contain
The oligodeoxynucleotide for having non-methylated CpG dinucleotides is exactly one of PAMP.So far, people have found four types altogether
The CpG ODN:D type (or A type) of type, K-type (or Type B), c-type and p-type, each type have unique structure and biological function special
Point.They are distributed on the identification of the TLR9 on endocytoplasmic reticulum, and express TLR9, are mainly monocyte in Mice Body, huge
Phagocyte, mDC cell, pDC cell and B cell, the interior mainly latter two of human body [Klinman, D.M., Currie, D.,
Gursel,I.&Verthelyi,D.Use of CpGoligodeoxynucleotides as immune
adjuvants.Immunological Reviews 199,201-216(2004)]。
Therefore CpG oligodeoxynucleotide can directly stimulate these cells, and indirect activation T cell, natural killer cells,
Induce immune response based on Th1 type, and newest research shows that it can directly inhibit mMDSC cell
[Y.Shirota, H.Shirota, D.M.Klinman, Journal of immunology 2012,188,1592-1599], quilt
It is known as the immunologic adjuvant or immunotherapy medicaments of a kind of novel high-efficiency low-toxicity, in treatment infectious diseases, anaphylaxis disease
There are powerful potential using value, the just pass by more and more scientists in disease, immunodefiiciency disease and cancer
Note.
At present to the complete thio or part thio-modification of the skeleton of CpG oligodeoxynucleotide, CpG widow can be partially solved
The problem of poly- deoxynucleotide is by nuclease hydrolysis, but the not high problem of bioavilability is still remained, therefore the present invention is to CpG
Oligodeoxynucleotide carries out small numerator modified to solve the problems, such as this, the bioavilability being especially administered orally.
Summary of the invention
It is an object of the invention to overcome the deficiencies of the prior art and provide a kind of widows of sequence units containing CpG being modified
Poly- deoxyribonucleic acid molecule and application thereof.The CPG ODN of structural modification of the invention have better oral administration biaavailability with
And immunoloregulation function.
In a first aspect, the present invention relates to a kind of oligodeoxynucleotide of sequence units containing CpG being modified, the modification
One of molecular selection following formula:
Preferably, the oligodeoxynucleotide contains 1-5 CpG unit, a length of 10-30nt of chain.
Preferably, the site of decorating molecule modification be 5 '-ends of oligodeoxynucleotide, 3 '-ends or in
Between position.
Preferably, the oligodeoxynucleotide contains one of following sequence:
Group | Sequence (5 ' -3 ') |
CpG1826 | tccatgacgttcctgacgtt |
CpG-H1826 | tccatgtcgttcctgtcgtt |
CpG-7 | tgacgttccgtt |
CpG-H7 | Tgtcgttccgtt |
CpG-8 | atgacgttgcgtt |
CpG-H8 | atgtcgttgcgtt |
CpG-13 | tccatgacgttcctgacgttcctgacgtt |
CpG-H13 | tccatgtcgttcctgtcgttcctgtcgtt |
CpG7909(2606) | tcgtcgttttgtcgttttgtcgtt |
In clinical application, CpG1826, CpG-7, CpG-8, CpG-13 of mouse sensitivity, can turn according to known theory
Change sequence C pG-H1826, CpG-H7, CpG-H8, CpG-H13 of people's sensitivity into.
Preferably, the skeleton of the oligodeoxynucleotide is full thio-modification, part thio-modification or repairs without thio
Decorations.
Second aspect, the present invention relates to the oligodeoxynucleotide for the sequence units containing CpG that one kind is modified as the aforementioned
Application as immunopotentiator.
The third aspect, the invention further relates to the oligodeoxynucleosides for the sequence units containing CpG that one kind is modified as the aforementioned
Oral or sucking preparation application of the acid as treatment tumour.
The present invention has following the utility model has the advantages that the present invention relates to a kind of CpG oligodeoxynucleotide through structural modification
(CpG ODN) has immunoloregulation function by the modification of the peptide fragment of specific combination, the fatty acid of certain chain lengths or lipid structure
CpG ODN and obtain.The CPG ODN of this structural modification has better oral administration biaavailability and immunoloregulation function, can
As oral immunity enhancing and immunotherapy medicaments, to improve organism to the immune response of antigen, be applied to anaphylactia,
Communicable disease, immunodefiiciency disease and cancer etc..
Detailed description of the invention
Upon reading the detailed description of non-limiting embodiments with reference to the following drawings, other feature of the invention,
Objects and advantages will become more apparent upon:
Fig. 1 is that the click of differential responses condition reacts PAGE figure;
Fig. 2 is the conjugate PAGE figure that the click of differential responses condition reacts PAGE figure and purified;
Fig. 3 is the CuAAC response diagram of nitrine lauric acid and alkynyl-modified CpG ODN;
Fig. 4 is the ion vitro immunization effect of stimulation figure of different chain length CpG;
Fig. 5 is four kinds of dipeptide structure figures;
Fig. 6 is the 14th day mice serum antibody concentration and IgG2a/ after the CpG initial immunity that CpG and four dipeptides is modified
IgG1 ratio figure;
Fig. 7 is the 21st day mice serum antibody concentration and IgG2a/ after the CpG initial immunity that CpG and four dipeptides is modified
IgG1 ratio figure;
Fig. 8 is the mice serum antibody concentration and IgG2a/IgG1 ratio at CpG not time point of CpG and four dipeptides modification
Figure;
Fig. 9 is the 21st day mice serum antibody concentration figure after various dose CpG, CpG-LP initial immunity;
Figure 10 is the 21st day mice serum antibody concentration figure after CpG, CpG-SA, CpG-LA initial immunity;
Figure 11 is the 28th day mice serum antibody concentration figure after CpG, CpG-SA, CpG-LA initial immunity.
Specific embodiment
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.The test method of actual conditions is not specified in the following example, usually according to conventional strip
The molecular clonings such as part, such as Pehanorm Brooker: condition described in the laboratory manual third edition (Science Press, 2002), or
According to condition proposed by each manufacturer.
The influence that embodiment 1, nitrine and alkynyl concentration, catalyst, reaction time react CuAAC
A dipeptides AF is selected to carry out the optimization of reaction condition, the method for optimization can be generalized to other small molecules with
The click of CpG ODN reacts.The premise that all reaction conditions change all is that reaction carries out under room temperature concussion.
1 various concentration nitrine of table, alkynyl, different proportion catalyst and differential responses time experimental design
Fig. 1 is that the click of differential responses condition reacts PAGE figure, and in (a) and (b), M represents 20bp DNA marker,
Lane 1 is unmodified CpG ODN;PAGE electrophoresis is carried out according to the design of table 1;Reaction condition in Fig. 1 (a) is reference
Condition [Rostovtsev, V.V., et al., A the stepwise huisgen of classical small molecule click reaction
cycloaddition process:copper(I)-catalyzed regioselective"ligation"of azides
And terminal alkynes.Angew Chem Int Ed Engl, 2002.41 (14): 2596-9], CpG ODN 5nmol
(34 μ l), AF 50nmol (8.5 μ l), 4 0.005nmol of CuSO (1 μ l), sodium ascorbate0.5nmol (1 μ l), three
The 300 3 groups of reactions of μ l, lane of aminophenylsulfonic acid buffer joined TBTA 0.5nmol (6.75 μ l), and 2 groups of lane are not added
TBTA, two groups of reactions are all reacted 24 hours.The concentration of CpG ODN is 0.014mM in reaction system.From the point of view of PAGE result,
Lane 2, lane 3, which compares position with lane 1, does not have notable difference, illustrates that click reaction does not carry out, not conjugate
It generates.Illustrate that the condition for being suitable for small molecule click reaction is unworkable for macromolecular.
Improve alkynyl and nitrine concentration in the reaction system, while by the dosage of CuSO4 from the 1/100 of original CpG ODN
20 times of CpG ODN are increased to, TBTA and sodium ascorbate is increased to CpG from the 1/10 of original CpG ODN dosage
40 times of ODN, and the volume of buffer is reduced, the concentration of CpG ODN is 0.1mM in such reaction system.Applicant investigates
The influence that TBTA and reaction time react click, has obtained Fig. 1 (b).In Fig. 1 (b), lane's 2, lane 4, lane 6
That TBTA is not added in reaction system, and TBTA is added in the reaction system of lane 3, lane 5, lane 7;Lane 2 with
3 reaction time of lane is 6 hours, and lane 4 and 5 reaction time of lane are 12 hours, and 7 reaction time of lane 6 and lane is
24 hours.
Six groups of reactions in Fig. 1 (b) are substantially all there are two band, and the unmodified CpG of position and lane 1
ODN has notable difference, compares with Fig. 1 (a), it has been found that after the concentration of CpG ODN and AF in the reaction system improves,
And after the ratio of catalyst and CpG ODN improve, click reaction occurs, and coupled product occurs, and coupled product is in PAGE
Band is higher than the band of unmodified CpG ODN.This result illustrates the CpG ODN and polypeptide of high concentration, a high proportion of to urge
Agent, solvent volume as few as possible are extremely advantageous to the carry out of click reaction.
The band of 3 lane in Fig. 1 (b), lane 5, lane 7 and lane 2, lane 4, lane 6 are clear compared to obvious,
This shows that TBTA is indispensable to the click reaction of CpG ODN.And lane 2, lane3 and lane 4, lane 5
With lane 6,7 two groups of lane are compared, and band is more clear, and do not show higher conversion ratio within 12 hours and 24 hours,
So applicant is selected 6 hours according to choice experiment arrangement or 12h reacts overnight.
PAGE process:
(1) glue raw material and dosage: the urea of 4.2g, 1mlTBE buffer, 4.44ml acrylamide, 40ulAP,
4ulTBMB.Pay attention to there is not urea precipitation when glue.
(2) glue prepared is rapidly joined in the glass plate being ready for, to or so 1 hour, after waiting gellings good
Tbe buffer liquid is added, after adding buffer, it is ensured that buffer will not be spilt, later loading.It can be prepared during equal gellings are solid
Sample.
Electrophoresis apparatus is opened after having gone up sample, starts to run glue, after about 34 hours, i.e., sample has arrived colloid edge
When, stop electrophoresis.Glue is removed, surface plate is put into, coloring agent supergreen is added and starts to dye, about dye half an hour
When left and right, glue is taken out, is developed.
The influence that embodiment 2, the ratio of nitrine small molecule and CpG ODN and reaction buffer react CuAAC
Optimum reacting time has been determined, has specified the effect of TBTA, has optimized the concentration and catalyst of CpG ODN and AF
After ratio, the influence that AF reacts click with the different proportion of CpG ODN and reaction buffer is investigated, and determine coupled product
Purification process.
The different buffers of table 2, the experimental design of AF and CpG ODN different proportion
Fig. 2 is that the conjugate PAGE that the click of differential responses condition reacts PAGE figure and purified schemes in (a) and (b), M
Representing 20bp DNA marker, lane 1 is unmodified CpG ODN;(a) electrophoresis is carried out according to the design of table 2;(b) pure
The PAGE of change method is verified, and lane 3 is the CpG-AF purified;
In Fig. 2 (a), the triethylamine acetate buffer of 2M pH 7.0 joined in the reaction system of lane 2, lane 3,
There is no buffer in the reaction system of lane 4, lane 5;Dipeptides is with CpG ODN's in the reaction system of lane 3, lane 5
Ratio is 50:1, and the ratio of AF and CpG ODN is 10:1 in the reaction system of lane 2, lane 4, other reaction conditions are equal
It is screened with front consistent.Four groups of experiments are comprehensively compared, and applicant finds out the reaction efficiency highest of lane 3, this says
Bright buffer and high AF and CpG ODN ratio react advantageous to click.So applicant selects 50:1 as AF and CpG
The reaction ratio of ODN, while being determined that CpG ODN is reacted with the click of AF and having needed triethylamine acetate buffer.
Click product is purified with acetone precipitation.Method particularly includes: 5 times of reaction volumes are added into reaction system
Acetone, sufficient vortex are mixed, are put in -20 DEG C of refrigerators 30 minutes.It 4 DEG C, 10000rpm, is centrifuged 20 minutes, discards supernatant, then plus
Enter 1ml acetone, blow and beat repeatedly, clean the solid of precipitation, then 4 DEG C, 10000rpm is centrifuged 20 minutes, then discards supernatant, dry
Obtained solid, solid are dissolved with ultrapure water again, and with 4 DEG C of dialysed overnights of bag filter of 3,500Da, dialysis terminates sample freeze-drying.
Applicant will purify the reaction group of lane 3 in Fig. 2 (a) with the method, and obtained CpG-AF is carried out PAGE verifying, obtain
Fig. 2 (b), lane 2 is CpG-AF after purification, and lane 1 is unmodified CpG ODN, it can be seen that lane 2 and lane
1 has visibility point difference, and reaction yield is very high, stablizes by the CpG-AF that click reacts, does not degrade substantially
It happens.
Embodiment 3, above-mentioned CuAAC reaction condition are applied to other small molecules
By taking fatty acid lauric acid as an example, Fig. 3 is nitrine lauric acid and the CuAAC reaction schematic diagram of alkynyl-modified CpG ODN;
The configuration of reactant stock solution;
1. the alkynyl-modified CpG ODN stock solution of 0.5mM:
First the centrifuge tube equipped with alkynyl-modified CpG ODN powder is centrifuged.Every pipe contains CpG ODN 25nmol, is added 50
The ultrapure water of μ l, concussion make to be uniformly mixed, -20 DEG C of storages.
2. 0.02M nitrine lauric acid stock solution: 353 μ lDMF are added in 2.3mg nitrine lauric acid, and concussion dissolution seals 4 DEG C
It saves.
3. 4mM TBTA stock solution: 4.2mg TBTA powder is weighed, is dissolved in 2ml DMF, concussion makes to be uniformly mixed ,-
20 DEG C of storages.
④0.5mMCuSO4Stock solution: 12.5mg CuSO is weighed4·5H 2O is dissolved in 1ml ultrapure water, matching while using.
5. 0.2M Sodium Ascorbate stock solution: weighing 16mg sodium ascorbate powder, it is ultrapure to be dissolved in 400 μ l
In water, matching while using.
6. 2M triethylamine acetate buffer: mixing 2.78ml triethylamine and 1.14ml acetic acid are added ultrapure water and are settled to
10ml adjusts pH to 7.0, room temperature storage.In 0.5ml centrifuge tube be added sequentially add 1 μ l stock solution 4., 26 μ l stock solutions
3., 5 μ l stock solutions 6., 5 μ l stock solutions 1., 5 μ l stock solutions 2., 1 μ l stock solution 5., it is every that a kind of novel substance vortex is added, entirely
Portion add it is rear closed, constant temperature oscillator room temperature concussion reaction stay overnight.
The CpG ODN sequence ion vitro immunization difference on effect of embodiment 4, different chain length
1. splenocyte it is external collection and culture: take 8 weeks Balb/c mouse one, take off cervical approach put to death, 75% alcohol immersion 5
Minute.Mouse is dissected, abdominal cavity is opened, takes out spleen.Spleen is put in cell sieve, PBS, grinding is added.Suction pipe collects grinding
Liquid afterwards, is added centrifuge tube, and 4 degree of 1400rpm are centrifuged 5min.After centrifugation, liquid is discarded supernatant, 5ml erythrocyte cracked liquid is added,
It is resuspended, 4 degree 1400 turns are centrifuged 5 minutes, discard supernatant liquid, and repeating this step to tube bottom cell is white.With 1640 culture mediums, weight
Outstanding cell draws 10 μ l and instills cell counting board, cell count under microscope.It is added in 96 orifice plates.96 orifice plates are placed in
37 DEG C, 5%CO22h is cultivated in incubator respectively.
2. prepared by sample solution: with the solution of the identical CpG as shown in table 3 below of PBS compound concentration;
Table 3
3. cell administration: it takes out sample solution and is added in 96 orifice plates, three multiple holes of each sample.Constant temperature cell incubator
In, 37 degree, after CO2 concentration 5% is cultivated 24 hours, 4 DEG C, 1400rpm is centrifuged 5mim, collects supernatant and measures for ELISA.
4. result: it stimulates splenocyte to secrete IL-6 by the CpG that upper result can be seen that different chain length and has differences, with
Blank group is compared, CpG1826, CpG-7, CpG-8, CpG-13, and the expression that CpG2006 stimulation splenocyte secretes IL-6 has significant
Property improve;Fig. 4 is the ion vitro immunization effect of stimulation figure of different chain length CpG.
The difference of embodiment 5, the CpG ODN epi sequence effect of different backbone modifications
1. splenocyte it is external collection and culture: take 8 weeks Balb/c mouse one, take off cervical approach put to death, 75% alcohol immersion 5
Minute.Mouse is dissected, abdominal cavity is opened, takes out spleen.Spleen is put in cell sieve, PBS, grinding is added.Suction pipe collects grinding
Liquid afterwards, is added centrifuge tube, and 4 degree of 1400rpm are centrifuged 5min.After centrifugation, liquid is discarded supernatant, 5ml erythrocyte cracked liquid is added,
It is resuspended, 4 degree 1400 turns are centrifuged 5 minutes, discard supernatant liquid, and repeating this step to tube bottom cell is white.It is cultivated with 10ml 1640
Cell is resuspended in base, draws 10 μ l and instills cell counting board, cell count under microscope.It is added in 96 orifice plates, 96 orifice plates is placed
In cultivating 2h respectively in 37 DEG C, 5%CO2 incubator.
2. prepared by sample solution: with the solution of the CpG of the identical different backbone modifications of PBS compound concentration, including it is complete thio
Modification, part thio-modification, the CpG. of no thio-modification
3. cell administration: the 5 μ l of sample solution of various concentration is taken out, is added in 96 orifice plates, three multiple holes of each sample.
In constant temperature cell incubator, 37 degree, after CO2 concentration 5% is cultivated 24 hours, 4 DEG C, 1400rpm is centrifuged 5mim, collects supernatant and uses
It is measured in ELISA.
4. result: stimulating splenocyte to secrete IL-6 in the presence of poor by the CpG that upper result can be seen that different backbone modifications
Different, the effect of stimulation of full thio-modification group is best.But compared to the blank group, the CpG stimulation splenocyte point of different backbone modifications
The expression for secreting IL-6 has significant property to improve.
The stomach and intestine stability of embodiment 6, small numerator modified CpG ODN
Simulation peptic digest liquid: weighing 20mg NaCl, 100mg pepsin, and 7ml deionized water, 73 μ l concentrated hydrochloric acids is added,
Again with hydrochloric acid tune PH to 1.2, water is added to be settled to 10ml, matching while using.
Simulation intestinal digestion liquid: weighing 70mg KH2PO4 and be dissolved in 2.5ml deionized water, and after being completely dissolved, 100mg pancreas is added
Enzyme adjusts PH to 7.5, water is added to be settled to 10ml.
Small numerator modified CpG ODN is added in simulation peptic digest liquid and intestinal digestion liquid, 37 DEG C of isothermal vibration difference
0.5h and 2h, race glue, which is shown, is showed no obvious degradation, and small numerator modified CpG ODN has good stomach and intestine stability.
Difference on effect of the CpG ODN as immunopotentiator after embodiment 7, dipeptides modification
Four kinds of dipeptide structures are as shown in Figure 5;Immunization protocol: the 0th day to mouse carry out initial immunity, the 7th day and 14 days
Booster immunization, immune every time first to inject 10 μ g OVA (being dissolved in 100 μ l PBS) to mouse peritoneal, then stomach-filling takes orally certain agent
The CpG ODN or CpG-dipeptide of amount (not indicating especially is 100 μ g).
Blood sample collection: point carries out blood sample collection in different times, is used for Efficacy evaluation.It particularly points out, the 14th
It first collects blood sample before third time is immune, for evaluating second of immune immune effect.Take the method for blood for after eye socket
Veniplex takes blood.The blood sample of collection by room temperature be centrifuged (3000rpm, 10min), take supernatant, such as still have color, repeat from
Heart process, until entirely without color.It saves to -20 DEG C;
ELISA detects mice serum antibody level: applicant predominantly detects IgG in mice serum by ELISA method,
The level of tri- kinds of antibody of IgG2a, IgG1.As a result: shadow of the CpG ODN of four kinds of dipeptides modification to mice serum specific antibody
It rings: influence of the CpG-LP dosage to mice serum specific antibody level: in conclusion the CpG after AF, LP modification has more preferably
Immunoenhancement result, referring specifically to fig. 6,7,8,9.
Difference on effect of the CpG ODN as immunopotentiator after embodiment 8, stearic acid and lauric acid modification
Immunization protocol: initial immunity is carried out to mouse at the 0th day, the 7th day and 14 days booster immunizations are immune first to small every time
10 μ g OVA (being dissolved in 100 μ l PBS) is injected intraperitoneally in mouse, and then stomach-filling takes orally the CpG ODN or CpG-FA of doses (not
Especially indicating is 100 μ g).
Blood sample collection: point carries out blood sample collection in different times, is used for Efficacy evaluation.It particularly points out, the 14th
It first collects blood sample before third time is immune, for evaluating second of immune immune effect.Take the method for blood for after eye socket
Veniplex takes blood.The blood sample of collection by room temperature be centrifuged (3000rpm, 10min), take supernatant, such as still have color, repeat from
Heart process, until entirely without color;It saves to -20 DEG C.ELISA detects mice serum antibody level: main by ELISA method
Detect IgG in mice serum, the level of two kinds of antibody of IgG1.CpG after stearic acid and lauric acid modification has preferably immune
Reinforcing effect, specific visible Figure 10 and Figure 11.
Embodiment 9 compares CpG ODN work after cholic acid, cholesterol, glycine cholic acid ester salt, the modification of taurine cholate salt
For the difference on effect of immunopotentiator
Immunization protocol: initial immunity is carried out to mouse at the 0th day, the 7th day and 14 days booster immunizations are immune first to small every time
10 μ g OVA (being dissolved in 100 μ l PBS) is injected intraperitoneally in mouse, after then stomach-filling takes orally CpG ODN or the modification of doses
CpG。
Blood sample collection: point carries out blood sample collection in different times, is used for Efficacy evaluation.It particularly points out, the 14th
It first collects blood sample before third time is immune, for evaluating second of immune immune effect.Take the method for blood for after eye socket
Veniplex takes blood.The blood sample of collection by room temperature be centrifuged (3000rpm, 10min), take supernatant, such as still have color, repeat from
Heart process, until entirely without color.It saves to -20 DEG C;
ELISA detects mice serum antibody level: IgG in mice serum is predominantly detected by ELISA method, two kinds of IgG1
The level of antibody.As a result: cholic acid, cholesterol, glycine cholic acid ester salt, taurine cholate salt modification CpG ODN relative to
Unmodified CpG ODN, mice serum IgG antibody, IgG1 level all improve to some extent.
The difference that embodiment 10, the CpG ODN for comparing the modification of four dipeptides act on Tumor growth inhibition
Model foundation: BALB/c murine mammary cancerous cell line 4T1-PGL3 is incubated at containing 10%FBS, and 1% is dual anti-
In 1640 culture medium of RPMI, 37 DEG C, 5%CO2, when cell monolayer lamella reaches 90% fusion, 0.25% trypsin digestion
Cell is passed on.The 4T1 cell of logarithmic growth phase is collected, PBS washes 1 time, cell count.The upper left side mammary gland of BALB/c mouse
Subcutaneously with 5*105Cell/only plant tumor.Growing to diameter to tumour has 5mm or so to start to be administered.
Tumour growth observation: observation tumour growth pattern uses gross tumor volume (V=) of vernier caliper measurement every three days
1/2* long * wide2.Terminate observation after one month.As a result: the CpG ODN of dipeptides AF, LP modification has different degrees of antitumor work
Property.
Embodiment 11 compares stearic acid, the difference that the CpG ODN of lauric acid modification acts on Tumor growth inhibition
Model foundation: BALB/c murine mammary cancerous cell line 4T1-PGL3 is incubated at containing 10%FBS, and 1% is dual anti-
In 1640 culture medium of RPMI, 37 DEG C, 5%CO2, when cell monolayer lamella reaches 90% fusion, 0.25% trypsin digestion
Cell is passed on.The 4T1 cell of logarithmic growth phase is collected, PBS washes 1 time, cell count.The upper left side mammary gland of BALB/c mouse
Subcutaneously with 5*105Cell/only plant tumor.Growing to diameter to tumour has 5mm or so to start to be administered.
Tumour growth observation: observation tumour growth pattern uses gross tumor volume (V=) of vernier caliper measurement every three days
1/2* long * wide2.Terminate observation after one month.As a result: the CpG ODN for the CpG ODN that stearic acid, lauric acid are modified is different
The anti-tumor activity of degree.
Embodiment 12 compares the CpG ODN couple that cholic acid, cholesterol, glycine cholic acid ester salt, taurine cholate salt are modified
The difference of Tumor growth inhibition effect
Model foundation: BALB/c murine mammary cancerous cell line 4T1-PGL3 is incubated at containing 10%FBS, and 1% is dual anti-
In 1640 culture medium of RPMI, 37 DEG C, 5%CO2, when cell monolayer lamella reaches 90% fusion, 0.25% trypsin digestion
Cell is passed on.The 4T1 cell of logarithmic growth phase is collected, PBS washes 1 time, cell count.The upper left side mammary gland of BALB/c mouse
Subcutaneously with 5*105Cell/only plant tumor.Growing to diameter to tumour has 5mm or so to start to be administered.
Tumour growth observation: observation tumour growth pattern uses gross tumor volume (V=) of vernier caliper measurement every three days
1/2* long * wide2.Terminate observation after one month.As a result: cholic acid, cholesterol, glycine cholic acid ester salt, taurine cholate salt are repaired
The CpG ODN of decorations has different degrees of anti-tumor activity.
In conclusion the CpG oligodeoxynucleotide (CpG ODN) of the present invention through structural modification, by specific group
The peptide fragment of conjunction, the fatty acid of certain chain lengths or lipid structure modification have the CpG ODN of immunoloregulation function and obtain.This knot
The CPG ODN of structure modification has better oral administration biaavailability and immunoloregulation function, can be used as oral immunity enhancing
And immunotherapy medicaments, organism is improved to the immune response of antigen, is applied to anaphylactia, communicable disease, immune is lacked
Fall into property disease and cancer etc..
Specific embodiments of the present invention are described above.It is to be appreciated that the invention is not limited to above-mentioned
Particular implementation, those skilled in the art can make various deformations or amendments within the scope of the claims, this not shadow
Ring substantive content of the invention.
Claims (7)
1. a kind of oligodeoxynucleotide for the sequence units containing CpG being modified, which is characterized in that it is described be modified containing CpG
The structural formula of the oligodeoxynucleotide of sequence units is shown below:
2. the oligodeoxynucleotide for the sequence units containing CpG being modified as described in claim 1, which is characterized in that described
Oligodeoxynucleotide contains 1-5 CpG unit, a length of 10-30nt of chain.
3. the oligodeoxynucleotide for the sequence units containing CpG being modified as described in claim 1, which is characterized in that described
The site of decorating molecule modification is the 5 '-ends, 3 '-ends or middle position of oligodeoxynucleotide.
4. the oligodeoxynucleotide for the sequence units containing CpG being modified as described in claim 1, which is characterized in that described
Oligodeoxynucleotide contains one of following sequence:
。
5. the oligodeoxynucleotide for the sequence units containing CpG being modified as described in claim 1, which is characterized in that described
The skeleton of oligodeoxynucleotide is for full thio-modification, part thio-modification or without thio-modification.
6. the oligodeoxynucleotide for the sequence units containing CpG that one kind is modified as described in claim 1 is used to prepare immune
The application of reinforcing agent.
7. the oligodeoxynucleotide for the sequence units containing CpG that one kind is modified as described in claim 1 is used to prepare treatment
Oral or sucking preparation the application of tumour.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610343119.8A CN105936906B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310554389.XA CN103773769B (en) | 2013-11-08 | 2013-11-08 | Adorned oligodeoxynucleotide molecule containing CpG sequence units and application thereof |
CN201610343119.8A CN105936906B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310554389.XA Division CN103773769B (en) | 2013-11-08 | 2013-11-08 | Adorned oligodeoxynucleotide molecule containing CpG sequence units and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105936906A CN105936906A (en) | 2016-09-14 |
CN105936906B true CN105936906B (en) | 2019-06-21 |
Family
ID=50566534
Family Applications (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610339165.0A Active CN105925583B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
CN201310554389.XA Expired - Fee Related CN103773769B (en) | 2013-11-08 | 2013-11-08 | Adorned oligodeoxynucleotide molecule containing CpG sequence units and application thereof |
CN201610343119.8A Active CN105936906B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
CN201610343117.9A Active CN105936905B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
Family Applications Before (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610339165.0A Active CN105925583B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
CN201310554389.XA Expired - Fee Related CN103773769B (en) | 2013-11-08 | 2013-11-08 | Adorned oligodeoxynucleotide molecule containing CpG sequence units and application thereof |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610343117.9A Active CN105936905B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (4) | CN105925583B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105749275A (en) * | 2016-03-30 | 2016-07-13 | 山东农业大学 | Nucleic acid slow release adjuvant and preparation and use methods thereof |
CN107099537B (en) * | 2017-04-12 | 2020-05-12 | 山东省农业科学院畜牧兽医研究所 | Duck specific CpG oligodeoxynucleotide and application thereof |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101454451A (en) * | 2003-10-30 | 2009-06-10 | 科勒制药有限公司 | C-class oligonucleotide analogs with enhanced immunostimulatory potency |
CN101517082A (en) * | 2006-09-27 | 2009-08-26 | 科勒制药有限责任公司 | CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity |
CN102333538A (en) * | 2008-12-09 | 2012-01-25 | 科勒制药集团有限公司 | Immunostimulatory oligonucleotides |
CN102864152A (en) * | 2005-11-07 | 2013-01-09 | 艾德拉药物股份有限公司 | Immunostimulation characteristic of oligonucleotide-based compound comprising modified immunostimulation dinucleotide |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN100439386C (en) * | 2003-03-05 | 2008-12-03 | 长春华普生物技术有限公司 | Deoxyoligonucleotide containing CpG single strand for strengthening immunological effect of Protein vaccine |
CN101085348B (en) * | 2007-06-18 | 2010-08-18 | 南京农业大学 | Nasal cavity immunity composite adjuvant for avian influenza inactivation antigen |
CN101850117B (en) * | 2010-06-03 | 2012-05-30 | 国家兽用生物制品工程技术研究中心 | Compound immunological adjuvant and vaccine |
MX344972B (en) * | 2010-11-16 | 2017-01-12 | Selecta Biosciences Inc | Immunostimulatory oligonucleotides. |
-
2013
- 2013-11-08 CN CN201610339165.0A patent/CN105925583B/en active Active
- 2013-11-08 CN CN201310554389.XA patent/CN103773769B/en not_active Expired - Fee Related
- 2013-11-08 CN CN201610343119.8A patent/CN105936906B/en active Active
- 2013-11-08 CN CN201610343117.9A patent/CN105936905B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101454451A (en) * | 2003-10-30 | 2009-06-10 | 科勒制药有限公司 | C-class oligonucleotide analogs with enhanced immunostimulatory potency |
CN102864152A (en) * | 2005-11-07 | 2013-01-09 | 艾德拉药物股份有限公司 | Immunostimulation characteristic of oligonucleotide-based compound comprising modified immunostimulation dinucleotide |
CN101517082A (en) * | 2006-09-27 | 2009-08-26 | 科勒制药有限责任公司 | CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity |
CN102333538A (en) * | 2008-12-09 | 2012-01-25 | 科勒制药集团有限公司 | Immunostimulatory oligonucleotides |
Non-Patent Citations (2)
Title |
---|
《Nuclease-resistant immunostimulatory phosphodiester CpG oligodeoxynucleotides as human Toll-like receptor 9 agonists》;Meng Wenjun等;《BMC biotechnology》;20111231;第11卷;全文 |
《一种化学修饰对寡核苷酸生物活性的影响》;李军生等;《广西工学院学报》;20010630;第13卷(第2期);第6、7页第1、2节 |
Also Published As
Publication number | Publication date |
---|---|
CN103773769B (en) | 2016-09-28 |
CN105925583A (en) | 2016-09-07 |
CN105936905A (en) | 2016-09-14 |
CN105936906A (en) | 2016-09-14 |
CN105936905B (en) | 2019-08-30 |
CN105925583B (en) | 2019-05-17 |
CN103773769A (en) | 2014-05-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN112516297B (en) | Preparation method and application of antigen and adjuvant co-delivery nano vaccine based on protamine as carrier | |
CN1259052A (en) | Aqueous immunologic adjuvant compositions of monophosphoryl lipid A | |
CN106008667B (en) | Small peptide, its application and vaccine as vaccine adjuvant | |
CN107281476B (en) | Antigenic peptide RL-adjuvant CpGODN7909 conjugate as well as preparation method and application thereof | |
WO2021115410A1 (en) | Immunostimulatory composition and use thereof | |
EP3103807B1 (en) | Peptide/ beta-1,3-glucan complex and production method therefor, and pharmaceutical composition containing peptide/ beta-1,3-glucan complex | |
CN1921862A (en) | Immunostimulant composition comprising at least one TOLL-like receptor 7 or TOLL-like receptor 8 agonist and a TOLL-like receptor 4 agonist | |
US20240131152A1 (en) | Nano-particles that contain synthetic variants of gm3 ganglioside as adjuvants in vaccines | |
US7790189B2 (en) | Immunostimulating agents | |
CN105936906B (en) | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof | |
CN110042103B (en) | CpG-ODN with specific immunostimulation effect on pigs and application thereof | |
CN101448517A (en) | Monovalent and polyvalent synthetic polysaccharide antigens for immunological intervention in disease | |
CN112159814B (en) | CpG oligodeoxynucleotide, preparation and use thereof | |
CN112089834B (en) | Preparation and application of pachyman nano adjuvant based on graphene oxide and adjuvant/antigen co-delivery vaccine | |
KR20120016648A (en) | Immunostimulatory compositions comprising liposome-encapsulated oligonucleotides as active ingredients | |
CN101636174B (en) | Method for producing a tumor vaccine | |
CN101559225B (en) | Meningococcus vaccine | |
CN103789315B (en) | The CpG oligonucleotide that PEG modifies and application thereof | |
CN102212524A (en) | Oligodeoxyribonucleotide used as immunomodulator of cattle and pig and vaccine adjuvant | |
CN102219835B (en) | Long peptide based on HCA587 antigen and its application in preparing antitumor drugs | |
CN108785323B (en) | Spermine modified pullulan as immunopotentiator | |
CN101314035B (en) | Uses of biological polyoses microcapsule | |
Wang et al. | Screening of novel immunostimulatory CpG ODNs and their anti-leukemic effects as immunoadjuvants of tumor vaccines in murine acute lymphoblastic leukemia | |
RU2478644C2 (en) | Method for preparing pharmacologically acceptable mixture of substances containing low-molecular ingredients of cell wall peptidoglycane of gram-negative bacteria and possessing immunostimulatory activity | |
Chedid | Immunopharmacological activities of muramyl dipeptide, a synthetic mycobacterial analog |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |