CN105936906A - Modified CpG sequence unit-containing oligodeoxynucleotide molecule and uses thereof - Google Patents
Modified CpG sequence unit-containing oligodeoxynucleotide molecule and uses thereof Download PDFInfo
- Publication number
- CN105936906A CN105936906A CN201610343119.8A CN201610343119A CN105936906A CN 105936906 A CN105936906 A CN 105936906A CN 201610343119 A CN201610343119 A CN 201610343119A CN 105936906 A CN105936906 A CN 105936906A
- Authority
- CN
- China
- Prior art keywords
- cpg
- oligodeoxynucleotide
- lane
- cpg odn
- odn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/17—Immunomodulatory nucleic acids
Abstract
The invention relates to a modified CpG sequence unit-containing oligodeoxynucleotide molecule and uses thereof, belongs to the technical field of immunotherapy, and also relates to an application of the modified CpG sequence unit-containing oligodeoxynucleotide molecule as an immunopotentiator, and an application of the modified CpG sequence unit-containing oligodeoxynucleotide molecule as an oral or inhalation preparation for treating tumors. Structurally modified CpG oligodeoxynucleotide (CpG ODN) is obtained through modifying a specifically combined peptide segment, specific-chain length fatty acid or a lipoid structure with the CpG ODN with an immunoloregulation function. The structurally modified CPG ODN has good oral bioavailability and immunoloregulation function, can be used as an oral immunopotentiation and immunotherapy medicine, can improve the immune response of organisms to antigens, and can be used to treat allergic diseases, infective diseases, immunodeficiency diseases and cancers.
Description
The application is the divisional application of original application, the filing date of original application: 2013.11.08；Application No.:
201310554389.X；Invention and created name is: adorned oligodeoxynucleotide molecule containing CpG sequence units and use thereof
On the way.
Technical field
The invention belongs to immunotherapy techniques field, be specifically related to a kind of adorned oligomerization containing CpG sequence units and take off
Oxygen nucleic acid molecule and application thereof.
Background technology
As far back as the nineties in 19th century, it is the most swollen that U.S. oncologist Coley finds that antibacterial crude extract is applied to 900
Tumor patient, has 40% patient tumors to disappear voluntarily, it is believed that it is that the lipopolysaccharide in antibacterial crude extract plays activity at that time
Effect, does not cause enough attention.Later, the Mice Body carried out with bacillus calmette-guerin vaccine (Bacillus Calmette-Guerin, BCG)
Interior experiment finds, the BCG processed by DNA enzymatic does not have antitumor action, illustrates that DNA of bacteria is only mediation this antitumor effect
Material [Tokunaga, T., et al., the Antitumor activity of deoxyribonucleic acid answered
fraction from Mycobacteriumbovis BCG.I.Isolation,physicochemical
characterization,and antitumor activity.J Natl Cancer Inst,1984.72(4):955-
62].Subsequently, researcher confirms that DNA of bacteria has direct immunostimulation and antitumor action [Yamamoto, S., et
al.,DNA from bacteria,but not from vertebrates,induces interferons,activates
natural killer cells and inhibits tumor growth.MicrobiolImmunol,1992.36(9):
983-97].Pisetsky seminar reports the DNA of bacteria (bDNA) of purification and poly-(dG, dC) can induce B cell to increase
Grow and secretory antibody, and the DNA of mammal can not [Messina, J.P., G.S.Gilkeson, and D.S.Pisetsky,
Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA.J
Immunol,1991.147(6):1759-64].Subsequently, during researcher finds poly-(dG, dC), methylating of cytosine can be led
Cause mitogen activity and lose [Messina, J.P., G.S.Gilkeson, and D.S.Pisetsky, The influence of
DNA structure on the in vitro stimulation of murine lymphocytes by natural
and synthetic polynucleotide antigens.Cell Immunol,1993.147(1):148-57].But work as
Time researcher the different immunocompetences from antibacterial and mammalian DNA that methylate of CpG are not connected, they are only
It is to guess to methylate to destroy the higher structure of bDNA.
