CN105907765A - Optimized beta-defensin AvBD2 gene and application thereof - Google Patents

Abstract

The invention discloses an optimized beta-defensin AvBD2 gene and an application thereof. The AvBD2 gene has a nucleotide sequence as shown in SEQ ID NO:1; the AvBD2 gene can be transformed into a genetic engineering strain and is subjected to protein expression; the obtained recombinant expression protein is mixed with lactobacillus casei to prepare a novel composite microbial ecological agent. The composite microbial ecological agent has been improved on the aspects of production performance, immune performance, intestinal pH, enteric microorganisms and the like of livestock and poultry, thereby promoting growth of livestock and poultry, improving the immunity and improving the digestive rate of feed; in an antibacterial experiment in vitro, the composite microbial ecological agent has relatively good bacteriostatic activity to pathogenic entero bacteria; in an animal experiment, the mean daily gain and the immune performance of the livestock and poultry are significantly improved under the condition of not adding any antibiotic drug; the flora environment of livestock and poultry intestines is improved; and growth of the livestock and poultry is promoted.

Description

The beta-alexin AvBD2 gene of a kind of optimization and application thereof

Technical field

The present invention relates to gene engineering technology field, the beta-defensin AvBD2 base of a kind of optimization Cause and application thereof.

Background technology

From the 1950's, the sub-therapeutic dose of antibiotic would be added to promote in feedstuff the growth of animal. A large amount of antibiotic abuses in aquaculture, already lead to drug tolerant bacteria and constantly occur, some infectious pathogens are the tightest Heavily threaten the development of human health and animal husbandry.Along with improving constantly and the propagation of Drug resistance cause of disease, Europe of people's attention rate Continent has begun to forbid using antibiosis usually to promote growth of animal in animal feed.Therefore, find a kind of natural pollution-free Can the novel fodder additive of substitute antibiotics extremely urgent, it had both had antibacterial functions, can promote again growth of animal, with Reduce feeding cost.

Alexin belongs to a subtribe of antibacterial peptide family, is that the class being distributed widely in animals and plants circle is rich in cysteine The little peptide of cation.Alexin has broad-spectrum anti-microbial activity, and antibacterial, fungus, spirillum, virus etc. are all had resistance, and Sex pheromone is not likely to produce drug resistance, be host resist external invasive organism invasion and attack important defence line, simultaneously because its Persistent expression in the multiple different tissues organ of animal body, is also considered as a part for animal innate immune system, There is important physiologic function.It is mainly characterized by 3 pairs of disulfide bond that 6 cysteine residues are formed, and mature peptide is about 38 42 aminoacid, molecular mass is about 3 4kDa.According to the difference of space structure, alexin can be divided into 3 big class: α to prevent Imperial element, beta-defensin and θ alexin.Fowl alexin belongs to beta-defensin class, the 3 pairs of disulfide bond be respectively Cys 1～Cys 5, Cys 2～Cys 4 and Cys 3～Cys 6 pairing connects formation, rich in arginine, has hydrophilic and lipotropy, characteristic β Lamellar structure.Up to now, being found that 14 kinds of beta-defensins in carcass, these fowl phylaxin genes are respectively designated as AvBD1～14.Wherein fowl beta-defensin 2 (AvBD2) is distributed widely in all kinds of organ-tissues of fowl, especially at bursa, food In each organ-tissues of digestive system such as road, crop, liver stomach function regulating, expression is higher.Digestive tract is animal body and food borne pathogens Contact site, is also its infestation position.AvBD2 has good biological safety, and has stronger antibacterial activity, it is possible to press down Making or kill pathogen, this is healthy to fowl digestive tract, especially to preventing body local defense and the inflammation such as upper digestive tract infection In play an important role.In Production of Livestock and Poultry, can be used for disease preventing and treating, promote animal health cultivation, there is potential application and open Make an offer value, and molecular recombination techniques is protide or the effective way of peptides product development application.

Pichia pastoris phaff (Pichia pastoris) expression system both had the expression of prokaryotic expression system high, Can the advantage of large-scale culture, the advantage modified, process and fold after there is again the protein translation of eukaryotic expression system, and external source The hereditary stability of gene is preferable, is one of eukaryotic expression system of being widely used at present.Pichia yeast expression system has very High biological safety, it is thus achieved that being widely recognized as including U.S. FDA.Pichia sp. self secretes minimal amount of albumen, easily Isolated and purified in heterologous protein, and there is post translational processing and modify in albumen of its secretion, is closer in native protein Conformation and activity, be therefore more suitable for the expression of eukaryotic gene.Excellent because its expression is stable, fermentation technology is ripe etc. again Point, and one of become the most most popular heterologous protein gene expression system.Alcohol oxidase AOX1 promoter (pAOX1) is P.pastoris applies more promoter in expressing, and its methanol induction is the strongest.But sweat needs use poisonous volatilization The methanol of property, as derivant, needs the conversion of carbon source, thus inconvenient operation, and the production cycle of foreign protein is longer.Sweet Oil aldehyde 3 phosphate dehydrogenase promoter (pGAP) is the composing type strong promoter of P.pastoris, has been used for expressing much allos Albumen, and obtain the yield similar to pAOX1.Additionally, GAP promoter has many advantages: recombinant bacterium sweat is simple, peace Quan Xinggao and need not storage and the transport of a large amount of methanol, is more suitable for large scale fermentation and produces, have the potential of cultivation continuously, and Reduce the production cost of destination protein.

Yeast single cell protein has obvious advantage as feedstuff, such as protein content about 50% in yeast dry matter 60%；Containing abundant enzyme in yeast, containing beta glucan (57.0%), mannan (6.6%), glycoprotein And chitin isoreactivity composition (22.0%)；Containing various aminoacid, particularly plant necessary to animal body in protein The lysine, methionine and the tryptophane that lack in feedstuff are more, and biological value is significantly better than phytoprotein, unicellular The digestibility of albumen is up to 85%～90%；Both animal was had growth promoting function, immunity of organism can be improved again, to animal Speech, yeast feed is a kind of preferably biological activity protein feedstuff.

Summary of the invention

It is an object of the invention to overcome the deficiencies in the prior art, it is provided that the beta-defensin AvBD2 gene of a kind of optimization And application, to provide the AvBD2 gene order of a kind of optimization, for replacing antibiotic to prepare the fowl biology of Novel pollution-free Feed additive.

The present invention is achieved by the following technical solutions:

The invention provides the beta-defensin AvBD2 gene of a kind of optimization, described AvBD2 gene has such as SEQ ID NO: Nucleotide sequence shown in 1.

Present invention also offers a kind of above-mentioned AvBD2 gene as the application in livestock biological feed additive.

Present invention also offers a kind of recombinant expression carrier containing above-mentioned AvBD2 gene.

Preferably, described recombinant expression carrier is to integrate pGHK that is that have AvBD2 gene order and that do not contain ammonia benzyl Amp resistance Alpha expression carrier.

Present invention also offers a kind of genetically engineered bacteria containing above-mentioned AvBD2 gene, described genetically engineered bacteria contains State recombinant expression carrier, or, the genome of described genetically engineered bacteria is integrated and has the above-mentioned AvBD2 gene order of external source.

Preferably, described genetically engineered bacteria is the Pichia pastoris GS115 bacterial strain containing above-mentioned AvBD2 gene.

Present invention also offers a kind of recombinant expression protein utilizing above-mentioned genetically engineered bacteria to prepare, its feature exists In, the preparation method of described recombinant expression protein is:

(1) described genetically engineered bacteria is fermented, it is thus achieved that fermentation liquid；

(2) take the supernatant of fermentation liquid, concentrate, it is thus achieved that described recombinant expression protein.

Present invention also offers a kind of microbial ecological agent containing above-mentioned recombinant expression protein, described microbial ecological agent is served as reasons Lactobacillus casei mixes according to volume ratio 1:10 with described recombinant expression protein, and wherein, the concentration of described lactobacillus casei is 6 × 10⁹CFU/mL, the concentration of described recombinant expression protein is 2.6mg/mL 5.2mg/mL.

The present invention has the advantage that the beta-defensin AvBD2 base that the invention provides a kind of optimization compared to existing technology Cause and application thereof, the fowl utilizing the beta-defensin AvBD2 gene of this optimization to can be used for replacing antibiotic to prepare Novel pollution-free is used Biology feed additive, i.e. compound micro-ecological preparation.This compound micro-ecological preparation can Direct-fed poultry, the productivity to poultry The aspects such as energy, immune performance, intestinal pH, enteric microorganism have improvement, may advantageously facilitate the growth of poultry, improve immunity, Increase the digestibility of feedstuff.It addition, utilize in compound micro-ecological preparation bacteriostatic test in vitro prepared by AvBD2 gene, to intestinal Road pathogenic bacterium have preferable bacteriostatic activity, in detoxification experiment in vivo, in the feelings without any antibiotic medicine Under condition, significantly improve average daily gain and the immune performance of poultry, improve the flora environment of animal and bird intestines, promote poultry Growth.

Accompanying drawing explanation

Fig. 1 be lactobacillus casei growth curve；

Fig. 2 is restructuring strains A vBD2 In Vitro Bacteriostasis detection；

Fig. 3 is different days broiler cecal content ERIC-PCR testing result；

Fig. 4 is different days broiler ileal contents ERIC-PCR testing result.

Detailed description of the invention

Elaborating embodiments of the invention below, the present embodiment is carried out under premised on technical solution of the present invention Implement, give detailed embodiment and concrete operating process, but protection scope of the present invention is not limited to following enforcement Example.

Embodiment 1

1, material

1.1, YPD culture medium: include the yeast powder of 10g/L, the D of peptone B and 20g/L of 20g/L～anhydrous glucose, Sterilizing 15 minutes at 115 DEG C.

1.2, MRS culture medium: include the peptone of 10.0g/L, the beef powder of 8.0g/L, the yeast powder of 4.0g/L, The glucose of 20.0g/L, the dipotassium hydrogen phosphate of 2.0g/L, the citric acid hydrogen diamine of 2.0g/L, the sodium acetate of 5.0g/L, 0.2g/L Magnesium sulfate, the manganese sulfate of 0.04g/L and the tween of 1.0g/L～80, at 25 DEG C regulate pH value to 5.7 ± 0.2, go out at 118 DEG C Bacterium 15 minutes.

1.3, LB culture medium: include the tryptone of 10.0g/L, the yeast leaching powder of 5.0g/L and 10.0g/L sodium chloride, 25 At DEG C, regulation pH value is to 7.0 ± 0.1, sterilizing 15 minutes at 121 DEG C.

1.4, MD culture medium: measure distilled water 800mL, 121 DEG C of autoclaving 20min, be cooled to 50～60 DEG C, adds 100mL 10×D、100mL 10×YNB、2mL 500×B.Solid medium adds 15g agar, and the flat board prepared is placed in 4 DEG C save backup.

Above culture medium adds the agar of 2g/L, is configured to solid medium.

2, step

2.1, the cultivation of lactobacillus casei

Under aseptic condition, take lactobacillus casei freeze-drying lactobacillus, MRS solid medium is coated with, at 37 DEG C, stand anaerobism Cultivation 20h, picking list bacterium colony, purification of ruling further on MRS solid medium, after 37 DEG C are cultivated 20h, picking list bacterium colony, Be inoculated in the MRS fluid medium of 100mL, anaerobism quiescent culture at 37 DEG C, respectively at 0h, 2h, 4h, 6h, 8h, 10h, 12h, 14h, 16h, 18h, 20h, 22h, 24h, 26h, 28h, 30h, 32h, 34h, 36h, 38h, 40h take cultivation bacterium solution, at absorbance Measure OD value under 600nm, obtain lactobacillus casei growth curve, described growth curve is as it is shown in figure 1, permissible from Fig. 1 Finding out, lactobacillus casei is in exponential growth later stage to the stable phase later stage when 24～48h, and fetching number Later growth is to stable phase The lactobacillus casei bacterium solution in later stage, is inoculated in MRS culture medium, 37 DEG C of anaerobism quiescent culture 15-24h, it is thus achieved that lactobacillus casei Culture fluid, bacterial concentration is 6 × 10⁸‐8×10⁸CFU/mL。

2.2, the preparation of GS115/AvBD2

A, the synthetic nucleotide sequence as shown in SEQ ID NO:1, it is thus achieved that the AvBD2 genetic fragment after optimization, described 5 ' ends of the AvBD2 gene after optimization are containing EcoR I restriction enzyme site, containing 6 encoding histidines after EcoR I restriction enzyme site Codon, 3 ' ends of AvBD2 gene after optimization are containing Not I restriction enzyme site, and full length gene is 143bp.

B, by after above-mentioned optimization AvBD2 gene insert constitutive expression carrier pGHK α EcoR I and Not I site it Between, it is thus achieved that pGHK α-AvBD2 recombiant plasmid, by the Sac I and Bgl II double digestion linearisation of pGHK α-AvBD2 recombiant plasmid, goes Except Amp resistant gene, and after CIAP removes phosphorylation, electricity converts to efficient Pichia pastoris GS115 competent cell.

C, utilize MD flat board primary dcreening operation and bacterium colony PCR evaluation and screening to go out positive recombinant bacterial strain GS115/AvBD2, and resist through G418 Property screening height copy recombinant bacterial strain.Measure bacterial strain concentration by fixed point and determine the optimal incubation time of recombinant bacterial strain.Such as Fig. 2 institute Show, for recombinant bacterial strain GS115/AvBD2 bacterial strain colony morphology figure.

2.3, the preparation of recombinant expression protein

Under the same conditions, the above-mentioned positive recombinant bacterial strain GS115/AvBD2 of different copy numbers is carried out cultivation table respectively Reach foreign protein particularly as follows: picking pGHK α AvBD2 identifies correct positive transformant, be inoculated into 5mLYPD culture fluid respectively In, cultivate in 28 DEG C of 200r/min overnight shakings.Overnight culture is arranged with the ratio of 10% and is inoculated into 50mL fermentation medium bottle In, cultivate 48h in 28 DEG C of 200r/min.And 4 DEG C, 12000g be centrifuged 10min, collect supernatant, i.e. obtain restructuring AvBD2 table Reach albumen.Measuring protein concentration in culture fluid, select high expressed bacterial strain, recycling high expressed bacterial strain carries out fermentation culture, Obtaining fermentation liquid, now protein expressioning product direct secretion is to outside born of the same parents, is centrifuged by fermentation liquid, takes supernatant, is described restructuring table Reach albumen.

2.4, the preparation of compound micro-ecological preparation

Take the exponential growth later stage lactobacillus casei bacterium solution to the stable phase later stage of step 2.1, with the restructuring table of step 2.3 Reach albumen to mix according to volume ratio 1:10 according to the restructuring AvBD2 Yeast engineering bacteria of volume ratio, it is thus achieved that two kinds of bacterium solution compound micro- Ecological agent.

3, effect identification

3.1

The extracorporeal bacteria inhibitor test of restructuring AvBD2: picking indicator bacteria list bacterium colony, is inoculated in 5mL LB culture fluid, and 37 DEG C are shaken Swing incubated overnight, take the LB culture medium mixing with 45 DEG C of the 10 μ L bacterium solution, be taped against in flat board, thickness about 3mm, uniform on flat board Lay 4 holes.Add 50 μ L testing samples in hole, cultivate 6～12h for 37 DEG C, inhibition zone situation around observation port.To add 30 μ L Ampicillin (Amp, 100 μ g/mL) or kanamycin (Kana, 50 μ g/mL) are positive control, with same process The expression supernatant concentrated solution of GS115/pGHK α and PBS are negative control.Interpretation of result: use agar diffusion method detection restructuring To escherichia coli, staphylococcus aureus, enterococcus faecalis, pasteurellosis bacillus, Pseudomonas aeruginosa and clostridium perfringen whether AvBD2 Having bacteriostatic activity, result is as shown in Figure 3.Inhibition zone all occurs around sample well and antibiotic control wells, and with same process Around the expression supernatant concentrated solution of GS115/pGHK α and PBS well, inhibition zone does not occurs.

The preparation of 3.2 bacterium solution and the packet of experimental animal

Lactobacillus casei is inoculated in MRS fluid medium by the inoculum concentration of 2%, 30 DEG C of quiescent culture 42h；Restructuring AvBD2 Pichia sp. group is inoculated in fermentation medium by the inoculum concentration of 10%, 28 DEG C, 200r/min shaking table concussion cultivation 48h； After yeast culture terminates, regulation bacterial concentration is to 6 × 10⁸CFU/mL。

60 white meat-type chickens are randomly divided into two groups, often group 30.Being respectively C and T group, C group is blank group, T group For the compound formulation group of the lactobacillus casei that ratio is 1:10 and AvBD2 Pichia sp. group of recombinating, the test period is 42d.

3.3 impacts on broiler average daily gain

Within first week, in drinking-water, add 6 × 10 in the ratio of 1:20⁸The lactic acid bacteria of CFU/mL, Pichia sp., second week is opened Begin to add 6 × 10 in the ratio of 1:10 in drinking-water⁸The lactic acid bacteria of CFU/mL, Pichia sp., free choice feeding, freely drink water.

Weighing chicken respectively at the 1st, 7,14,21 and 42 ages in days, before weighing, 12h stops material, does not cuts off the water, second day early morning 8:00 carries out weighing on an empty stomach, calculates average daily gain.

Computing formula:

Average daily gain ADG (g)=(test average weight in latter stage initial stage average weight) ÷ tests natural law

The detection compound micro-ecological preparation impact on the average daily gain of broiler, it is thus achieved that result as shown in table 1 below:

Table 1: the compound micro-ecological preparation impact on the average daily gain of broiler

Note: for the same string of form, letter is identical to be indicated without significant difference, and letter is different indicates significant difference, Lowercase alphabet shows that significant difference, capitalization represent that difference is the most notable

3.4 impacts on broiler immune organ index

Testing 7d, 21d, 42d, often 5 chickens of group extraction weigh body weight collare venesection and butcher, pluck respectively thymus, Fabricius bursa and spleen are also weighed, Computation immunity shoot formation.

Computing formula: Immune Organs Index=immune organ fresh weight (g) ÷ Slaughter weight (kg)

The detection compound micro-ecological preparation impact on different days broiler Immune Organs Index, it is thus achieved that as shown in table 2 below Result:

Table 2: the compound micro-ecological preparation impact on different days broiler Immune Organs Index

Note: C group is blank group, T group is experimental group.

As shown in Table 1, during 7 age in days, the index and spleen index of T group broiler is significantly higher than C group (P < 0.05)；21 ages in days and 42 ages in days Time, the index and spleen index of two groups of group broiler does not shows difference (P > 0.05).The thymus index of T group broiler and bursal index are three Individual age in days is above C group, and thymus index is extremely notable (P < 0.01) at 7 ages in days and 42 age in days differences, and bursal index is 21 Age in days difference is extremely notable (P < 0.01).These results suggest that, although compound micro-ecological preparation is in terms of improving broiler index and spleen index DeGrain, but have obvious effect in terms of the thymus improving broiler and bursal index.

3.5ERIC-PCR method detection compound formulation is on broiler caecum and the impact of ileum flora:

Take broiler cecal content and ileal contents, utilize in ERIC-PCR detection cecal content and ileal contents Bacterial genomes repetitive sequence, it is thus achieved that such as the electrophoretogram of Fig. 3 and 4, specific experiment is:

Using each group of broiler excrement sample as STb gene template, carry out ERIC-PCR fingerprint map analyzing intestinal microflora.Reference ERIC PCR document synthetic primer (forward primer ERIC 1:ATGTAAGCTCCTGGGGATTCAC and downstream primer ERIC 2: AAGTAAGTGACTGGGGTGAGCG), the PCR for Bacterium entericum ERIC sequence expands.

3.5.1 the collection of sample

Testing 7d, 21d, 42d, often 5 chickens of group extraction, carry out jugular vein sacrificed by exsanguination, cut open the belly rapidly and take caecum and return Intestinal middle-end content.

3.5.2 the pretreatment of sample

(1) under aseptic condition, caecum and the ileal contents of taking-up are mixed respectively, respectively take out about 2g excrement sample, add respectively Entering 10mL sterilizing TE buffer, whirlpool concussion is cleaned, and stands 3min.

(2) taking supernatant in clean 10mL centrifuge tube, 4 DEG C, 400rpm is centrifuged 10min, takes supernatant.

(3) being proceeded to by supernatant in clean 10mL centrifuge tube, add appropriate TE buffer, whirlpool shakes 3min, the most outstanding Floating cleaning thalline, 600rpm is centrifuged 3min, takes supernatant.

(4) supernatant 8000rpm is centrifuged 15min, abandons supernatant, add the appropriate resuspended thalline of TE buffer.

(5) 8000rpm is centrifuged 15min, abandons supernatant, precipitation is proceeded in the 2mL centrifuge tube of sterilizing.

(6) adding 700 μ L, the acetone of 20 DEG C of pre-coolings, precipitation is cleaned in the concussion of abundant whirlpool, and 8000rpm is centrifuged 15min, abandons Supernatant takes precipitation (this step is repeated twice).

(7) repeating (6) step pure water and clean precipitation, 8000rpm is centrifuged 15min, abandons supernatant and takes precipitation.

3.5.3 the extraction of bacteria total DNA

Extracting with bacterial genomes DNA small volume of reagent box, concrete operations are carried out by test kit description:

(1) taking above-mentioned pretreated sample, 12000 × g is centrifuged 30s, abandons supernatant, has added RNase A's with 150 μ L The resuspended precipitation of Buffer S.

(2) add 20 μ L lysozyme stock solutions, after mixing, stand 5min.

(3) add the EDTA (pH is 8.0) of 30 μ L 0.25M, ice bath 5min after mixing.

(4) add 450 μ L Buffer G A, 65 DEG C of water-bath 10min after whirlpool concussion 15s.

(5) adding 400 μ L Buffer G B and 950 μ L Buffer DV (4 DEG C of pre-coolings), after mixing, 12000 × g is centrifuged 2min。

Abandoning clean upper phase the most as far as possible, retain INTERPHASE CARBIDE PRECIPITATION and lower phase, add 950 μ L, 4 DEG C of pre-cooling Buffer DV, after mixing 12000 × g is centrifuged 2min.

(7) abandoning phase, by lower phase transfer to filter, 12000 × g abandons filter after being centrifuged 1min, adds 400 μ L Buffer BV in filtrate, mixing.

(8) be placed in preparing pipe in 2mL centrifuge tube, by step (7) in mixed liquor move into preparation pipe, 12000 × g be centrifuged 1min。

(9) abandoning filtrate, add 500 μ L Buffer W1,12000 × g is centrifuged 1min.

(10) abandoning filtrate, add 700 μ L Buffer W2,12000 × g is centrifuged 1min.

(11) repeat step the most once.

(12) abandoning filtrate, 12 000 × g is centrifuged 1min.

(13) will prepare pipe in another clean 1.5mL centrifuge tube, add 100 μ L and be preheating to the Eluent of 65 DEG C and arrive Silica film central authorities, after standing 1min, 12 000 × g is centrifuged 1min eluted dna.

3.5.4ERIC PCR amplification

According to the research experience that this laboratory is conventional, take pictures, analyze gained band number and brightness under different temperatures, with choosing Select optimum annealing temperature.

3.5.5ERIC the Detection of Stability of PCR

With same lactic acid bacteria, colibacillary DNA sample as template, with identical reaction system, with the suitableeest annealing temperature Under, carrying out respectively 3 times repeating test in different time, PCR primer is electrophoresis detection on the agarose gel of 2%, in order to verify The stability of set up ERIC PCR reaction system.

3.5.6 the ERIC PCR fingerprint map analyzing of caecum and ileum intestinal microbial population STb gene

Respectively with the intestinal STb gene of the caecum carried and ileum as template, ERIC PCR reaction system is set such as Under:

PCR response procedures is as follows:

Amplified production electrophoresis detection taking pictures with gel imaging system on 2.0% agarose gel.Use and analyze The ERIC PCR finger printing of each test group caecum when different days and two intestinal segments of ileum is carried out by software NTSYS2.1 Band counts, and calculates index of similarity Cs by Dice method, with UPGMA (unweighted pair group mean Average) multiformity of intestinal microbial population is carried out cluster analysis.Dice method gained correlation coefficient is not because of by ERIC PCR fingerprint The impact that in collection of illustrative plates, band is strong and weak, is a kind of relatively objective evaluation.

From the figure 3, it may be seen that respectively the band of group broiler caeca samples focuses mostly between 100bp 1000bp.Broiler is at 7 ages in days Time just have the band of relatively horn of plenty, show now to have bacterial strain field planting in caecum.The band number of T group Intestine of Broiler is significantly higher than C group, illustrates that the multiformity of this T group intestinal microbial population is enriched and population density is higher.7,14,21 age in days time, same group of different days Between collection of illustrative plates master tape position and signature band quantity all change and differ, it is shown that the unstability of Intestine of Broiler dominant microflora, But the quantity of band is in rising trend, show that the multiformity of microbiologic population is gradually stepping up.After 28 ages in days, each experimental group collection of illustrative plates Master tape change inconspicuous, illustrate that in microbiologic population, dominant microflora is the most stable.

As shown in Figure 4, the band of each group broiler ileal samples focuses mostly between 250bp 2000bp.Broiler is at each age in days Section, T group Intestine of Broiler just has the band number of relatively horn of plenty to be significantly higher than C group, shows now to have bacterial strain field planting, T group intestinal The multiformity of group is abundant and population density is higher.Along with age in days increases, the TuPu method band between same group of different days Quantity and brightness are in rising trend, show that the multiformity of microbiologic population and population density are gradually stepping up.After 28 ages in days, each group Intestinal microbial population compositional similarity is the highest, illustrates that the dominant microflora in this Intestine of Broiler microbiologic population the most stable time period.

From Fig. 3 and 4, within the whole test period, each group bin number of broiler ileum collection of illustrative plates, brightness and main bar All there is notable difference in position, signature band quantity and the position etc. of band, bin number is substantially few compared with caecum, says with caecum The caecum of bright broiler is different with dominant microflora with the kind of the flora in ileum, and the microbiologic population's abundance in ileum and population Density is low compared with caecum.AvBD2 recombination yeast is to improving intestinal environment, and improving intestinal microbial population richness has significantly effect.

Sequence table

<110>Agricultural University Of Anhui

<120>the beta-alexin AvBD2 gene of a kind of optimization and application thereof

<160> 3

<170> PatentIn version 3.5

<210>1

<211>this sequence relates to amino acid residue or base are total: mature peptide contains 39 amino acid residues, C-terminal 5 Individual amino acid residue

<212>nucleic acid species: DNA

<213> Gallus gallus (chicken)

<400> 1

1 aagagggtct caaatcccac agtcaaagcc ctctggaggg aagagaccaa gaggtgttct

61 ggtttggctt ttgggctcat ctaatatccg gtaacgtctc agttcttttc agtctttctt

121 ttaatgtctt ctgtgttttt gaaaagaaaa caaattatat atatatacat gtgtgagtgt

181 cctcagcgtt attaatctaa acctgtaggc ttctaaaaaa aaaaattgga tgtaagttta

241 tcagcattac taaggttgaa taagtggttc aaatatgtgc tagtatcttt gtaggctttg

301 gtaaagcagg ctttggtaaa gataccccac ttgttaattc caaggagaaa aatggggtga

361 ggtcgagctg agaagctgct ggtctcttag aaaccaacat atgtttagta tcagtgttaa

421 gaagttcctt tcatttgcag gattaggttt actttgctta cttatttctc ctggtatttc

481 caaatataga gaattttgct ccaacttctg atgccggttt ctaatctgct ttgggctact

541 ccttaccatt ccatctgcag aaatgcaatt catcacaacc tcatttccct gcagtgctta

601 agagaaaaca atgcagaagg ctgaaagatg aatgaatgat attaactgcc tcccttctat

661 ccataagccc agttaggaca tcttatccca ctttgcttac gttagttgcg tcagtcattg

721 actcttccaa ggacttcatt acaggattgc ttttaaatgt ctcttgtcag ctgggaacag

781 atttggttgt ttttggaatt tggagtttcc attcctgagt gatcatctgt agactaaagc

841 tgaagatcat gagcaaattg cttttgctaa gtttcaacac tgcgaaatga acacgttatt

901 tctgtcattt ataagctcgg atgtagaacc acctcactgt gctcagtggg gtttatttat

961 tagataaaac gttgaaccgg gcatgaggtg ttgtctgtat tttggccaag gagtatttgc

1021 aaagcgtggc aggaaatctg aattagaaca gcttaataaa cacaaatcct gagatatgta

1081 tttatatccc atgctgctcc ttgctttctt tcccccagaa atgcccacag agcatccatg

1141 aggtcatgga ggtatttctg aatttgaaga aaatgtaata taaatgccgt tttatctgta

1201 cagctcagaa gactgtagat tccagggact gcctgccaca tacatttctt cttccttttc

1261 cctgtagcag ctcagcagat ctgcagccat gaggattctt tacctgcttt tctctctcct

1321 cttcctggca ctccaggctt ctccaggtaa gatgaaagag gaattaaagg ggaggataac

1381 gactgggtta tggggaaggg tttgcagacc cgctttgtga gctcaccttt caacgtggcc

1441 aaaccctcac agcagtcctt aaggcagctg agtgagtgga gctgccttgc cttgcagaat

1501 cagagggaac ttggttgctg ttgttgcagg gttgtcttcg ccccggcggg acatgctgtt

1561 ctgtaaagga gggtcctgcc actttggagg gtgtcccagc catctaatca aagtcggaag

1621 ctgcttcggg ttccgttcct gctgcaaatg gtgagtttga ccttcactga cgttcatcca

1681 tcgcgtaagt ggacaaatgc attttaccca agatgctgct gaatgttcgg tcttggattt

1741 atgaaggaaa cagtacatta cgagggcagc ctggtgtaag ttgctagtag ggctttacag

1801 ttgtctttct cctgagatgt gctgctgagg tgtacaccat gatgtgtcca ggcacaaagg

1861 gtaaagtatg gccatagatg ccagccacgt gcagtcccag ctctttgctt ataagtccca

1921 gcccttatag ctcctctgcc agggggtttt gtattttcag aactgggctg ttatggtgca

1981 tggggaacaa aagggttgcg ctgcagggtg aacacggatc tgagtgcagt tgagtctgtg

2041 caaaaagtga aactgcatca aaagaaaatc taatgccatt gggactgaac gcactcaccc

2101 caaggccagg ggataccaat tcagttccct gcttttcccg gagcgatagc aaagcactcc

2161 tcccagtcag atgggactgc acaaggctgt cccaatccga cttgcatgtg acaataggta

2221 ttttggaatg tatataacca agaggaagac gtgcatggat tgagagcgag tagggaagga

2281 atgtaaatac aaaaacaatc tgatttcttt gtctgtttgt gcaggccttg gaatgcataa

2341 acacttcatg agtccattca agagctttga aaatttcttc caggcatgtg ctttaaatgc

2401 tacagcaaag cctcagcagc aagaagaccc ctctcatgtg ttaatgcaat atgttttgtg

2461 ttgtagagta aatacaaata tcttctgcac tgcctttctt cctcttgaat aaattgtcat

2521 tgcatagca

<210>2

<211>22

<212>nucleic acid species: DNA

<213>synthetic

<400>2

GTCCCTATTT CAATCAATTG AA 22

<210>2

<211>21

<212>nucleic acid species: DNA

<213>synthetic

<400>3

GCAAATGGCA TTCTGACATC C 21

Claims (8)

1. the beta-alexin AvBD2 gene optimized, it is characterised in that described AvBD2 gene has such as SEQ ID NO:1 institute The nucleotide sequence shown.

2. an AvBD2 gene as claimed in claim 1 is as the application in livestock biological feed additive.

3. the recombinant expression carrier containing AvBD2 gene as claimed in claim 1.

Recombinant expression carrier the most according to claim 3, it is characterised in that described recombinant expression carrier is that integration has AvBD2 gene order and without the pGHK alpha expression carrier of ammonia benzyl Amp resistance.

5. a genetically engineered bacteria, it is characterised in that described genetically engineered bacteria contains recombinant expressed load as claimed in claim 4 Body, or, the genome of described genetically engineered bacteria is integrated and has the AvBD2 gene order as claimed in claim 1 of external source.

A kind of genetically engineered bacteria the most according to claim 5, it is characterised in that described genetically engineered bacteria is containing described The Pichia pastoris GS115 bacterial strain of AvBD2 gene.

7. one kind utilizes the recombinant expression protein that genetically engineered bacteria as claimed in claim 6 prepares, it is characterised in that institute The preparation method stating recombinant expression protein is:

(1) described genetically engineered bacteria is fermented, it is thus achieved that fermentation liquid；

(2) take the supernatant of fermentation liquid, concentrate, it is thus achieved that described recombinant expression protein.

8. the microbial ecological agent containing recombinant expression protein as claimed in claim 7, described microbial ecological agent is for by doing Lactobacillus paracasei mixes according to volume ratio 1:10 with described recombinant expression protein, and wherein, the concentration of described lactobacillus casei is 6 × 10⁹CFU/mL, the concentration of described recombinant expression protein is 2.6mg/mL-5.2 mg/mL.