Ground by the experiment carried out with the oligodeoxynucleotide (oligodeoxynucleotides, ODN) of synthesis
Studying carefully, finding that DNA of bacteria has immunostimulation is owing to wherein containing the non-methylated CpG core with specificity flanking sequence
Thuja acid motif [Yamamoto, T., et al., Lipofection of synthetic oligodeoxyribonucleotide
having a palindromic sequence of AACGTT to murine splenocytes enhances
interferon production and natural killer activity.MicrobiolImmunol,1994.38
(10):831-6].Different from DNA of bacteria, the frequency that in mammal and other vertebrates DNA moleculars, CpG motif occurs is very
Low, and in the CpG motif of 60%～90%, the 5th carbon atom of cytosine methylates, therefore, mammal itself
DNA molecular does not have immunostimulation [Barton, G.M., J.C.Kagan, and R.Medzhitov, Intracellular
localization of Toll-like receptor 9prevents recognition of self DNA but
facilitates access to viral DNA.Nature Immunology,2006.7(1):49-56]。Arthur
The immunostimulatory activity of the different sequence C pG ODN that M.Krieg et al. is synthesized by analysis, tentatively draws immunostimulating CpG
The basic law of ODN structure: sequence must contain non-methylated CpG motif；The basic structure of CpG motif is 5'-X 1X
2CGY 1Y 2-3', wherein X 1 represents a purine, and X 2 represents a purine or a thymus pyrimidine, and Y 1 and Y 2 represents
Pyrimidine.One or more CpG motif can be had in a CpG ODN, purine that CpG motif both sides are special and pyrimidine, with
And the difference being separated by base between CpG motif all can affect immunostimulation type and intensity [Krieg, A.M., the et of CpG motif
al.,CpG motifs in bacterial DNA trigger direct B-cell activation.Nature,
1995.374(6522):546-9；Krieg,A.M.,CpG motifs in bacterial DNA and their immune
effects.Annual Review of Immunology,2002.20:709-760；Krieg,A.M.,G.Hartmann,and
A.K.Yi,Mechanism of action of CpG DNA.Immunobiology of Bacterial Cpg-DNA,
2000.247:1-21]。
Human immune system is it can be found that pathogenic infection, and sorts out to produce different cytological effects to infecting,
Crucial structure is special, the antigen receptor of high-affinity, referred to as pattern having on immunocyte (such as T cell, B cell)
Identification receptor (pattern-recognition receptor, PRR).PRR can combine with the antigen above pathogen, these
Antigen is collectively referred to as pathogen associative mode molecule (pathogen-associated molecular pattern, PAMP).Contain
The oligodeoxynucleotide having non-methylated CpG dinucleotide is exactly one of PAMP.Up to now, people are found that four kinds altogether
The CpG ODN:D type (or A type) of type, K-type (or Type B), c-type and p-type, each type has the structure of uniqueness and biological function special
Point.TLR9 that they are distributed on endocytoplasmic reticulum identifies, and expresses TLR9, mainly mononuclear cell, huge in Mice Body
Phagocyte, mDC cell, pDC cell and B cell, the interior mainly latter two of human body [Klinman, D.M., Currie, D.,
Gursel,I.&Verthelyi,D.Use of CpGoligodeoxynucleotides as immune
adjuvants.Immunological Reviews 199,201-216(2004)]。
Therefore CpG oligodeoxynucleotide can directly stimulate these cells, and indirect activation T cell, natural killer cell,
Induce based on the immunne response of Th1 type, and up-to-date research show that it can directly suppress mMDSC cell
[Y.Shirota, H.Shirota, D.M.Klinman, Journal of immunology 2012,188,1592-1599], quilt
It is known as immunological adjuvant or the immunotherapy medicaments of a kind of novel high-efficiency low-toxicity, in treatment infectious disease, anaphylaxis disease
Disease, immunodeficiency diseases and cancer have powerful potential using value, is just closed by more and more scientists
Note.
Skeleton full sulfur generation or part thio-modification to CpG oligodeoxynucleotide at present, it is possible to it is few that part solves CpG
Poly-Deoxydization nucleotide is by the problem of nuclease hydrolysis, but still there is the problem that bioavailability is the highest, and therefore the present invention is to CpG
Oligodeoxynucleotide carries out small numerator modified to solve the bioavailability of this problem, particularly oral administration.
Summary of the invention
It is an object of the invention to overcome the deficiencies in the prior art, it is provided that a kind of adorned widow containing CpG sequence units
Poly-deoxyribonucleic acid molecule and application thereof.The CPG ODN of the structural modification of the present invention have more preferable oral administration biaavailability with
And immunoloregulation function.
First aspect, the present invention relates to a kind of adorned oligodeoxynucleotide containing CpG sequence units, described modification
One in molecule selection following formula:
Preferably, described oligodeoxynucleotide contains 1-5 CpG unit, a length of 10-30nt of its chain.
Preferably, described decorating molecule modify site be 5 '-end of oligodeoxynucleotide, 3 '-end or in
Between position.
Preferably, the one during described oligodeoxynucleotide contains following sequence:
| Group | Sequence (5 '-3 ') |
| CpG1826 | tccatgacgttcctgacgtt |
| CpG-H1826 | tccatgtcgttcctgtcgtt |
| CpG-7 | tgacgttccgtt |
| CpG-H7 | Tgtcgttccgtt |
| CpG-8 | atgacgttgcgtt |
| CpG-H8 | atgtcgttgcgtt |
| CpG-13 | tccatgacgttcctgacgttcctgacgtt |
| CpG-H13 | tccatgtcgttcctgtcgttcctgtcgtt |
| CpG7909(2606) | tcgtcgttttgtcgttttgtcgtt |
In clinical practice, CpG1826, CpG-7, CpG-8, CpG-13 that Mus is sensitive, can turn according to known theory
Change sensitive sequence C pG-H1826 of people, CpG-H7, CpG-H8, CpG-H13 into.
Preferably, the skeleton of described oligodeoxynucleotide is full thio-modification, part thio-modification or repaiies without sulfur generation
Decorations.
Second aspect, the present invention relates to the most adorned a kind of oligodeoxynucleotide containing CpG sequence units
Application as immunostimulant.
The third aspect, the invention still further relates to the most adorned a kind of oligodeoxynucleoside containing CpG sequence units
Acid is as the oral for the treatment of tumor or the application of suction preparation.
The present invention has following beneficial effect: the present invention relates to a kind of CpG oligodeoxynucleotide through structural modification
(CpG ODN), is modified by the peptide fragment of particular combination, the fatty acid of certain chain lengths or lipid structure and has immunoloregulation function
CpG ODN and obtain.The CPG ODN of this structural modification has more preferable oral administration biaavailability and immunoloregulation function, can
Using as oral immunity strengthen and immunotherapy medicaments, improve the organism immunne response to antigen, be applied to anaphylactic disease,
Infectious disease, immunodeficiency diseases and cancer etc..
Accompanying drawing explanation
By the detailed description non-limiting example made with reference to the following drawings of reading, the further feature of the present invention,
Purpose and advantage will become more apparent upon:
Fig. 1 is the click reaction PAGE figure of differential responses condition；
Fig. 2 is the conjugate PAGE figure that click reaction PAGE schemes and purification is crossed of differential responses condition；
Fig. 3 is nitrine lauric acid and the CuAAC response diagram of alkynyl-modified CpG ODN；
Fig. 4 is the ion vitro immunization effect of stimulation figure of different chain length CpG；
Fig. 5 is four kinds of dipeptide structure figures；
Fig. 6 is CpG and the 14th day mice serum antibody concentration and IgG2a/ after the CpG initial immunity modified of four dipeptides
IgG1 ratio figure；
Fig. 7 is CpG and the 21st day mice serum antibody concentration and IgG2a/ after the CpG initial immunity modified of four dipeptides
IgG1 ratio figure；
Fig. 8 is mice serum antibody concentration and the IgG2a/IgG1 ratio of the CpG not time point of CpG and four dipeptides modifications
Figure；
Fig. 9 is the 21st day mice serum antibody concentration figure after various dose CpG, CpG-LP initial immunity；
Figure 10 is the 21st day mice serum antibody concentration figure after CpG, CpG-SA, CpG-LA initial immunity；
Figure 11 is the 28th day mice serum antibody concentration figure after CpG, CpG-SA, CpG-LA initial immunity.
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are merely to illustrate the present invention
Rather than restriction the scope of the present invention.The test method of unreceipted actual conditions in the following example, generally according to conventional strip
Part, such as Pehanorm Brooker equimolecular clone: the condition described in the laboratory manual third edition (Science Press, 2002), or
According to the condition proposed by each manufacturer.
The impact that CuAAC is reacted by embodiment 1, nitrine and alkynyl concentration, catalyst, response time
Select a dipeptides AF to carry out the optimization of reaction condition, the method for optimization can be generalized to other little molecule with
The click reaction of CpG ODN.The premise that all reaction conditions change is all to react to carry out under room temperature is shaken.
Table 1 variable concentrations nitrine, alkynyl, different proportion catalyst and differential responses time EXPERIMENTAL DESIGN
Fig. 1 is the click reaction PAGE figure of differential responses condition, and in (a) and (b), M represents 20bp DNA marker,
Lane 1 is the most modified CpG ODN；PAGE electrophoresis is carried out according to the design of table 1；Reaction condition in Fig. 1 (a) is reference
Condition [Rostovtsev, V.V., et al., the A stepwise huisgen of classical little molecule click reaction
cycloaddition process:copper(I)-catalyzed regioselective"ligation"of azides
And terminal alkynes.Angew Chem Int Ed Engl, 2002.41 (14): 2596-9], CpG ODN 5nmol
(34 μ l), AF 50nmol (8.5 μ l), CuSO 4 0.005nmol (1 μ l), sodium ascorbate0.5nmol (1 μ l), three
Aminophenylsulfonic acid buffer 300 μ l, lane 3 groups reaction adds TBTA 0.5nmol (6.75 μ l), and lane 2 groups does not add
TBTA, two groups of reactions all react 24 hours.In reaction system, the concentration of CpG ODN is 0.014mM.From the point of view of PAGE result,
Lane 2, lane 3 and lane 1 compares position does not has notable difference, illustrates that click reaction is not carried out, does not has conjugate
Produce.Illustrate that the condition being applicable to little molecule click reaction is unworkable for macromole.
Improve alkynyl and nitrine concentration in reaction system, simultaneously by the consumption of CuSO4 from the 1/100 of original CpG ODN
Bringing up to 20 times of CpG ODN, TBTA and sodium ascorbate brings up to CpG from the 1/10 of original CpG ODN consumption
40 times of ODN, and reduce the volume of buffer, in such reaction system, the concentration of CpG ODN is 0.1mM.Applicant investigates
The impact that click is reacted by TBTA and response time, has obtained Fig. 1 (b).In Fig. 1 (b), lane 2, lane 4, lane's 6
Reaction system does not add TBTA, and the reaction system of lane 3, lane 5, lane 7 adds TBTA；Lane 2 with
Lane 3 response time is 6 hours, and lane 4 and lane 5 response time are 12 hours, and lane 6 and lane 7 response time is
24 hours.
In Fig. 1 (b) six groups reactions have two bands substantially, and the most modified CpG of position and lane 1
ODN has notable difference, contrasts with Fig. 1 (a), it has been found that after CpG ODN and AF concentration in reaction system improves,
And after the ratio of catalyst and CpG ODN improves, click react generation, coupled product appearance, coupled product in PAGE
The band band higher than the most modified CpG ODN.This result explanation CpG ODN of high concentration and polypeptide, a high proportion of urge
Agent, the fewest solvent volume, click reaction is carried out extremely advantageous.
Lane 3 in Fig. 1 (b), lane 5, lane 7 and lane 2, the band of lane 4, lane 6 is compared the most clear,
This demonstrates that the click of CpG ODN is reacted by TBTA is indispensable.And lane 2, lane3 Yu lane 4, lane 5
Comparing with 7 liang of groups of lane 6, lane, band becomes apparent from, and within 12 hours and 24 hours, does not demonstrate higher conversion ratio,
So applicant selects 6 hours according to choice experiment arrangement or overnight 12h reaction.
PAGE process:
(1) carbamide of glue raw material and consumption: 4.2g, 1mlTBE buffer, 4.44ml acrylamide, 40ulAP,
4ulTBMB.Carbamide is not had to separate out the when of noting glue.
(2) glue prepared is rapidly joined in off-the-shelf glass plate, treat about 1 hour, after waiting gelling good
Add tbe buffer liquid, after adding buffer, it is ensured that buffer will not spill, afterwards loading.Can prepare Deng gelling solid period
Sample.
Opening electrophresis apparatus after having gone up sample, start to run glue, after about 34 hours, i.e. sample has arrived colloid edge
Time, stop electrophoresis.Glue is taken off, puts into surface plate, add stain supergreen and start dyeing, about contaminate half an hour
The when of left and right, glue is taken out, development.
The impact that CuAAC is reacted by ratio and the reaction buffer of the little molecule of embodiment 2, nitrine and CpG ODN
Determine optimum reacting time, specify that the effect of TBTA, optimize the concentration of CpG ODN Yu AF and catalyst
After ratio, the impact that click is reacted by the different proportion of investigation AF with CpG ODN and reaction buffer, and determine coupled product
Purification process.
The different buffer of table 2, the EXPERIMENTAL DESIGN of AF Yu CpG ODN different proportion
Fig. 2 is in conjugate PAGE figure (a) and (b) that click reaction PAGE schemes and purification is crossed of differential responses condition, M
Representing 20bp DNA marker, lane 1 is the most modified CpG ODN；A () carries out electrophoresis according to the design of table 2；B () is pure
The PAGE checking of change method, the CpG-AF that lane 3 crosses for purification；
In Fig. 2 (a), the reaction system of lane 2, lane 3 adds the triethylamine acetate buffer of 2M pH 7.0,
The reaction system of lane 4, lane 5 do not has buffer；In the reaction system of lane 3, lane 5, dipeptides is with CpG ODN's
Ratio is 50:1, and in the reaction system of lane 2, lane 4, the ratio of AF Yu CpG ODN is 10:1, and other reaction conditions are equal
Consistent with above screen.Four groups of experiment Integrated comparative, applicant finds out that the reaction efficiency of lane 3 is the highest, and this says
Click is reacted favourable by bright buffer and high AF with CpG ODN ratio.So applicant selects 50:1 as AF and CpG
The reaction ratio of ODN, determines the click of CpG ODN with AF simultaneously and reacts and need triethylamine acetate buffer.
Purification click product is carried out with acetone precipitation.Method particularly includes: in reaction system, add 5 times of reaction volumes
Acetone, abundant vortex mixes, and is put in-20 DEG C of refrigerators 30 minutes.4 DEG C, 10000rpm, centrifugal 20 minutes, discard supernatant, then add
Entering 1ml acetone, repeatedly blow and beat, clean the solid separated out, then 4 DEG C, 10000rpm is centrifuged 20 minutes, then discards supernatant, is dried
The solid obtained, solid dissolves with ultra-pure water again, and with 3,4 DEG C of dialysed overnight of the bag filter of 500Da, dialysis terminates sample lyophilizing.
Applicant will purify the reaction group of lane 3 in Fig. 2 (a) by the method, and the CpG-AF obtained is carried out PAGE checking, obtain
Fig. 2 (b), lane 2 is CpG-AF after purification, and lane 1 is the most modified CpG ODN, it can be seen that lane 2 and lane
1 has visibility point difference, and reaction yield is the highest, and the CpG-AF obtained through click reaction is stable, does not the most degrade
Situation occurs.
Embodiment 3, above-mentioned CuAAC reaction condition are applied to other little molecules
As a example by fatty acid lauric acid, Fig. 3 is that the CuAAC of nitrine lauric acid and alkynyl-modified CpG ODN reacts schematic diagram；
Reactant storing solution configures；
1. 0.5mM alkynyl-modified CpG ODN storing solution:
The centrifuge tube that first will be equipped with alkynyl-modified CpG ODN powder is centrifuged.Often pipe is containing CpG ODN 25nmol, adds 50
The ultra-pure water of μ l, concussion makes mix homogeneously ,-20 DEG C of storages.
2. 0.02M nitrine lauric acid storing solution: 2.3mg nitrine lauric acid, adds 353 μ lDMF, and concussion is dissolved, sealed 4 DEG C
Preserve.
3. 4mM TBTA storing solution: weigh 4.2mg TBTA powder, is dissolved in 2ml DMF, and concussion makes mix homogeneously ,-
20 DEG C of storages.
④0.5mMCuSO4Storing solution: weigh 12.5mg CuSO4·5H 2O, is dissolved in 1ml ultra-pure water, matching while using.
5. 0.2M Sodium Ascorbate storing solution: weigh 16mg sodium ascorbate powder, is dissolved in 400 μ l ultrapure
In water, matching while using.
6. 2M triethylamine acetate buffer: mixing 2.78ml triethylamine and 1.14ml acetic acid, adds ultra-pure water and is settled to
10ml, regulates pH to 7.0, room temperature storage.In 0.5ml centrifuge tube add be sequentially added into 1 μ l storing solution 4., 26 μ l storing solutions
3., 5 μ l storing solutions 6., 5 μ l storing solutions 1., 5 μ l storing solutions 2., 1 μ l storing solution 5., often add a kind of novel substance vortex, entirely
Portion is airtight after adding, and the concussion reaction of constant temperature oscillator room temperature is overnight.
Embodiment 4, the CpG ODN sequence ion vitro immunization difference on effect of different chain length
1. the external collection of splenocyte and cultivation: taking 8 weeks Balb/c mices one, de-cervical approach is put to death, 75% alcohol-pickled 5
Minute.Dissect mice, open abdominal cavity, take out spleen.Spleen is put on cell sieve, adds PBS, grind.Suction pipe is collected and is ground
After liquid, add centrifuge tube, 4 degree of 1400rpm are centrifuged 5min.After Li Xin, abandoning supernatant, add 5ml erythrocyte cracked liquid,
Resuspended, 4 degree 1400 leaves the heart 5 minutes, abandoning supernatant, and repeating this step to pipe floor cells is white.Use 1640 culture medium, weight
Outstanding cell, draws 10 μ l and instills cell counting count board, cell counting under microscope.Join in 96 orifice plates.96 orifice plates are positioned over
37 DEG C, 5%CO22h is cultivated respectively in incubator.
2. prepared by sample solution: use the solution of the CpG as shown in table 3 below that PBS compound concentration is identical；
Table 3
3. cell administration: take out sample solution and join in 96 orifice plates, the multiple hole of three, each sample.Constant temperature cell culture incubator
In, 37 degree, after CO2 concentration 5% cultivates 24 hours, 4 DEG C, 1400rpm is centrifuged 5mim, collects supernatant and measures for ELISA.
4. result: by upper result it can be seen that the CpG of different chain length stimulates splenocyte secretion IL-6 there are differences, with
Blank group is compared, and CpG1826, CpG-7, CpG-8, CpG-13, CpG2006 stimulate the expression of splenocyte secretion IL-6 to have significant
Property improve；Fig. 4 is the ion vitro immunization effect of stimulation figure of different chain length CpG.
Embodiment 5, the difference of CpG ODN epi sequence effect of different backbone modification
1. the external collection of splenocyte and cultivation: taking 8 weeks Balb/c mices one, de-cervical approach is put to death, 75% alcohol-pickled 5
Minute.Dissect mice, open abdominal cavity, take out spleen.Spleen is put on cell sieve, adds PBS, grind.Suction pipe is collected and is ground
After liquid, add centrifuge tube, 4 degree of 1400rpm are centrifuged 5min.After Li Xin, abandoning supernatant, add 5ml erythrocyte cracked liquid,
Resuspended, 4 degree 1400 leaves the heart 5 minutes, abandoning supernatant, and repeating this step to pipe floor cells is white.Cultivate with 10ml 1640
Base, re-suspended cell, draw 10 μ l and instill cell counting count board, cell counting under microscope.Add in 96 orifice plates, 96 orifice plates are placed
In 37 DEG C, in 5%CO2 incubator, cultivate 2h respectively.
2. prepared by sample solution: use the solution of the CpG of the different backbone modifications that PBS compound concentration is identical, including full sulfur generation
Modifying, part thio-modification, without the CpG. of thio-modification
3. cell administration: take out the sample solution 5 μ l of variable concentrations, join in 96 orifice plates, the multiple hole of three, each sample.
In constant temperature cell culture incubator, 37 degree, after CO2 concentration 5% cultivates 24 hours, 4 DEG C, 1400rpm is centrifuged 5mim, collects supernatant and uses
Measure in ELISA.
4. result: by upper result it can be seen that the CpG of different backbone modification stimulates splenocyte secretion IL-6 existence poor
Different, the effect of stimulation of full thio-modification group is best.But compared with blank group, the CpG of different backbone modifications stimulates splenocyte to divide
The expression secreting IL-6 has had significant property to improve.
Embodiment 6, the gastrointestinal stability of small numerator modified CpG ODN
Simulation peptic digestion liquid: weigh 20mg NaCl, 100mg pepsin, adds 7ml deionized water, 73 μ l concentrated hydrochloric acid,
Adjust PH to 1.2 with hydrochloric acid again, add water and be settled to 10ml, matching while using.
Simulation intestinal digestion liquid: weigh 70mg KH2PO4 and be dissolved in 2.5ml deionized water, after being completely dissolved, adds 100mg pancreas
Enzyme, adjusts PH to 7.5, adds water and be settled to 10ml.
Being joined by small numerator modified CpG ODN in simulation peptic digestion liquid and intestinal digestion liquid, 37 DEG C of isothermal vibrations are respectively
0.5h and 2h, runs glue and shows and be showed no obvious degradation, and small numerator modified CpG ODN has good gastrointestinal stability.
After the modification of embodiment 7, dipeptides, CpG ODN is as the difference on effect of immunostimulant
Four kinds of dipeptide structure are as shown in Figure 5；Immunization protocol: mice is carried out initial immunity at the 0th day, the 7th day and 14 days
Booster immunization, mouse peritoneal first injected 10 μ g OVA (being dissolved in 100 μ l PBS) by each immunity, and then gavage is administered orally certain agent
CpG ODN or CpG-dipeptide (indicating the most especially is all 100 μ g) of amount.
Blood sample collection: carry out blood sample collection at different time points, for Efficacy evaluation.Particularly point out, the 14th
My god, for the third time before immunity, first collect blood sample, be used for evaluating the immune effect of second time immunity.Take after the method for blood is eye socket
Venous plexus takes blood.The blood sample collected, by room temperature centrifugal (3000rpm, 10min), takes supernatant, as still there being color, repeatable from
Heart process, until entirely without color.Preserve to-20 DEG C；
ELISA detects mice serum antibody horizontal: applicant predominantly detects IgG in mice serum by ELISA method,
The level of tri-kinds of antibody of IgG2a, IgG1.Result: the CpG ODN of the four kinds of dipeptides modifications shadow to mice serum specific antibody
Ringing: the CpG-LP dosage impact on mice serum specific antibody level: in sum, the CpG after AF, LP modify has more preferably
Immunoenhancement result, referring specifically to Fig. 6,7,8,9.
After embodiment 8, stearic acid and lauric acid modification, CpG ODN is as the difference on effect of immunostimulant
Immunization protocol: mice is carried out initial immunity at the 0th day, the 7th day and 14 days booster immunizations, each immunity is first to little
Mus lumbar injection 10 μ g OVA (is dissolved in 100 μ l PBS), and then gavage is administered orally CpG ODN or CpG-FA of doses (not
Indicating especially is all 100 μ g).
Blood sample collection: carry out blood sample collection at different time points, for Efficacy evaluation.Particularly point out, the 14th
My god, for the third time before immunity, first collect blood sample, be used for evaluating the immune effect of second time immunity.Take after the method for blood is eye socket
Venous plexus takes blood.The blood sample collected, by room temperature centrifugal (3000rpm, 10min), takes supernatant, as still there being color, repeatable from
Heart process, until entirely without color；Preserve to-20 DEG C.ELISA detects mice serum antibody horizontal: main by ELISA method
The level of two kinds of antibody of IgG, IgG1 in detection mice serum.CpG after stearic acid and lauric acid are modified has more preferable immunity
Reinforced effects, concrete visible Figure 10 and Figure 11.
Embodiment 9, compare cholic acid, cholesterol, glycine cholic acid ester salt, taurine cholate salt modify after CpG ODN make
Difference on effect for immunostimulant
Immunization protocol: mice is carried out initial immunity at the 0th day, the 7th day and 14 days booster immunizations, each immunity is first to little
Mus lumbar injection 10 μ g OVA (is dissolved in 100 μ l PBS), after then gavage is administered orally CpG ODN or the modification of doses
CpG。
Blood sample collection: carry out blood sample collection at different time points, for Efficacy evaluation.Particularly point out, the 14th
My god, for the third time before immunity, first collect blood sample, be used for evaluating the immune effect of second time immunity.Take after the method for blood is eye socket
Venous plexus takes blood.The blood sample collected, by room temperature centrifugal (3000rpm, 10min), takes supernatant, as still there being color, repeatable from
Heart process, until entirely without color.Preserve to-20 DEG C；
ELISA detects mice serum antibody horizontal: predominantly detect IgG in mice serum, IgG1 two kinds by ELISA method
The level of antibody.Result: cholic acid, cholesterol, glycine cholic acid ester salt, taurine cholate salt modify CpG ODN relative to
The CpG ODN of unmodified, mice serum IgG antibody, IgG1 level improve the most to some extent.
Embodiment 10, compare CpG ODN that four dipeptides the modify difference to Tumor growth inhibition effect
Model is set up: BALB/c murine mammary cancerous cell line 4T1-PGL3 is incubated at containing 10%FBS, and 1% is dual anti-
In RPMI 1640 culture medium, 37 DEG C, 5%CO2, when cell monolayer lamella reaches 90% fusion, 0.25% trypsinization
Cell passes on.Collecting the 4T1 cell of exponential phase, PBS washes 1 time, cell counting.The upper left side mammary gland of BALB/c mouse
Subcutaneous with 5*105Cell/only plant tumor.Treat that tumor grows to diameter and has about 5mm to start to be administered.
Tumor growth is observed: observe tumor growth pattern, every three days with gross tumor volume (V=) of vernier caliper measurement
1/2* long * width2.Terminate after one month to observe.Result: the CpG ODN that dipeptides AF, LP modify all has antitumor in various degree to live
Property.
The CpG ODN that embodiment 11, harder fat acid, lauric acid the are modified difference to Tumor growth inhibition effect
Model is set up: BALB/c murine mammary cancerous cell line 4T1-PGL3 is incubated at containing 10%FBS, and 1% is dual anti-
In RPMI 1640 culture medium, 37 DEG C, 5%CO2, when cell monolayer lamella reaches 90% fusion, 0.25% trypsinization
Cell passes on.Collecting the 4T1 cell of exponential phase, PBS washes 1 time, cell counting.The upper left side mammary gland of BALB/c mouse
Subcutaneous with 5*105Cell/only plant tumor.Treat that tumor grows to diameter and has about 5mm to start to be administered.
Tumor growth is observed: observe tumor growth pattern, every three days with gross tumor volume (V=) of vernier caliper measurement
1/2* long * width2.Terminate after one month to observe.Result: the CpG ODN of the CpG ODN that stearic acid, lauric acid are modified all has difference
The anti-tumor activity of degree.
Embodiment 12, compare cholic acid, cholesterol, glycine cholic acid ester salt, taurine cholate salt modify CpG ODN couple
The difference of Tumor growth inhibition effect
Model is set up: BALB/c murine mammary cancerous cell line 4T1-PGL3 is incubated at containing 10%FBS, and 1% is dual anti-
In RPMI 1640 culture medium, 37 DEG C, 5%CO2, when cell monolayer lamella reaches 90% fusion, 0.25% trypsinization
Cell passes on.Collecting the 4T1 cell of exponential phase, PBS washes 1 time, cell counting.The upper left side mammary gland of BALB/c mouse
Subcutaneous with 5*105Cell/only plant tumor.Treat that tumor grows to diameter and has about 5mm to start to be administered.
Tumor growth is observed: observe tumor growth pattern, every three days with gross tumor volume (V of vernier caliper measurement
=) 1/2* long * width2.Terminate after one month to observe.Result: cholic acid, cholesterol, glycine cholic acid ester salt, taurine cholate salt
The CpG ODN modified all has anti-tumor activity in various degree.
In sum, the CpG oligodeoxynucleotide through structural modification (CpG ODN) that the present invention relates to, by specific group
The peptide fragment, the fatty acid of certain chain lengths or the lipid structure that close are modified to be had the CpG ODN of immunoloregulation function and obtains.This knot
The CPG ODN that structure is modified has more preferable oral administration biaavailability and immunoloregulation function, can strengthen as oral immunity
And immunotherapy medicaments, improve the organism immunne response to antigen, be applied to anaphylactic disease, infectious disease, immunity lack
Fall into property disease and cancer etc..
Above the specific embodiment of the present invention is described.It is to be appreciated that the invention is not limited in above-mentioned
Particular implementation, those skilled in the art can make various deformation or amendment within the scope of the claims, this not shadow
Ring the flesh and blood of the present invention.
Claims (7)
1. an adorned oligodeoxynucleotide containing CpG sequence units, it is characterised in that the structure of described decorating molecule
Formula is shown below:
The most adorned oligodeoxynucleotide containing CpG sequence units, it is characterised in that described
Oligodeoxynucleotide contains 1-5 CpG unit, a length of 10-30nt of its chain.
The most adorned oligodeoxynucleotide containing CpG sequence units, it is characterised in that described
The site that decorating molecule is modified is 5 '-end of oligodeoxynucleotide, 3 '-end or centre position.
The most adorned oligodeoxynucleotide containing CpG sequence units, it is characterised in that described
Oligodeoxynucleotide contains the one in following sequence:
The most adorned oligodeoxynucleotide containing CpG sequence units, it is characterised in that described
The skeleton of oligodeoxynucleotide is full thio-modification, part thio-modification or without thio-modification.
6. an adorned oligodeoxynucleotide containing CpG sequence units as claimed in claim 1 is used for preparing immunity
The application of reinforcing agent.
7. an adorned oligodeoxynucleotide containing CpG sequence units as claimed in claim 1 is used for preparing treatment
Oral or the application of suction preparation of tumor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610343119.8A CN105936906B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610343119.8A CN105936906B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
| CN201310554389.XA CN103773769B (en) | 2013-11-08 | 2013-11-08 | Adorned oligodeoxynucleotide molecule containing CpG sequence units and application thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310554389.XA Division CN103773769B (en) | 2013-11-08 | 2013-11-08 | Adorned oligodeoxynucleotide molecule containing CpG sequence units and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105936906A true CN105936906A (en) | 2016-09-14 |
| CN105936906B CN105936906B (en) | 2019-06-21 |
Family
ID=50566534
Family Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610343119.8A Active CN105936906B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
| CN201610339165.0A Active CN105925583B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
| CN201310554389.XA Expired - Fee Related CN103773769B (en) | 2013-11-08 | 2013-11-08 | Adorned oligodeoxynucleotide molecule containing CpG sequence units and application thereof |
| CN201610343117.9A Active CN105936905B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
Family Applications After (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610339165.0A Active CN105925583B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
| CN201310554389.XA Expired - Fee Related CN103773769B (en) | 2013-11-08 | 2013-11-08 | Adorned oligodeoxynucleotide molecule containing CpG sequence units and application thereof |
| CN201610343117.9A Active CN105936905B (en) | 2013-11-08 | 2013-11-08 | Oligodeoxynucleotide molecule for the sequence units containing CpG being modified and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (4) | CN105936906B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105749275A (en) * | 2016-03-30 | 2016-07-13 | 山东农业大学 | Nucleic acid slow release adjuvant and preparation and use methods thereof |
| CN107099537B (en) * | 2017-04-12 | 2020-05-12 | 山东省农业科学院畜牧兽医研究所 | Duck specific CpG oligodeoxynucleotide and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101454451A (en) * | 2003-10-30 | 2009-06-10 | 科勒制药有限公司 | C-class oligonucleotide analogs with enhanced immunostimulatory potency |
| CN101517082A (en) * | 2006-09-27 | 2009-08-26 | 科勒制药有限责任公司 | CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity |
| CN102333538A (en) * | 2008-12-09 | 2012-01-25 | 科勒制药集团有限公司 | Immunostimulatory oligonucleotides |
| CN102864152A (en) * | 2005-11-07 | 2013-01-09 | 艾德拉药物股份有限公司 | Immunostimulation characteristic of oligonucleotide-based compound comprising modified immunostimulation dinucleotide |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100439386C (en) * | 2003-03-05 | 2008-12-03 | 长春华普生物技术有限公司 | Deoxyoligonucleotide containing CpG single strand for strengthening immunological effect of Protein vaccine |
| CN101085348B (en) * | 2007-06-18 | 2010-08-18 | 南京农业大学 | Nasal cavity immunity composite adjuvant for avian influenza inactivation antigen |
| CN101850117B (en) * | 2010-06-03 | 2012-05-30 | 国家兽用生物制品工程技术研究中心 | Compound immunological adjuvant and vaccine |
| US8546550B2 (en) * | 2010-11-16 | 2013-10-01 | Selecta Biosciences, Inc. | Immunostimulatory oligonucleotides |
-
2013
- 2013-11-08 CN CN201610343119.8A patent/CN105936906B/en active Active
- 2013-11-08 CN CN201610339165.0A patent/CN105925583B/en active Active
- 2013-11-08 CN CN201310554389.XA patent/CN103773769B/en not_active Expired - Fee Related
- 2013-11-08 CN CN201610343117.9A patent/CN105936905B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101454451A (en) * | 2003-10-30 | 2009-06-10 | 科勒制药有限公司 | C-class oligonucleotide analogs with enhanced immunostimulatory potency |
| CN102864152A (en) * | 2005-11-07 | 2013-01-09 | 艾德拉药物股份有限公司 | Immunostimulation characteristic of oligonucleotide-based compound comprising modified immunostimulation dinucleotide |
| CN101517082A (en) * | 2006-09-27 | 2009-08-26 | 科勒制药有限责任公司 | CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity |
| CN102333538A (en) * | 2008-12-09 | 2012-01-25 | 科勒制药集团有限公司 | Immunostimulatory oligonucleotides |
Non-Patent Citations (4)
| Title |
|---|
| LIU HP等: "《Membrane Anchored Immunostimulatory Oligonucleotides for In Vivo Cell Modification and Localized Immunotherapy》", 《ANGEWANDTE CHEMIE-INTERNATIONAL EDITION》 * |
| MENG WENJUN等: "《Nuclease-resistant immunostimulatory phosphodiester CpG oligodeoxynucleotides as human Toll-like receptor 9 agonists》", 《BMC BIOTECHNOLOGY》 * |
| 李军生等: "《一种化学修饰对寡核苷酸生物活性的影响》", 《广西工学院学报》 * |
| 段群鹏: "《模拟信号肽缀合反义寡核苷酸的合成与水解稳定性研究》", 《中国优秀硕士学位论文全文数据库基础科学辑》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103773769A (en) | 2014-05-07 |
| CN103773769B (en) | 2016-09-28 |
| CN105936905B (en) | 2019-08-30 |
| CN105925583B (en) | 2019-05-17 |
| CN105936906B (en) | 2019-06-21 |
| CN105936905A (en) | 2016-09-14 |
| CN105925583A (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3480208A1 (en) | Anti-microbial peptide derivative and application thereof | |
| Lin et al. | A novel adjuvant Ling Zhi-8 enhances the efficacy of DNA cancer vaccine by activating dendritic cells | |
| CN101790380A (en) | The conjugate and the application thereof of synthetic TLR agonist | |
| CN107012149A (en) | Regulate and control immunomodulatory oligonucleotide (IRO) compound of the immune response based on TOLL sample acceptors | |
| CN106008667B (en) | Small peptide, its application and vaccine as vaccine adjuvant | |
| Yang et al. | Preparation and antitumor effects of nanovaccines with MAGE-3 peptides in transplanted gastric cancer in mice | |
| CA2922320A1 (en) | Enhanced photochemical internalisation using a tlr ligand | |
| CN102166356A (en) | Application of alpha-mannatide as vaccine adjuvant and vaccine preparation prepared using same | |
| CN105163753A (en) | Cationic lipid vaccine compositions and methods of use | |
| EP3103807A1 (en) | Peptide/ -1,3-glucan complex and production method therefor, and pharmaceutical composition containing peptide/ -1,3-glucan complex | |
| CN109957548A (en) | A kind of dendritic cell vaccine of gene modification | |
| CN103773769B (en) | Adorned oligodeoxynucleotide molecule containing CpG sequence units and application thereof | |
| CN107281476A (en) | A kind of Antigenic Peptide RL adjuvants CpGODN7909 conjugates and its preparation method and application | |
| CN104611293A (en) | Method for inducing amplification of NK(natural killer) cells by traditional Chinese medicine combination in vitro and application of method | |
| CN107158375A (en) | Purposes of the CpG composite adjuvants in MUC1 fusion proteins are antitumor | |
| CN112516297B (en) | Preparation method and application of antigen and adjuvant co-delivery nano vaccine based on protamine as carrier | |
| CN103948910A (en) | Use of immunomodulatory polypeptide ZL-1 in preparation of anti-tumor drugs | |
| CN101636174B (en) | Method for producing a tumor vaccine | |
| CN108210922A (en) | A kind of novel cellular immunity enhancing adjuvant | |
| CN104357393A (en) | Isolated culture method of chicken intestinal tract epithelial GammaDeltaT cells | |
| CN102343103B (en) | The screening of human papillomavirus type 16 three peptide vaccine and checking and continuous expression HPV16 E5, the structure of the animal model for tumour of E6, E7 | |
| CN102212524A (en) | Oligodeoxyribonucleotide used as immunomodulator of cattle and pig and vaccine adjuvant | |
| CN105907715A (en) | Exosome of Schistosoma japonicum egg antigen (SEA) bone marrow dendritic cell origin and application thereof | |
| CN103789315B (en) | The CpG oligonucleotide that PEG modifies and application thereof | |
| CN107149671B (en) | Pharmaceutical composition and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |